CN116732070A - CGBE single base editor capable of realizing base transversion and application thereof - Google Patents

Abstract

The application provides a CGBE base editor capable of realizing base transversion and application thereof. The application designs and synthesizes a uracil glycosylase gene cUNG from cod, fuses mutant APOEE of a cytosine deaminase gene rAPO from rat and an inactivated Cas9 protein gene nSpCas9, and combines the APOEE-nCas9-cUNG genes, wherein the genes can realize base inversion of C-G. The application also provides an expression cassette and an expression vector comprising the APOEE-nCas9-cUNG gene, and application of the expression cassette and the expression vector in the aspect of rice gene editing. The application constructs a plant expression vector by using the designed APOEE-nCas9-cUNG gene, further constructs a rice targeting vector, leads to single base substitution of rice specific gene loci after being introduced into rice cells, and particularly realizes high-efficiency C-G base transversion.

Description

CGBE single base editor capable of realizing base transversion and application thereof

Technical Field

The application relates to the technical fields of biotechnology and plant genetic engineering. In particular, the application relates to an application of a novel CGBE base editor APOEE-nCas9-cUNG in rice gene targeting, and the CGBE single base editor can realize base transversion of specific sites.

Background

The current gene editing technology (ZFN, TALEN, CRISPR/Cas 9) relies on the induction of double strand breaks at target sites, thereby activating DNA repair mechanisms and achieving the purpose of gene correction. Thus, double strand break-based gene editing techniques are not only prone to DNA fragment insertions and deletions, but may also produce off-target effects and uncertain editing that ultimately affect the function of the target gene. And the appearance of single base editing technology can realize more accurate gene replacement.

Single base gene editing technology (base editors, BEs) refers to a gene editing technology that can cause single base changes on the genome. The basic principle is a gene editing technology which is formed by fusing cytosine deaminase (APOBEC) or adenosine deaminase with Cas9n (D10A) and is used for modifying single bases at positions 4-7 of a target far away from a PAM end depending on the CRISPR principle.

Based on CRISPR/Cas9 gene editing system, 4 months in 2016, the group David Liu, a biochemist of Harvard university, reported a new gene editing tool, a single base editing system, in the journal of Nature. The single base editing system is mainly composed of two parts of sgRNA and fusion protein, wherein the fusion protein is generally composed of an engineered Cas9 protein, cytosine deaminase and uracil glycosylase inhibitor, and the fusion protein of the emerging group only comprises two parts of Cas9 and cytosine deaminase. The sgrnas act by complementarily pairing to a target site, directing the binding of the fusion protein to the target site. Ext> theext> twoext> baseext> editingext> systemsext> utilizeext> cytosineext> deaminaseext> orext> artificiallyext> evolvedext> adenineext> deaminaseext> toext> accuratelyext> editext> aext> targetext> siteext>,ext> andext> finallyext> canext> respectivelyext> realizeext> theext> baseext> replacementext> ofext> Cext> -ext> Text> (ext> Gext> -ext> Aext>)ext> orext> Aext> -ext> Gext> (ext> Text> -ext> Cext>)ext>.ext>

In addition to the base transition, the base transversion (C-A, C-G, etc.) is also a great proportion in the point mutation, and in 2020, the national institute of biotechnology of the national academy of sciences, zhang Xueli and Bi Chang laboratories, the general hospitals of the Harvard medical college, J.Keith Joung and Julian Gru newald laboratories, respectively, construct a highly efficient new tool GBE/CGBE for mediating C-G base transversion by modifying the existing single base editing tool CBE. Subsequently, qi Yiping and cinnabar health teams have respectively performed a series of growths and optimizations on different uracil DNA glycosylases, cytosine deaminase, and vector structures, etc., effecting the base transversions of C-G in plants. However, CGBE still has the problems of low efficiency, more byproducts and the like in plants at present, which may be caused by the great difference of repairing modes in animals and plants, so that the development of a single base editing tool capable of realizing base inversion with high efficiency in plants is urgent.

