CN114934066A

CN114934066A - Gene editing system for osteolithiasis and application thereof

Info

Publication number: CN114934066A
Application number: CN202210455336.1A
Authority: CN
Inventors: 戴勇; 李丹丹; 欧明林; 汤冬娥
Original assignee: Shenzhen Linyan Medical Co ltd
Current assignee: Shenzhen Linyan Medical Co ltd
Priority date: 2022-04-28
Filing date: 2022-04-28
Publication date: 2022-08-23
Anticipated expiration: 2042-04-28
Also published as: CN114934066B

Abstract

The invention discloses a gene editing system for osteomalacia and application thereof. The gene editing system comprises: the CRISPR/Cas editing system comprises sgRNAs, wherein the nucleotide sequences of the sgRNAs are shown in SEQ ID No. 1; and the exogenous template comprises at least one nucleotide sequence shown in SEQ ID No. 2-3. The gene editing system according to the embodiment of the application has at least the following beneficial effects: the gene editing system provided by the application designs a guide RNA and a repair template aiming at a specific osteomyelitis mutation site, utilizes a CRISPR/Cas editing system to specifically cut a target sequence, and guides a homologous recombination repair process, thereby efficiently completing the repair of the R286W mutation site.

Description

Gene editing system for treating osteomalacia and application thereof

Technical Field

The application relates to the technical field of induced pluripotent stem cells, in particular to a gene editing system for treating a osteomalacia and application thereof.

Background

Osteomalacia is a rare human genetic disease, and its diagnosis relies mainly on radiographic confirmation of abnormal bone density. As a heterogeneous disease, different patients can be roughly classified into asymptomatic or slightly symptomatic benign types and potentially severely life threatening malignant types. Because the etiology and the pathology of the malignant osteomyelitis are not clear at present, the treatment of the malignant osteomyelitis can only adopt a symptomatic treatment method. The currently available symptomatic treatment is allogeneic Hematopoietic Stem Cell Transplantation (HSCT) therapy, and approximately 73% of patients receiving treatment can achieve a disease-free survival period of 5 years. Although this treatment has been greatly developed over the past few years, implantation of stem cells from donors still presents a number of difficulties. Transplant rejection is one of the important problems, and it is almost impossible for two different individuals to have identical HLA, thus requiring the recipient to match the donor as closely as possible, which also greatly limits the available donors for the patient.

Aiming at the problem, the autologous stem cells can not generate any rejection or toxicity and risk to the body of the patient, and the safety of the autologous stem cells can be greatly improved. Induced pluripotent stem cells (ipscs) derived from patients are ideal autologous stem cells, but pathogenic genes are also present in the cells, and thus the cells need to be genetically repaired before they can be used. The CRISPR-Cas9 technology enables efficient editing at specific positions of the genome in various biological systems, and after the CRISPR system is cleaved to generate double-strand breaks, DNA repair inside cells follows the following two mechanisms: one is non-homologous end joining (NHEJ), and the broken DNA is directly connected; and the other is Homologous Directed Repair (HDR), and the broken DNA is subjected to homologous recombination repair according to a DNA template. Taking HDR as an example, the efficiency of HDR is affected by various factors, such as the chosen PAM site, the type of repair template, and the design of the template sequence, etc., which together result in a large difference in HDR efficiency among different cell lines. In earlier studies, it was identified that the mutation R286W in CLCN7 gene may be the cause of an autosomal dominant inheritance type 2 osteomalacia (ADO2) family, and ADO2-iPSC containing the mutation site was constructed. Therefore, it is necessary to provide a gene editing system capable of efficiently repairing the mutation site of the lithiasis by means of the CRISPR technology.

Disclosure of Invention

The present application is directed to solving at least one of the problems in the prior art. Therefore, the application provides a gene editing system aiming at the lithiasis and application thereof, and the gene repairing system can be used for efficiently repairing the mutation site of the lithiasis R286W.

In a first aspect of the present application, there is provided a gene editing system for a lithiasis, the gene editing system comprising:

the CRISPR/Cas editing system comprises sgRNAs, wherein the nucleotide sequences of the sgRNAs are shown in SEQ ID No. 1;

and the exogenous template comprises at least one nucleotide sequence shown in SEQ ID No. 2-3.

The gene editing system according to the embodiment of the application has at least the following beneficial effects:

the gene editing system provided by the application designs a guide RNA and a repair template aiming at a specific osteomyelitis mutation site, specifically cuts a target sequence by using a CRISPR/Cas editing system, and guides a homologous recombination repair process, thereby efficiently completing the repair of the R286W mutation site.

In some embodiments of the present application, the exogenous template is a double-stranded template comprising nucleotide sequences as set forth in SEQ ID Nos. 2-3, respectively.

