CN103131709A - Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control - Google Patents
Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control Download PDFInfo
- Publication number
- CN103131709A CN103131709A CN2013100532352A CN201310053235A CN103131709A CN 103131709 A CN103131709 A CN 103131709A CN 2013100532352 A CN2013100532352 A CN 2013100532352A CN 201310053235 A CN201310053235 A CN 201310053235A CN 103131709 A CN103131709 A CN 103131709A
- Authority
- CN
- China
- Prior art keywords
- gene
- zfx
- mouse
- rna
- interference fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a ribonucleic acid (RNA) interference fragment of a zinc finger-x (zfx) gene, a carrier formed by the RNA interference fragment and application of the RNA interference fragment in mouse filial generation sex control. The RNA interference fragment has the advantages of hindering, harming or destroying normal development and functions of X-sperms by silencing the zfx gene in an X-sperm of a generative cell of a male mouse. Multiple fertilization chances are provided for a Y-sperm when the male mouse is mated with a female mouse, the sex of a mouse is effectively controlled before fertilization, accordingly the male mouse rate of F1 generation mice is greatly improved, required spermatid is not hurt, and spermatid vitality is not reduced, and the cost is low.
Description
Technical field
The present invention relates to the molecular genetics field, being specifically related to can be reticent
zfxRNA interference fragment and the application thereof of gene.
Background technology
Under field conditions (factors), nearly all mammiferous sex ratio is all near 1:1, thereby realized stably producing offspring without interruption, is issued to the eubiosis in the condition of nature.For reality was produced in herding, desirable sex ratio tool was of great significance.The manufacturing enterprise that utilizes lactation, egg-laying deseription to produce wishes to obtain more female individuals, and produce meat, produce the hair proterties show to such an extent that dominance is more obvious on male.All the time, the mankind just have great interest to the sex of controlling the animal offspring.Sex control is mainly carried out from prefecundation and latter two aspect of being fertilized at present, and the former uses and is fertilized after sperm separates again, and makes the sex that has just determined the offspring at the time of fertilization; The latter adopts early embryo sex to identify, the method for carrying out embryo's sex screening is controlled offspring's sex.
The mammal sex determination theory thinks, sex chromosome just can develop into female individuals for the zygote of " XX ", and sex chromosome is that will developing into of " XY " is male.So fundamentally, controlling the optimal method of Livestock Sex is first to separate X, y sperm, and then is fertilized, and just can control artificially offspring's sex, and this is approach simple, the most most economical in sex control in theory.After the 1950's, the research report of separating about sperm is a lot, the physical property (volume, density, electric charge, mobility) of utilizing the X sperm different with y sperm is all attempted in these researchs), adopt the diverse ways such as centrifuging, electrophoretic method, ion exchange method, cell-surface antigens method to realize the separation of sperm, but a common problem arranged---repeatable poor.And and these differences change along with the difference of envrionment conditions, therefore, many results of study are usually inconsistent, opposite conclusion even occurs, cause some Difference of two class sperms to have dispute.Up to the present, except X, y sperm DNA content have difference can affirm, otherwise difference performance is very little, even is difficult to determine.But along with the development of Protocols in Molecular Biology, and the continuation of research work deeply, and new achievement in research will continue to bring out.
The principle that there are differences according to Mammals X, y sperm DNA content at present, utilize wandering cells retrieval instrument to separate X, y sperm, separating effect is best, purity is more than 90%, but due to apparatus expensive, the reasons such as velocity of separation is slow, and the sperm quantity that is used for fertilization is few, vigor is poor can not satisfy far away and produce upper heavy demand to sexing semen.By contrast, if can find in two kinds of sperm developments or fertilization process, even critical X, the special mRNA of Y chromosome during fetal development, utilize RNA to disturb (RNA Interference in conjunction with contemporary emerging Protocols in Molecular Biology, RNAi) method is expected to lower cost, and is easy, realize sex control to animal rapidly.
RNAi is gene silencing (the Post-transcriptional Gene Silencing after a kind of transcribing, PTGS) phenomenon, by the double-stranded RNA (Dubble-stranded RNA.dsRNA) that produces in external synthetic or the body mRNA in its homology of cell internal specific ground degraded, make corresponding gene disturb, realize stoping the expression of target gene.The RNAi method can be lowered the genetic expression in cell quick, easy, effectively, specifically, and it does not still study a kind of powerful of gene function, and for the specific gene treatment provides new technique means, its application prospect is very wide.