Disclosure of Invention

In order to solve the above problems, in order to achieve a highly efficient, precisely controllable CGBE single base editing tool developed in plants, the present application provides a novel highly efficient tool for editing while maintaining the gene editing accuracy by replacing and fusing the uracil glycosylase gene cnung derived from cod in a CGBE single base editing system, and in addition, the present inventors found a mutant of APO by mutating arginine (R) at position 125 of APO to glutamic acid (E); the 131 rd arginine (R) is mutated into glutamic acid (E) to obtain the mutant, the corresponding nucleotide sequence is APOEE, and better base conversion efficiency can be obtained by utilizing the APOEE to be matched with cUNG. The novel CGBE base editing tool APOEE-nCas9-cUNG can realize accurate and efficient base transversion tools from C to G.

The application designs and optimizes uracil DNA glycosylase (cUNG) genes from cod in rice, and forms fusion protein APOEE-nCas9-cUNG by fusing cytosine deaminase variant APOEE genes from rats and inactivated nSpCas9 protein genes, wherein the sequence of the fusion protein APOEE-nCas9-cUNG is shown in a sequence table. The apoe-nCas 9-cnng gene was integrated into the expression vector pHUC411 of the proprietary title of the laboratory. On the basis, a corresponding targeting vector is constructed, and then, the precise editing of specific genes in rice is realized through genetic transformation of the rice.

In particular, in a first aspect, the present application provides a novel single base editor apoe-nCas 9-cnung, characterized in that the gene sequence of the apoe-nCas 9-cnung base editor comprises at least:

(a) The nucleotide sequence shown in SEQ ID NO. 1; or alternatively

(b) A nucleotide sequence capable of performing rice genome cleavage by substituting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or alternatively

(c) A nucleotide sequence which adds one or more nucleotides to the nucleotide sequence shown in SEQ ID NO.1 and is capable of performing genome cleavage in rice; or alternatively

(d) The nucleotide sequence shown in SEQ ID NO.1 lacks one or more nucleotides and is capable of performing genome cleavage in rice.

The gene of the editor APOEE-nCas9-cUNG consists of a nucleotide sequence shown in SEQ ID NO.1 in a sequence table.

In another aspect, the present application provides an expression cassette, wherein the expression cassette comprises a gene sequence of a single base editor APOEE-nCas9-cUNG.

In another aspect, the present application provides an expression vector, wherein the expression vector comprises the single base editor apoe-nCas 9-cnng or the expression cassette.

In another aspect, the application provides the use of said gene, said expression cassette or said vector, characterized in that said use comprises effecting single base editing of the rice genome using said single base editor apoe-nCas 9-cnung to obtain a transgenic plant or plant part containing single base mutations.

The application comprises the steps of utilizing the single base editor APOEE-nCas9-cUNG to identify a PAM sequence with NGG characteristics, completing the shearing of DNA double chains in rice bodies, and obtaining transgenic plants or plant parts with single base mutation sites from C to G under the action of a self repair system.

The construction method of the plant expression vector containing the APOEE-nCas9-cUNG gene comprises the following steps: three genes of APOEE, nCas9 and cUNG are connected in series on a T vector through a seamless cloning technology; the pHUC SPR vector is cut by using PstI/SacI enzyme and recovered, and as the PstI/SacI enzyme cutting sites are added at the two ends of the T-APOEE-nCas9-cUNG sequence, the APOEE-nCas9-cUNG can be connected to the pHUC SPR vector by using T4 ligase to obtain the plant expression vector pHUC APOEE-nCas9-cUNG; further, the U3 SPR sg2.0PolyT expression cassette was ligated into pHUC APOEE-nCas9-cUNG using T4 ligase through the HindIII cleavage site to give pHUC411 APOEE-nCas9-cUNG.