Wherein, the nucleotide sequence shown in SEQ ID No.1 is as follows: CCGCAGAGACACAGAGAAGT, respectively;

the nucleotide sequence shown in SEQ ID No.2 is as follows:

ACTTCCGCAGAGACACAGAGAAGCGGGACTTCGTCTCCGCAGGGGCTGCGGC；

the nucleotide sequence shown in SEQ ID No.3 is as follows:

TGAAGGCGTCTCTGTGTCTCTTCGCCCTGAAGCAGAGGCGTCCCCGACGCCG。

in some embodiments of the present application, the exogenous template comprises upstream and downstream homology arm sequences and a repair sequence located between the upstream and downstream homology arm sequences, and the nucleotide sequence of the repair sequence is shown in at least one of SEQ ID Nos. 2-3. The homologous arm sequence refers to a sequence of an upstream fragment and a downstream fragment which are homologous with a region to be repaired where a target sequence is located, and when the target sequence is sheared by the CRISPR/Cas editing system, the homologous arm of the template is complementarily paired with the sheared double strands for repair.

In some embodiments of the present application, the gene editing system includes a targeting vector comprising a nucleotide sequence of the sgRNA and an exogenous template vector comprising a nucleotide sequence of the exogenous template.

The targeting vector is a vector for gene targeting, which can be recombined with a specific site of a recipient cell and repaired. Exogenous template vectors refer to vectors that are used to provide templates for gene editing repair. In some embodiments, the targeting vector and the exogenous template vector are plasmid vectors.

In some embodiments of the present application, the targeting vector is a Cas9 expression plasmid with the sgRNA integrated on the Cas9 expression plasmid.

In some embodiments of the present application, the targeting vector is a px461 plasmid and the exogenous template vector is a pUC57 plasmid.

In some embodiments of the present application, the targeting vector further comprises a nucleotide sequence of a Cas9 protein.

In a second aspect of the present application, there is provided a method for preparing a homologous recombination repair cell, the method comprising the steps of:

constructing a targeting vector and an exogenous template vector, wherein the targeting vector comprises a nucleotide sequence shown as SEQ ID No.1, and the exogenous template vector comprises at least one nucleotide sequence shown as SEQ ID No. 2-3;

and co-transfecting the targeting vector and the exogenous template vector to the cell to be repaired, and screening to obtain a gene editing and repairing cell, wherein the cell to be repaired has R286W mutation of the CLCN7 gene.

In some embodiments of the present application, the cell to be repaired is an induced pluripotent stem cell. By utilizing the preparation method, the induced pluripotent stem cells from the patient with the lithiasis with the R286W mutation can be restored to the wild normal induced pluripotent stem cells, so that the induced pluripotent stem cells can be applied to autologous stem cell treatment of the patient with the lithiasis, and the problems of rejection, toxicity and the like caused by xenotransplantation are avoided.

In a third aspect of the present application, there is provided a homologous recombination repair cell, which is prepared by the aforementioned preparation method.

In some embodiments of the present application, the homologous recombination repair cell is an induced pluripotent stem cell. The homologous recombination repairing cell is an induced pluripotent stem cell derived from autologous cells of a patient, so that the homologous recombination repairing cell can be applied to stem cell treatment of the patient and effectively relieves the lithiasis of the patient.

In a fourth aspect of the present application, there is provided the use of the aforementioned homologous recombination repair cell in the preparation of a cell therapy product.

Additional aspects and advantages of the present application will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the present application.

Drawings

Fig. 1 is a schematic diagram of a gene editing method in example 1 of the present application, in which a is a schematic diagram of the principle of the method, b is a schematic diagram of the position of the mutation site, and c is a schematic diagram of the specific repair principle of the mutation site.

FIG. 2 is a map of the targeting vector plasmid and the foreign template vector plasmid constructed in example 1 of the present application.

FIG. 3 is a gel electrophoresis image of PCR amplification products of different clones in example 1 of the present application.

FIG. 4 shows the sequencing results of some of the clones in example 1 of the present application.

FIG. 5 shows the results of identifying the clones in example 1 of the present application, wherein A is an image of a GC-ADO2-iPSCs colony cultured on Matrigel, B is the result of karyotyping GC-ADO2-iPSCs, C and D are the results of flow cytometry for identifying the expression of GC-ADO2-iPSCs pluripotency markers SSEA-4 and Tra-1-81, E, F and G are the formation of GC-ADO2-iPSCs teratoma, E is endoderm (intestinal epithelial cells), F is mesoderm (cartilage), and G is ectoderm (neurocalyx).

Fig. 6 is western blot detection results of different ipscs before and after repair of the present application, wherein a is the imaging result of western blot analysis and B is the relative level of CLCN7 expression in the different ipscs.