Research at genome, mRNA and protein level all proves, X, y sperm genetic expression there are differences really.Genetic expression detects and studies show that, in the reduction division pachytene stage that sperm forms, has an effect for preventing some enzymes and sex chromosome, and two concentrated gonosome bodies that form of sex chromosome height.Sex chromosome has been protected in the formation of gonosome, and on sex chromosome, the expression of special gene is closed.Therefore, there is no transcribing of mRNA in the Mammals mature sperm, yet but contain mRNA in the Mammals mature sperm, this species diversity is from transcribing in during spermatogenesis, and its translation far lags behind transcribes.These mRNA instruct more synthetic necessary albumen after spermioteleosis, or after fertilization is to the replenishing of ovocyte mRNA storehouse, or as RNAi, fertility and embryo growth and development are played a part key.
Hendriksen etc. find the research of mouse, in the reduction division process, remove
XistOutside genetic expression, nearly all sex chromosome gene does not all have to express, however meiosis anaphase, and some sex chromosome specific genes begin to express.Postmeiotic detects on Y chromosome
UbelyWith
SryGene has higher mRNA level; Ubelx gene mRNA high level expression also detected in the X sperm, find simultaneously the X chromosome specific gene
Mhr6AExpression product.The somebody finds the expression of X, other specific genes of Y chromosome in addition, as the X chromosome specific gene
Akap82(skelemin of sperm tail) and Nap-X (a kind of nuclear phase of encoding closes albumen), the Y chromosome specific gene
Zfy-1, Zfy-2And
Y353/B
Wherein
Zfx/ZfyGene is the pair of alleles of encoding zinc finger protein on karyomit(e), expresses since meiophase, and the content in round spermatid is the highest.
ZfxGene is
ZFYA member in (zinc finger-Y) gene family,
ZFYFamily comprises
Zfx, ZfyWith
ZfaGene, they are closely similar on molecular structure.General Mammals has
ZfxWith
ZfyGene, the Zfx gene is positioned on X sex chromosome, is gene female, that the boar X chromosome must contain,
ZfyGene is positioned on Y sex chromosome, and two genes are positioned at heterosomal end, but is not positioned at the homology zone.
ZfxGene comprises transcribing of an acidity exciting zone, and nuclear localization sequence and a DNA joining region have 13 C2H2[Cys (2) His (2)] the type zinc fingers.In mammalian cell, the C2H2 zinc fingers is one of modal protein structure.At present found that kind more than 800 has the protein of this zinc fingers, has important physiological function.
Zfx/ZfyThe albumen of coding has some functions and relevant with the generation of sperm as transcription factor in the sperm forming process.
Summary of the invention
Purpose of the present invention is exactly for above-mentioned defective of the prior art, provide based on the RNA perturbation technique for
zfxThe RNA interference fragment of gene.
To achieve these goals, technical scheme provided by the invention is: the RNA interference fragment of zfx gene has following arbitrary sequence:
siRNA 1：GAACTGAATGTCGCTGAGATT，
siRNA 7：GGACTATCCTCATAAGTGTGA，
siRNA 9：GGTGCAGTGAGAATACATTAT。
Second purpose of the present invention has been to provide
zfxThe expression vector of gene RNA interference fragment, this expression vector clone has arbitrary RNA interference fragment as claimed in claim 1.
Further, above-mentioned expression vector has the sequence shown in SEQ ID NO:1,2 or 3.
The 3rd purpose of the present invention has been to provide
zfxThe application of the RNA interference fragment of gene in controlling the mouse sex of children.
Further, above-mentioned application, described control method is, with the RNA interference fragment of zfx gene, the zfx gene in the mouse sperm cell carried out silence, produces the spermatid of particular type.
Beneficial effect of the present invention is: RNAi interference fragment provided by the invention, and by in the sexual cell X sperm of male mice
zfxGene carries out silence, hinders, damages or destroy normal development and the function of X sperm.Give with the female mice mating time and the y sperm chance of more being fertilized, thereby in the sex that effectively controlled mouse prefecundation, F1 is raise greatly for the male mouse rate that mouse produces.Present method can injury to required spermatid or is reduced its vigor, and with low cost.