On the other hand, on the basis of the expression vector, a corresponding gene targeting vector is constructed according to the actual requirement of the experiment. In another aspect, the present application provides a method for introducing a targeting vector (apoe-cGBE-TAC) into a rice cell using an apoe-nCas 9-cnung expression vector (which contains the apoe-nCas 9-cnung gene with high editing efficiency and uses thereof), which can obtain a targeting vector (apoe-cGBE-TAC) of a specific gene by performing only simple annealing and cleavage ligation on the basis of the expression vector, comprising the steps of:

(1) Removing shell of rice seeds, sterilizing, separating embryo, and placing on callus induction medium to generate secondary callus;

(2) Transferring the secondary callus to a new callus induction medium for preculture;

(3) Contacting the callus obtained in step (2) with agrobacterium carrying a targeting vector for apoe-nCas 9-cnung (apoe-nCas 9-cnung-TAC) for 15min;

(4) Transferring the callus in the step (3) to a culture dish on which three sterile filter papers (2.5-3.5 mL of agrobacterium suspension medium is added) are placed, and culturing for 48 hours at 21-23 ℃;

(5) Placing the callus in the step (4) on a pre-screening culture medium to culture for 5-7d;

(6) Transferring the callus of step (5) onto a screening medium to obtain a resistant callus;

(7) Transferring the resistant callus to a differentiation regeneration medium to differentiate into seedlings;

(8) Transferring the seedlings in the step (7) into a rooting culture medium for rooting.

Wherein the seed in step (1) is a mature seed; the induction medium in the steps (1) and (2) is an induction medium listed in the explanatory table 1; contacting with agrobacterium in step (3) is immersing the callus in the agrobacterium suspension; the agrobacterium suspension medium in step (4) is the suspension medium listed in table 1 of the specification; the pre-screening medium in step (5) is illustrative of the pre-screening medium listed in table 1; the screening media of step (6) are those listed in Table 1; the differentiation and regeneration medium in the step (7) is a differentiation and regeneration medium listed in table 1 of the specification; the rooting medium in step (8) is the rooting medium listed in Table 1.

In a preferred embodiment, wherein the rice is japonica rice, more preferably, the rice is japonica Nipponbare.

Table 1 exemplary formulation of the medium

TABLE 1

The "optimized N6 macroelements" mentioned in the tableThe element "refers to [ NO ] in the N6 macroelement ₃ -]/[NH ₄ +]＝40mM/10mM。

In a preferred embodiment, the nucleotide sequence of the APOEE-nCas9-cUNG marker gene is the nucleotide sequence shown in SEQ ID NO.1, specifically as follows:

technical effects

The editor provided by the application can realize accurate and efficient base transversion from C to G in plants, and the editor is repeatedly verified by the application, so that the editor can be effectively applied to crops such as rice and the like and used as an editor with high editing efficiency. The editor is used for editing rice genes, so that more mutants with C to G transversions can be edited, more random mutations can be obtained, or a mutant library with more mutations can be obtained.

The application also provides an excellent gene resource for the CRISPR/Cas9 gene editing system, and has great research significance and social value.

Drawings

FIG. 1 is a schematic representation of pHUC411-APOEE-nCas9-cUNG vector plasmids.

FIG. 2 shows an example of APOEE-nCas9-cUNG editing TAC gene mutation.

FIG. 3 is a diagram of the Sanger sequencing of the APOEE-nCas9-cUNG edited TAC gene.

Detailed Description

Embodiments of the present application are described below with reference to the accompanying drawings. It should be noted that the following examples are only illustrative of exemplary implementations of the present application and are not intended to limit the present application in any way. Certain equivalent modifications and obvious improvements to the present application may be made by those skilled in the art.

The operations in the following detailed description are performed using conventional operations commonly used in the art without additional specificity. The person skilled in the art can easily obtain teachings about such conventional operations from the prior art, for example, see textbooks Sambrook and David Russell, molecular Cloning: ALaboratory Manual,3rd ed., vols1,2; charles Neal Stewart, alicher Touraev, vitaly Citovsky and Tzvi Tzfira, plant Transformation Technologies, etc. The raw materials, reagents, materials and the like used in the following examples are all commercially available products unless otherwise specified.

Example 1 construction of APOEE-nCas9-cUNG

The inventors of the present application constructed a CGBE base editing system using uracil DNA glycosylase (cnung) fusion inactivated nscas 9 protein from cod, and apoe cytosine deaminase by the following procedure and named apoe-nCas 9-cnung. Meanwhile, a CGBE base editing system is formed by fusing inactivated nSpCas9 protein and APOEE cytosine deaminase by using uracil DNA glycosylase (hUNG) from human sources as a contrast, and the CGBE base editing system is named as APOEE-nCas9-hUNG.