Detailed Description

The conception and the resulting technical effects of the present application will be clearly and completely described below in conjunction with the embodiments to fully understand the objects, features and effects of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all embodiments, and other embodiments obtained by a person skilled in the art without making any inventive effort based on the embodiments of the present application are within the protection scope of the present application.

The following detailed description of embodiments of the present application is provided for illustrative purposes only and is not intended to be limiting of the present application.

In the description of the present application, the meaning of a plurality is one or more, the meaning of a plurality is two or more, and the above, below, exceeding, etc. are understood as excluding the present number, and the above, below, within, etc. are understood as including the present number. If there is a description of first and second for the purpose of distinguishing technical features only, this is not to be understood as indicating or implying a relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of technical features indicated.

In the description of the present application, reference to the description of the terms "one embodiment," "some embodiments," "an illustrative embodiment," "an example," "a specific example," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

Example 1

The embodiment provides a gene editing and repairing method of a osteodynia-induced pluripotent stem cell, which relates to an osteodynia-induced pluripotent stem cell (ADO2-iPSCs), and the preparation process comprises the following steps:

(1) a30 mL urine sample from a patient with urolithiasis who had been identified as the R286W mutation was taken and centrifuged at 300 Xg for 10 minutes at room temperature, the supernatant was discarded, the buffer was resuspended and transferred to a 50mL tube and centrifuged again at 300 Xg for 10 minutes at room temperature. The supernatant was discarded, the cells at the bottom of the tube were washed and resuspended in 0.5mL urea medium (Cellapy, Beijing, China), seeded onto culture plates, and cultured in 5% CO ₂ And cultured at 37 ℃ with medium replacement every 60 hours. The cultured cells are inoculated to a 6-well plate, and reprogramming is carried out when the confluence degree reaches 50-80%.

(2) Reprogramming was performed by infecting cells with a non-integrative Sendai virus reprogramming kit (Cytotunne 2.0 Sendai vector, Thermo Scientific) containing 4 transcription factors (OCT4, SOX2, KLF4, and C-MYC). After 24 hours of incubation following transfection, cells were harvested, inoculated into fresh medium (day 1) and cultured for 6 days (medium was changed every 2 days). Cells were harvested on day 7 and plated on Matrigel-coated urea medium. The iPSCs were grown in a simple medium containing growth factors on day 8, and then replaced with fresh medium every day to observe the cloning of iPSCs. And (5) carrying out passage after the iPSCs clone grows to a proper size. In this example, ADO2-iPSCs cell line was established using clones selected on day 17 after plasmid infection. Through the combination of methods such as morphology, surface markers, pluripotency, karyotype and the like and sequencing, the ADO2-iPSCs with the R286W mutation are identified and then used for repairing the CRISPR/Cas gene editing system.

The gene editing method is shown in figure 1, wherein a is a schematic diagram of the principle of the method, b is a schematic diagram of the position of the mutation site, and ADO2-iPSCs which are derived from a patient and carry CLCN7 gene R286W mutation are subjected to repair of the mutation site in the ADO2-iPSCs through a CRISPR/Cas9 editing system by means of an HDR exogenous template to obtain iPSCs with normal CLCN7 gene expression homologous to the patient. c is a specific repair principle of the mutation site, the mutation site is caused by mutation of TGG on the 10 th exon into CGG, the Cas9 protein is used for cutting nearby the mutation site, and homologous directional repair is completed through an exogenous template (repair sequences are respectively shown as SEQ ID No. 2-3).

sgRNAs were designed according to the upstream and downstream sequences of TGG mutation on exon 10 via website http:// www.deephf.com/index/#/cas9, wherein scores are shown in Table 1 below according to the sgRNAs of the first five arranged from high to low, and sgRNA5 was selected as the sgRNA of the subsequent experiment. sgRNA5 was chosen because the sequence was closest to the mutation site.

TABLE 1 sgRNA obtained by design

The gene editing and repairing method of the homologous recombination and repair cell comprises the following steps:

(1) respectively constructing plasmids by the screened sgRNA5 and an exogenous template, wherein a sequence of the sgRNA5 is connected to a px461 plasmid to obtain a targeting vector plasmid for simultaneously expressing sgRNA and Cas9 proteins; the sequence of the foreign template was ligated to the pUC57 plasmid to give a foreign template vector plasmid expressing CLCN7 template. Referring to A and B of FIG. 2, maps of the constructed targeting vector plasmid and exogenous template vector plasmid are shown, respectively.

(2) And (3) electrically transferring the targeting vector plasmid and the exogenous template vector plasmid into the ADO2-iPSCs prepared above, carrying out drug screening after transfection, carrying out culture and amplification, selecting a monoclonal, carrying out PCR, and carrying out PCR product sequencing verification.