Detailed process of the present invention is:
One, material and concrete grammar:
1, build the RNAi interference carrier of zfx gene:
The zfx gene order of using comes from the NCBI gene pool, filters out 10 siRNA fragments according to RNAi principle of design and the compare of analysis result on NCBI, and is as shown in table 1, for being used for siRNA's
zfxThe cDNA template.Add Ecor I and Bam I restriction enzyme site in 5 ' and 3 ' of each siRNA fragment respectively, as shown in table 2, then send biotech firm to synthesize the siRNA fragment.Positive and negative adopted chain is combined into two strands by annealing and is connected to RNAi-Ready pSIREN-RetroQ-ZsGreen Vector(Clontech, the U.S.) on carrier, as shown in Figure 4, then be transformed into (Tiangen in E. coli DH5 α competent cell, China) increase, extract plasmid-20 ℃ preservation.
Table 1
2,
zfxThe external interference test of gene:
Choose 4 of the healthy male mouse of kunming of 28 ages in days, adopt the cervical vertebra dislocation method that it is put to death, its belly is drenched sterilization with 75% alcohol.Take out the bilateral testes of every mouse under aseptic condition, adopt two step enzyme digestions to isolate sustentacular cell of testis and androgone.These isolated cells are put into the HamF12/DMEM nutrient solution that contains 10% foetal calf serum, interior interpolation HEPES (15mol/L), 100 kU/L penicillin and 0.1 g/L Streptomycin sulphate, 1ug/ml Urogastron, 100ul ITS (Regular Insulin, Transferrins,iron complexes, sodium selenate) { Regular Insulin (10 μ g/ml), Transferrins,iron complexes (10 μ g/ml) }, 3.3 * 10
-7Mol/L vitamin A acid, vitamin A (3.3 * 10
-7Mo/L), 10 μ g/ml vitamin-Es, 10
-4Mol/L vitamins C, 10
-3Mol/L pyruvic acid, 10
-7Mol/L testosterone, 25U/L rFSH.Approximately by 1 * 10
6CELL/cm
2Density be inoculated in six orifice plates that are placed with cover glass, at 32 ℃, 5% CO
2, humidity is to cultivate 24 hours under 95% condition, as transfection reagent, the carrier that builds is transfected in androgone every group of triplicate with calcium ion.Total RNA of androgone was as a child extracted in transfection 48, detected the mrna expression level of zfx gene with RT-PCR.Pick out interference effect four experiments of carrying out next step preferably, as shown in table 2, hereinafter to be referred as pzq1 (Zfx1286), pzq2 (zfx3945), pzq3 (Zfx2325) and pzq4 (Zfx6487), table 2 is with BamHI and EcoRI restriction enzyme site
zfxThe RNAi sequence.
Table 2
3, the animal body internal interference of zfx gene test:
Choose the healthy male mouse of kunming in 80 6 ages in week, be divided at random 5 groups, three groups of testis injection interference effects, three interference carriers preferably wherein, the interference carrier 40ug of every injection equal volume; The empty carrier 40ug of other two groups one group injection equal volume, the physiological saline of one group of injection equal volume.Interval 7 days injection one-time continuous injection 4 times, the female kunming mice abdominal injection PMSG 5U in last injection 40 6 ages in week of random choose after 5 days, then injection 5U HCG after 42-48h mates (this moment is apart from last injection plasmid 7d) with 8 of every group of male mouse by 1:1.Check whether female mouse becomes pregnant morning next day, sees that female mouse that cloudy bolt is arranged and male mouse separate to carry out single cage and raise, and observes output offspring's sex ratio.Mate simultaneously every group of remaining 8 male mouse are put to death, get bilateral testes and extract total RNA, detect the mrna expression level of respectively organizing the ZFX gene with RT-PCR, as shown in table 3 is goal gene primer sequence and PCR condition.
Table 3
Two, experimental result:
1, RT-PCR detects in androgone
zfxThe expression level of gene mRNA:
As shown in Figure 1, result shows in experimental group pzq1, pzq2, pzq3, pzq4
zfxThe expression level of gene mRNA is all lower than control group (physiological saline group).Wherein pzq1, pzq3 and control group comparing difference significantly (P＜0.05); Pzq4 difference is (P＜0.01) extremely significantly.All tentatively choose pzq1, pzq2, pzq3, pzq4 are right
zfxThe gene interference effect is the shRNA fragment preferably, and is as shown in table 2.
2, RT-PCR detects the expression level of zfx gene mRNA in testis tissue:
As shown in Figure 2, result shows the expression level of zfx gene mRNA in experimental group pzq1, pzq2, pzq3, pzq4 all lower than control group (physiological saline group), and difference is (P＜0.01) extremely significantly.Wherein experimental group pzq4 is minimum.