Specifically, the cUNG gene constructed by the application is synthesized by the biological technology Co., ltd. In Suzhou Jin Weizhi, is connected to a PUC57-AMP vector to form a PUC57-AMP-cUNG vector, and is loaded into an E.coli XL-blue strain.

Secondly, two amino acids of PUC57-Amp-rAPO were mutated using a point mutation kit purchased from the holoepith organism, respectively: arginine (R) at position 125 is mutated to glutamic acid (E); arginine (R) at position 131 is mutated to glutamic acid (E); the mutated gene was designated PUC57-Amp-APOEE (R125E, R131E). In addition, the nscas 9 gene sequence laboratory has been maintained.

According to the Gibson splice principle, the APOEE gene, the nSpCas9 gene and the cUNG gene are connected together and connected to a modified Quan Shi gold T vector, and the APOEE-nCas9-cUNG-T-SPR is named. The specific operation is as follows:

according to APOEE gene, nSpCas9 gene, splicing sequence of cUNG gene and T vector sequence, respectively synthesizing primers:

BP NLS-ABE8 FP:

BP NLS for APOEE HR RP:

APOEE for bpNLS HR FP:

nCas9 for cUNG HR RP:

cUNG for nCas9 HR FP:

BP NLS for T HR RP:

PCR was performed using PUC57-Amp-APOEE (R125E, R131E) as a template and primers BP NLS-ABE8 FP and BP NLS for APOEE HR RP, and the PCR product was recovered. PCR amplification was performed with primers APOEE for bpNLS HR FP and nCas9 for cUNG HR RP using the laboratory-stored nSpCas9 gene as template, and the PCR product was recovered. PCR was performed using PUC57-AMP-cUNG as a template and primers cUNG for nCas9 HR FP and BP NLS for T HR RP, and the PCR product was recovered. The three recovery fragments and the T-SPR vector fragment after EcoRI digestion are combined into an APOEE gene, an nSpCas9 gene and a cUNG gene fused together according to the NEBuilder HiFi DNAAssembly Reaction Protocol specification and the Gibson splicing principle, and the genes are named as APOEE-nCas9-cUNG-T-SPR, and the APOEE-nCas9-cUNG-T-SPR is transferred into escherichia coli XL-blue.

Example 2 construction of plant targeting vector containing APOEE-nCas9-cUNG Gene

From the E.coli XL-blue containing the APOEE-nCas9-cUNG-T-SPR vector obtained above, the plasmid was extracted with the Axygen plasmid extraction kit, digested with PstI/SacI, and the APOEE-nCas9-cUNG fragment was recovered. And simultaneously, carrying out linearization treatment on pHUC SPR by using PstI/SacI enzyme, recovering the pHUC SPR, and connecting the APOEE-nCas9-cUNG fragment and the pHUC SPR fragment by using T4 ligase (purchased from NEB company) to obtain the pHUC APOEE-nCas9-cUNG. Further, the U3 SPR sg2.0PolyT expression cassette was ligated into pHUC APOEE-nCas9-cUNG using T4 ligase via the HindIII cleavage site to give pHUC411 APOEE-nCas9-cUNG (FIG. 1).

Nucleotide sequence 2869-2891 in rice TAC gene (Os 09g 0529300) was selectedCCCTTTCACCTTTTGCGGGATTT (underlined is the PAM sequence of the 5'ngg-3' structure), the corresponding sgRNA sequence was AAATCCCGCAAAAGGTGAAA as a targeting site. And synthesizing an sgRNA sequence, and connecting the sgRNA sequence to an APOEE-nCas9-cUNG expression vector to form a targeting editing vector APOEE-nCas9-cUNG-TAC. The fused plant expression vector was transferred into agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 strain (saved by the university of agro-college of security) for genetic transformation using freeze thawing (fig. 2).