The iPSC clones edited by this method (total 11 clones) were collected, subjected to DNA extraction, PCR amplification, and gel electrophoresis, and the results are shown in fig. 3, with 9 clones (clones C13, C14, C16, C17, C18, C19, C20, C22, and C23) having a band 724bp in the size of the target fragment. The cells of these clones were collected, and partial results of sequencing verification are shown in fig. 4, and in combination with the figure, the mutant site TGG in the edited iPSC clone was successfully repaired to be the wild-type CGG.

The edited iPSCs were further identified, and the result is shown in fig. 5, wherein a is a morphological photograph, and it can be seen from the figure that clustered cells are visible on Matrigel, and have a clearer outline. B is the result of karyotype analysis, which shows that it has normal karyotype. C and D are expression results of identifying GC-ADO2-iPSCs pluripotency markers SSEA-4 and Tra-1-81 by flow cytometry respectively, and as can be seen in the figure, the cells can effectively express specific markers SSEA-4E and Tra-1-81 of pluripotent stem cells. E. F and G are the formation of GC-ADO2-iPSCs teratoma, and it can be seen from the figure that GC-ADO2-iPSC has the capacity of three germ layers to differentiate: endoderm (intestinal epithelial cells), mesoderm (cartilage) and ectoderm (neurorosettes). The results are combined, and the edited iPSC has the typical iPSC characteristics and is complete in chromosome.

The expression of CLCN7 in wild-type iPSCs (NC-iPSC), ADO2-iPSCs and GC-ADO2-iPSCs was analyzed by Western blotting, and beta-actin was used as a control, and as a result, as shown in FIG. 6, A is a gel image of Western blotting of different cells (2 cases of NC-iPSC, 3 cases of each of ADO2-iPSCs and GC-ADO 2-iPSCs), and B is the expression of CLCN7 in A relative to beta-actin, and it can be seen from the figure that the expression level of CLCN7 before and after repair did not change significantly. The results indicate that, at the iPSC stage, the expression level of the protein was not affected before and after CLCN7 gene repair.

By combining the method, the repair template plasmid is constructed, a target sequence is targeted through a specific sgRNA by virtue of a CRISPR/Cas9 technology, the repair template is utilized to carry out single-base mutation repair on a mutation site, so that corrected iPSCs based on ADO2 patients can be efficiently obtained, and the method can be further applied to treatment of the patients.

The present application has been described in detail with reference to the embodiments, but the present application is not limited to the embodiments described above, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present application. Furthermore, the embodiments and features of the embodiments of the present application may be combined with each other without conflict.

SEQUENCE LISTING

<110> Shenzhen Lin research medicine Limited

<120> Gene editing System for osteomalacia and use thereof

<130> 1

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

ccgcagagac acagagaagt 20

<210> 2

<211> 52

<212> DNA

<213> Artificial sequence

<400> 2

acttccgcag agacacagag aagcgggact tcgtctccgc aggggctgcg gc 52

<210> 3

<211> 52

<212> DNA

<213> Artificial sequence

<400> 3

tgaaggcgtc tctgtgtctc ttcgccctga agcagaggcg tccccgacgc cg 52

Claims

1. A gene editing system for a urolithiasis, comprising:

the CRISPR/Cas editing system comprises sgRNAs, and the nucleotide sequences of the sgRNAs are shown in SEQ ID No. 1;

the exogenous template comprises at least one nucleotide sequence shown in SEQ ID No. 2-3.

2. The gene editing system of claim 1, wherein the exogenous template is a double-stranded template comprising nucleotide sequences as set forth in SEQ ID nos. 2-3, respectively.

3. The gene editing system of claim 1, comprising a targeting vector comprising a nucleotide sequence of the sgRNA and an exogenous template vector comprising a nucleotide sequence of the exogenous template.

4. A gene editing system as claimed in claim 3, wherein the targeting vector is a px461 plasmid and the exogenous template vector is a pUC57 plasmid.

5. The gene editing system of claim 3, wherein the targeting vector further comprises a nucleotide sequence of a Cas9 protein.

6. The preparation method of the homologous recombination repairing cell is characterized by comprising the following steps:

and co-transfecting the targeting vector and the exogenous template vector to a cell to be repaired, and screening to obtain a gene editing and repairing cell, wherein the cell to be repaired has R286W mutation of a CLCN7 gene.

7. The method according to claim 6, wherein the cells to be repaired are induced pluripotent stem cells.

8. The preparation method according to claim 6, wherein the targeting vector further comprises a nucleotide sequence of Cas9 protein.

9. A homologous recombination repair cell produced by the production method according to any one of claims 6 to 8.

10. Use of the homologous recombination repair cells of claim 9 for the preparation of a cell therapy product.