3, F1 is for the sex ratio of mouse:
As table 4 and shown in Figure 3, result shows that experimental group pzq1, pzq2 F1 do not have difference (P＞0.05) for male mouse rate and the control group of mouse, and the F1 of experimental group pzq3 and pzq4 is high than control group for the male mouse rate of mouse, significant difference (P＜0.05), wherein up to 79.49%, difference is (P＜0.01) extremely significantly for male mouse rate for the F1 of experimental group pzq4.Table 4 is each group offspring (F1 generation) male and female mouse quantity.
Table 4
Annotate: have the identical person of arbitrary letter not remarkable for difference between two groups, capitalization represents that difference is extremely remarkable, and the lowercase alphabet differential is different significantly.
Three, innovative point of the present invention:
As shown in table 5, table 5 is oligonucleotide sequence.
Table 5
As shown in table 5, what three siRNA interference fragments provided by the invention can be to mouse
zfxGene has good reticent effect, and wherein pqz3 disturbs the X sperm of male mouse, can make F1 reach 75.94% for male mouse rate in mouse: and pqz4 disturbs the X sperm of male mouse, F1 for male mouse rate in mouse up to 79.66%.Although and pqz1 does not have significant difference to F1 mouse rate after the interference of zfx gene, the interference effect to the zfx gene in the spermatogenesis cell has also reached conspicuous level (P＜0.05).
Description of drawings
Fig. 1 is the expression level of zfx mRNA in cell.
Fig. 2 is the expression level of zfx mRNA in tissue.
Fig. 3 is that RNA disturbs zfx F1 for male mouse rate.
In figure: have the identical person of arbitrary letter not remarkable for difference between two groups, capitalization represents that difference is extremely remarkable, and the lowercase alphabet differential is different significantly.
Fig. 4 is vector construction schematic diagram of the present invention.
Embodiment
The technology of using in following examples, comprise gene sequencing, pcr amplification and detection, vector construction equimolecular biology techniques, unless stated otherwise, be routine techniques well known by persons skilled in the art, the plant and instrument that uses, reagent, plasmid and carrier etc., only dated especially, be that general those skilled in the art can obtain by public approach.
Embodiment 1:
1, build the RNAi interference carrier of zfx gene:
The zfx gene order of using comes from the NCBI gene pool, filters out 10 siRNA fragments according to RNAi principle of design and the compare of analysis result on NCBI, and is as shown in table 1, for being used for siRNA's
zfxThe cDNA template.Add Ecor I and Bam I restriction enzyme site in 5 ' and 3 ' of each siRNA fragment respectively, as shown in table 2, then send biotech firm to synthesize the siRNA fragment.Positive and negative adopted chain is combined into two strands by annealing and is connected to RNAi-Ready pSIREN-RetroQ-ZsGreen Vector(Clontech, the U.S.) on carrier, then be transformed into (Tiangen in E. coli DH5 α competent cell, China) increase, extract plasmid-20 ℃ preservation.
2, the external interference test of zfx gene:
Choose 4 of the healthy male mouse of kunming of 28 ages in days, adopt the cervical vertebra dislocation method that it is put to death, its belly is drenched sterilization with 75% alcohol.Take out the bilateral testes of every mouse under aseptic condition, adopt two step enzyme digestions to isolate sustentacular cell of testis and androgone.These isolated cells are put into the HamF12/DMEM nutrient solution that contains 10% foetal calf serum, interior interpolation HEPES (15mol/L), 100 kU/L penicillin and 0.1 g/L Streptomycin sulphate, 1ug/ml Urogastron, 100ul ITS (Regular Insulin, Transferrins,iron complexes, sodium selenate) { Regular Insulin (10 μ g/ml), Transferrins,iron complexes (10 μ g/ml) }, 3.3 * 10
-7Mol/L vitamin A acid, vitamin A (3.3 * 10
-7Mo/L), 10 μ g/ml vitamin-Es, 10
-4Mol/L vitamins C, 10
-3Mol/L pyruvic acid, 10
-7Mol/L testosterone, 25U/L rFSH.Approximately by 1 * 10
6CELL/cm
2Density be inoculated in six orifice plates that are placed with cover glass, at 32 ℃, 5% CO
2, humidity is to cultivate 24 hours under 95% condition, as transfection reagent, the carrier that builds is transfected in androgone every group of triplicate with calcium ion.Total RNA of androgone was as a child extracted in transfection 48, detected the mrna expression level of ZFX gene with RT-PCR.Pick out interference effect four experiments of carrying out next step preferably, as shown in table 2, hereinafter to be referred as pqz1 (Zfx1286), pqz2 (zfx3945), pqz3 (Zfx2325) and pqz4 (Zfx6487), table 2 is with BamHI and EcoRI restriction enzyme site
zfxThe RNAi sequence.