Example 3-genetic transformation of Rice and mutant acquisition Using APOEE-cGBE-TAC as targeting vector.

1. Induction and preculture of mature embryo callus

Removing shell from mature seeds of Japanese sunny, selecting seeds with normal appearance and clean and no mildew spots, shaking with 70% alcohol for 90s, and pouring out alcohol; the seeds were washed with 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%) containing Tween20, 1 drop of Tween20 was added per 100 ml, and shaken on a shaker for 45min (180 r/min). Pouring out sodium hypochlorite, washing with sterile water for 5-10 times until no sodium hypochlorite smell exists, and finally adding sterile water and soaking overnight at 30 ℃. Embryos were separated along the aleurone layer with a scalpel blade and scutellum placed up on induction medium (composition see table 1), 12 grains/dish, and dark cultured at 30 ℃ to induce callus.

After two weeks, spherical, rough and pale yellow secondary calli appear, and the pre-culture operation can be carried out, namely, the secondary calli are transferred to a new callus induction culture medium, and the secondary calli are subjected to dark culture at 30 ℃ for 5 days. After the preculture is finished, small particles with good states and vigorous division are collected into a 50mL sterile centrifuge tube by a spoon and used for agrobacterium infection.

2. Cultivation of Agrobacterium Strain and suspension preparation

Agrobacterium strain EHA105 containing the APOEE-nCas9-cUNG-TAC vector was streaked on LB plates containing 50mg/L kanamycin (see Table 1 for ingredients), dark incubated at 28℃for 24h, and after 24h the activated Agrobacterium was inoculated with a sterile inoculating loop onto fresh LB plates of 50mg/L kanamycin for a second activation, dark incubation overnight at 28 ℃. 20-30mL of Agrobacterium suspension medium (composition shown in Table 1) was added to a 50mL sterile centrifuge tube, activated 2 times with an inoculating loop, OD660 was adjusted to about 0.10-0.25, and the mixture was allowed to stand at room temperature for 30min or more.

3. Infection and co-cultivation

To the prepared callus (see step 1), the Agrobacterium suspension was added and soaked for 15min, with gentle shaking in between. Pouring out the liquid after the soaking is finished (the liquid is dripped as much as possible), sucking out the superfluous agrobacterium liquid on the surface of the callus by using sterile filter paper, and drying by using sterile air in an ultra clean bench. Three pieces of sterile filter paper are placed on a disposable sterile petri dish with the thickness of 100 multiplied by 25mm, 2.5mL of agrobacterium suspension medium is added, the callus after the suction is uniformly dispersed on the filter paper, and the callus is cultivated for 48 hours in the dark at the temperature of 23 ℃.

4. Pre-screening and screening culture

After the end of co-cultivation, the co-cultivated calli were evenly spread in pre-screening medium (composition see Table 1), and cultivated in the dark at 30℃for 5 days. After the pre-screening culture is finished, transferring the calli to a screening culture medium (the composition is shown in table 1), inoculating 25 calli to each culture dish, culturing in the dark at 30 ℃, and after 2-3 weeks, obviously growing the resistant calli, and carrying out differentiation and regeneration operation.

5. Differentiation and regeneration

2-3 small fresh particles with good growth state are selected for each independent transformant and transferred to a differentiation regeneration medium (the composition is shown in Table 1). Each dish was inoculated with 5 independent transformants. Culturing at 28deg.C under light with light intensity of 3000-6000lx for 16 hr and 8 hr in dark.

6. Rooting and transplanting

When the buds of the resistant callus grow to about 2cm, only one well-grown seedling is taken from each independent transformant, and the seedlings are transferred to a rooting medium (the composition is shown in table 1), and are cultivated by illumination at 28 ℃ for 16 hours, dark for 8 hours and light intensity of 3000-6000lx. After two weeks, young seedlings with developed root systems are selected, the culture medium is washed off by water, and the young seedlings are transplanted into soil.