3, the animal body internal interference of zfx gene test:
Choose the healthy male mouse of kunming in 80 6 ages in week, be divided at random 5 groups, three groups of testis injection interference effects, three interference carriers preferably wherein, the interference carrier 40ug of every injection equal volume; The empty carrier 40ug of other two groups one group injection equal volume, the physiological saline of one group of injection equal volume.Interval 7 days injection one-time continuous injection 4 times, the female kunming mice abdominal injection PMSG 5U in last injection 40 6 ages in week of random choose after 5 days, then injection 5U HCG after 42-48h mates (this moment is apart from last injection plasmid 7d) with 8 of every group of male mouse by 1:1.Check whether female mouse becomes pregnant morning next day, sees that female mouse that cloudy bolt is arranged and male mouse separate to carry out single cage and raise, and observes output offspring's sex ratio.Mate simultaneously every group of remaining 8 male mouse are put to death, get bilateral testes and extract total RNA, detect the mrna expression level of respectively organizing the ZFX gene with RT-PCR, as shown in table 3 is the condition of primer and the PCR of goal gene.
It should be noted that at last: the above only is the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment, the present invention is had been described in detail, for a person skilled in the art, it still can be modified to the technical scheme that aforementioned each embodiment puts down in writing, and perhaps part technical characterictic wherein is equal to replacement.Within the spirit and principles in the present invention all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Sequence table
＜110〉Shihezi Univ
＜120 〉
zfxThe application of the RNA interference fragment of gene and control mouse sex thereof
<160> pqz-1
<210> 1
<211> 1261
<212> RNA
<400> 1
aaagtaagat ttttccgatt tcttggcttt atatatcttg tggaaggacg aggatccgaa 60
ctgaatgtcg ctgagattca agagatctca gcgacattca gttctttttt acgcgtgaat 120
tctagttatt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc 180
cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 240
ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 300
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 360
ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 420
tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 480
accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt tgactcacgg 540
ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 600
cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg cggtaggcgt 660
gtacggtggg aggtctatat aagcagagct ggtttagtga accgtcagat ccgctagcgc 720
taccggtcgc caccatggcc cagtccaagc acggcctgac caaggagatg accatgaagt 780
accgcatgga gggctgcgtg gacggccaca agttcgtgat caccggcgag ggcatcggct 840
accccttcaa gggcaagcag gccatcaacc tgtgcgtggt ggagggcggc cccttgccct 900
tcgccgagga catcttgtcc gccgccttca tgtacggcaa ccgcgtgttc accgagtacc 960
cccaggacat cgtcgactac ttcaagaact cctgccccgc cggctacacc tggaccgctc 1020
cttcctgttc gaggacggcg ccgtgtgcat ctgcacgtcg acatcaccgt ggagcgtgga 1080
ggagactgca tgtacacgag tcagttctac gcgtgactcc cgcgacgtcc gtgatgagaa 1140
gatgacgaca ctgggagtct ctgcagaaga tcatccgtgt agcagcatct gaggcgactg 1200
acagtacgtc tgctgaggac ggtgcgatgg gcctgccaga ttctgacacc ccgggtgata 1260
c 1261
<160> pqz-3
<210> 1
<211> 1058
<212> RNA
<400> 2
ctttcgattt cttggcttta tatatcttgt ggaaggacga ggatccggac tatcctcata 60
agtgtttcaa gagaacactt atgaggatag tcctttttta cgcgtgaatt ctagttatta 120
atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 180
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 240
aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 300
gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 360
ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 420
atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 480
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 540
tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 600
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 660
ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagcgct accggtcgcc 720
accatggccc agtccaagca cggcctgacc aaggagatga ccatgaagta ccgcatggag 780
ggctgcgtgg acggccacaa gttcgtgatc accggcgagg gcatcggcta ccccttcaag 840
ggcaagcagg ccatcaacct gtgcgtggtg gagggcggcc ccttgccctt cgccgaggac 900
atcttgtccg ccgccttcat gtacggcaac cgcgtgttca ccgagtaccc ccaggacatc 960
gtcgactact tcaagaactc ctgccccgcc ggctacacct gggaccgctc cttcctgttc 1020
gaggacggcg ccgtggtgca tctgcaacgc cgaccatc 1058
<160> pqz-4
<210> 1
<211> 1194
<212> RNA
<400> 3
agaccagaga tttcgatttc ttggctttat atatcttgtg gaaggacgag gatccggtgc 60
agtgagaata cattttcaag agaaatgtat tctcactgca ccttttttac gcgtgaattc 120
tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 180
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 240
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 300
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 360
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 420
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 480
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 540
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 600
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 660
acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 720
ccggtcgcca ccatggccca gtccaagcac ggcctgacca aggagatgac catgaagtac 780
cgcatggagg gctgcgtgga cggccacaag ttcgtgatca ccggcgaggg catcggctac 840
cccttcaagg gcaagcaggc catcaacctg tgcgtggtgg agggcggccc cttgcccttc 900
gccgaggaca tcttgtccgc cgccttcatg tacggcaacc gcgtgttcac cgagtacccc 960
caggacatcg tcgactactt caagaactcc tgccccgccg gctacacctg gacgctcttc 1020
tgtcgaggac ggcgcgtgtg catctgcacg cgacatcacg tgagcgtgag agactgcatg 1080
taccacgagt cagttctacg cgtgaactcc cgcgacgccg tgaatgaaga agatgacgac 1140
actggagcct ctgcaaagaa tcatcccgtg gccaagcaag gcatctttga aggg 1194
Sequence table
＜110〉Shihezi Univ
＜120 〉
zfxThe application of the RNA interference fragment of gene and control mouse sex thereof
<160> pqz-1
<210> 1
<211> 1261
<212> RNA
<400> 1
aaagtaagat ttttccgatt tcttggcttt atatatcttg tggaaggacg aggatccgaa 60
ctgaatgtcg ctgagattca agagatctca gcgacattca gttctttttt acgcgtgaat 120
tctagttatt aatagtaatc aattacgggg tcattagttc atagcccata tatggagttc 180
cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 240
ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 300
caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 360
ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 420
tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 480
accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt tgactcacgg 540
ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 600
cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg cggtaggcgt 660
gtacggtggg aggtctatat aagcagagct ggtttagtga accgtcagat ccgctagcgc 720
taccggtcgc caccatggcc cagtccaagc acggcctgac caaggagatg accatgaagt 780
accgcatgga gggctgcgtg gacggccaca agttcgtgat caccggcgag ggcatcggct 840
accccttcaa gggcaagcag gccatcaacc tgtgcgtggt ggagggcggc cccttgccct 900
tcgccgagga catcttgtcc gccgccttca tgtacggcaa ccgcgtgttc accgagtacc 960
cccaggacat cgtcgactac ttcaagaact cctgccccgc cggctacacc tggaccgctc 1020
cttcctgttc gaggacggcg ccgtgtgcat ctgcacgtcg acatcaccgt ggagcgtgga 1080
ggagactgca tgtacacgag tcagttctac gcgtgactcc cgcgacgtcc gtgatgagaa 1140
gatgacgaca ctgggagtct ctgcagaaga tcatccgtgt agcagcatct gaggcgactg 1200
acagtacgtc tgctgaggac ggtgcgatgg gcctgccaga ttctgacacc ccgggtgata 1260
c 1261
<160> pqz-3
<210> 1
<211> 1058
<212> RNA
<400> 2
ctttcgattt cttggcttta tatatcttgt ggaaggacga ggatccggac tatcctcata 60
agtgtttcaa gagaacactt atgaggatag tcctttttta cgcgtgaatt ctagttatta 120
atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 180
acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 240
aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 300
gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 360
ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 420
atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 480
gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 540
tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 600
aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 660
ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagcgct accggtcgcc 720
accatggccc agtccaagca cggcctgacc aaggagatga ccatgaagta ccgcatggag 780
ggctgcgtgg acggccacaa gttcgtgatc accggcgagg gcatcggcta ccccttcaag 840
ggcaagcagg ccatcaacct gtgcgtggtg gagggcggcc ccttgccctt cgccgaggac 900
atcttgtccg ccgccttcat gtacggcaac cgcgtgttca ccgagtaccc ccaggacatc 960
gtcgactact tcaagaactc ctgccccgcc ggctacacct gggaccgctc cttcctgttc 1020
gaggacggcg ccgtggtgca tctgcaacgc cgaccatc 1058
<160> pqz-4
<210> 1
<211> 1194
<212> RNA
<400> 3
agaccagaga tttcgatttc ttggctttat atatcttgtg gaaggacgag gatccggtgc 60
agtgagaata cattttcaag agaaatgtat tctcactgca ccttttttac gcgtgaattc 120
tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 180
cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 240
gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 300
atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 360
aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 420
catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 480
catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 540
atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 600
ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 660
acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta 720
ccggtcgcca ccatggccca gtccaagcac ggcctgacca aggagatgac catgaagtac 780
cgcatggagg gctgcgtgga cggccacaag ttcgtgatca ccggcgaggg catcggctac 840
cccttcaagg gcaagcaggc catcaacctg tgcgtggtgg agggcggccc cttgcccttc 900
gccgaggaca tcttgtccgc cgccttcatg tacggcaacc gcgtgttcac cgagtacccc 960
caggacatcg tcgactactt caagaactcc tgccccgccg gctacacctg gacgctcttc 1020
tgtcgaggac ggcgcgtgtg catctgcacg cgacatcacg tgagcgtgag agactgcatg 1080
taccacgagt cagttctacg cgtgaactcc cgcgacgccg tgaatgaaga agatgacgac 1140
actggagcct ctgcaaagaa tcatcccgtg gccaagcaag gcatctttga aggg 1194
Claims (5)
1.zfx the RNA interference fragment of gene is characterized in that, has following arbitrary sequence:
siRNA 1：GAACTGAATGTCGCTGAGATT，
siRNA 7：GGACTATCCTCATAAGTGTGA，
siRNA 9：GGTGCAGTGAGAATACATTAT。
2.
zfxThe expression vector of gene RNA interference fragment is characterized in that, this expression vector clone has arbitrary RNA interference fragment as claimed in claim 1.
3. expression vector according to claim 2, is characterized in that, this expression vector has the sequence shown in SEQ ID NO:1,2 or 3.
4.zfx the application of the RNA interference fragment of gene in controlling the mouse sex of children.
5. application according to claim 4, is characterized in that, described control method is, with the RNA interference fragment of zfx gene, the zfx gene in the mouse sperm cell carried out silence, produces the spermatid of particular type.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310053235.2A CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310053235.2A CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103131709A true CN103131709A (en) | 2013-06-05 |
| CN103131709B CN103131709B (en) | 2014-12-17 |
Family
ID=48492161
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310053235.2A Expired - Fee Related CN103131709B (en) | 2013-02-18 | 2013-02-18 | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103131709B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232643A (en) * | 2014-08-25 | 2014-12-24 | 石河子大学 | RNAi (ribonucleic acid interference) interference segment, interference vector, and preparation method and application thereof |
| CN107267511A (en) * | 2017-06-27 | 2017-10-20 | 石河子大学 | RNAi interference fragments, interference carrier and its preparation method and application |
| CN109735542A (en) * | 2019-01-24 | 2019-05-10 | 石河子大学 | RNAi interference fragment, interference carrier and its preparation method and application |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033120A2 (en) * | 2000-10-17 | 2002-04-25 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
| KR20080082562A (en) * | 2008-07-04 | 2008-09-11 | (주)지노첵 | Diagnostic methods for male infertility and diagnostic kits for male infertility for detecting y chromosomal microdeletion |
| WO2009020932A2 (en) * | 2007-08-03 | 2009-02-12 | Biocept, Inc. | In-situ hybridization to detect rna and dna markers |
| CN102206676A (en) * | 2011-03-24 | 2011-10-05 | 石河子大学 | Vector for controlling gender of animals and application thereof |
| CN102277434A (en) * | 2011-07-28 | 2011-12-14 | 曹跃琼 | Application and relevant drug of human ZFX (zinc finger-X) gene |
| CN102703578A (en) * | 2011-07-06 | 2012-10-03 | 郭奇伟 | Multiple real-time fluorescent PCR detection kit for Y chromosome microdeletion |
| CN102912028A (en) * | 2012-11-06 | 2013-02-06 | 北京阅微基因技术有限公司 | Amplification composite for detecting microdeletion of Y-chromosome and detection kit |
-
2013
- 2013-02-18 CN CN201310053235.2A patent/CN103131709B/en not_active Expired - Fee Related
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002033120A2 (en) * | 2000-10-17 | 2002-04-25 | The Chinese University Of Hong Kong | Non-invasive prenatal monitoring |
| WO2009020932A2 (en) * | 2007-08-03 | 2009-02-12 | Biocept, Inc. | In-situ hybridization to detect rna and dna markers |
| KR20080082562A (en) * | 2008-07-04 | 2008-09-11 | (주)지노첵 | Diagnostic methods for male infertility and diagnostic kits for male infertility for detecting y chromosomal microdeletion |
| CN102206676A (en) * | 2011-03-24 | 2011-10-05 | 石河子大学 | Vector for controlling gender of animals and application thereof |
| CN102703578A (en) * | 2011-07-06 | 2012-10-03 | 郭奇伟 | Multiple real-time fluorescent PCR detection kit for Y chromosome microdeletion |
| CN102277434A (en) * | 2011-07-28 | 2011-12-14 | 曹跃琼 | Application and relevant drug of human ZFX (zinc finger-X) gene |
| CN102912028A (en) * | 2012-11-06 | 2013-02-06 | 北京阅微基因技术有限公司 | Amplification composite for detecting microdeletion of Y-chromosome and detection kit |
Non-Patent Citations (3)
| Title |
|---|
| MOUNTS,W.M.: "Sequence 148030 from Patent WO2005116265", 《GENBANK》 * |
| 彭强等: "siRNA介导小鼠Zfy基因干扰的定量分析", 《石河子大学学报》 * |
| 苏作鹏: "Zfx在人脑胶质瘤中的功能研究", 《中国硕士论文全文数据库》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232643A (en) * | 2014-08-25 | 2014-12-24 | 石河子大学 | RNAi (ribonucleic acid interference) interference segment, interference vector, and preparation method and application thereof |
| CN107267511A (en) * | 2017-06-27 | 2017-10-20 | 石河子大学 | RNAi interference fragments, interference carrier and its preparation method and application |
| CN107267511B (en) * | 2017-06-27 | 2020-06-16 | 石河子大学 | RNAi interference fragment, interference vector, preparation method and application thereof |
| CN109735542A (en) * | 2019-01-24 | 2019-05-10 | 石河子大学 | RNAi interference fragment, interference carrier and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103131709B (en) | 2014-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108441519A (en) | The method that homologous remediation efficiency is improved in CRISPR/CAS9 gene editings | |
| CN111228475A (en) | Biological product for preventing novel coronavirus | |
| CN110295149B (en) | Mutant strain 3 type duck hepatitis A virus CH-P60-117C strain and construction method thereof | |
| CN109321571A (en) | A method of utilizing CRISPR/Cas9 preparation and reorganization porcine pseudorabies virus | |
| CN103131709B (en) | Ribonucleic acid (RNA) interference fragment of zinc finger-x (zfx) gene and application of RNA interference fragment in mouse sex control | |
| CN114350615B (en) | STAT2 gene deletion cell strain and preparation method and application thereof | |
| CN110218732B (en) | African swine fever virus tandem gene, co-expression vector, construction method and application | |
| CN112391412A (en) | Replication-type oncolytic adenovirus for regulating lipid metabolism and application thereof | |
| CN114369619A (en) | Reporter vector for gene knockout, vector system and application | |
| CN110607324A (en) | Dairy cow lysozyme gene mammary gland specificity expression recombinant plasmid and construction method and application thereof | |
| CN109456991B (en) | Protocatechuic acid regulated switch system, regulating method and application thereof | |
| CN110295180B (en) | Type 3 duck hepatitis A virus mutant gene ISA-A117C-C4334A and construction method thereof | |
| CN110684781B (en) | Type 3 duck hepatitis A virus mutant gene ISA-A117C-T1142A and construction method thereof | |
| CN111088282B (en) | Application of AAVS1 and H11 safe harbor sites in recombinant expression protein | |
| CN109055375A (en) | A kind of CRISPR assists the method and its application of trans- enhancer activated gene expression | |
| CN101121939A (en) | Universal green fluorescence protein fusion target gene expression carrier for siRNA screening system | |
| CN101705246B (en) | Lentiviral gene transfer vector, preparation method and application thereof | |
| CN110747232A (en) | Long-acting stably expressed baculovirus vector and construction method thereof | |
| CN109456992B (en) | Protocatechuic acid regulated multifunctional gene expression platform and application thereof | |
| CN101186925B (en) | General-purpose highly effective eukaryon expression carrier p3I-GFPN and mastitis-resisting transgene carrier constructed by the same | |
| CN109371167A (en) | Genetic elements and the application of frameshift mutation are generated for detecting CRISPR/Cas9 gene editing system cutting gene | |
| CN110484546B (en) | Type-3 duck hepatitis A virus mutant gene ISA-C4334A and construction method | |
| CN110283835B (en) | Type-3 duck hepatitis A virus mutant gene ISA-T1142A-C4334A and construction method thereof | |
| CN110295148A (en) | A kind of method of 3 type duck hepatitis A virus reverse genetic strain of rapid build | |
| CN104195153A (en) | Bicistronic co-expression gene transfer bodyand preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141217 Termination date: 20190218 |