7. Molecular characterization

Before transplanting, rice leaf samples are taken, and DNA small extraction is carried out by using a CTAB method. The resulting genomic DNA samples were used for PCR analysis. The following primers were designed for PCR identification:

TAC check FP:GAGCTGGTTGAGTAGTCGAA

TAC check RP:GGCGAGCGAATAGGCAGCAA

used to amplify 263bp sequences near the TAC target. The PCR fraction was first kept at 95℃for 5min, and then subjected to 35 cycles: 94℃for 30s, 62℃for 30s, 72℃for 20s, and finally 72℃for 5min. And 5. Mu.L of amplified product is taken for agarose gel electrophoresis verification, and the PCR product is subjected to Mulberry sequencing if the band size is consistent. The sequencing results were aligned with two control sequences. Control sequence 1 is an apoe-nCas 9-hnenge sequence containing only mutant apoe, no optimized sequence cnng, and control sequence 2 is a wild-type sequence APO-nCas 9-hnenge (no mutant apoe and cnng provided herein).

APO has the sequence of

The hUNG sequence is:

plants containing the gene sequences of the present application and the control gene were cultivated separately in the manner of the above examples.

In the offspring plants obtained from APOEE-nCas9-cUNG-TAC, 28C-G mutations appear in the detected 48 plants, and the editing efficiency reaches 58.3%. In the same manner, plants were obtained in which the TAC gene was edited by APOEE-nCas9-hUNGE, and as a result, 10 of the 54 plants examined had C-G mutation, with an editing efficiency of 18.5%. The same operation is used for obtaining plants of APO-nCas9-hUNGE for editing TAC genes, and 6C-G mutations appear in the 54 detected plants in the obtained offspring plants, wherein the editing efficiency is only 11.1%.

It follows that the use of APOEE in combination with cUNG is a CGBE base editor that can achieve efficient C-G base transversions.

The above experiment was repeated 3 times, and the average editing efficiency of the C-G transversion of the plant containing the APOEE-nCas9-cUNG gene of the application can be maintained between 55 and 60%, thus proving the effectiveness of the editor.

Claims (8)

1. A CGBE single base editor capable of realizing base transversion, characterized in that the single base editor is apoe-nCas 9-cnng, and the gene sequence at least comprises:

(a) The nucleotide sequence shown in SEQ ID NO. 1; or alternatively

(b) A nucleotide sequence capable of performing rice genome cleavage by substituting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or alternatively

(c) A nucleotide sequence capable of performing genome cleavage in rice by adding one or more nucleotides to the nucleotide sequence shown in SEQ ID NO. 1; or alternatively

(d) The nucleotide sequence shown in SEQ ID NO.1 lacks one or more nucleotides and is capable of performing genome cleavage in rice.

2. The CGBE single base editor capable of effecting a base transversion according to claim 1, characterized in that the gene of the CGBE single base editor consists of the nucleotide sequence shown in SEQ ID No.1 in the sequence listing.

3. An expression cassette comprising the gene sequence of the CGBE single base editor of claim 1.

4. An expression vector comprising the CGBE single base editor of claim 1 or the expression cassette of claim 3.

5. The CGBE single base editor of claim 1, the expression cassette of claim 3 or the vector use of claim 4, wherein the use comprises effecting single base editing of C-G of a rice genome using the single base editor gene.

6. The use according to claim 5, wherein the CGBE single base editor apoe-nbas 9-cnng is used to mutate the C base at a specific or non-specific site in the target gene sequence to G, resulting in a transgenic plant or plant part containing a single base mutation.

7. A method of introducing the CGBE single base editor of claim 1 into a rice cell.

8. The method according to claim 7, characterized in that it comprises the following steps:

(1) Removing shell of rice seeds, sterilizing, separating embryo, and placing on callus induction medium to generate secondary callus;

(2) Transferring the secondary callus to a new callus induction medium for preculture;

(3) Contacting the callus obtained in step (2) with agrobacterium of a targeting vector carrying a CGBE single base editor for 15 minutes;

(4) Transferring the callus in the step (3) to a culture dish with three sterile filter papers laid on the culture dish, and culturing at 21-23 ℃ for 48 hours;

(5) Placing the callus in the step (4) on a pre-screening culture medium for culturing for 5-7 days;

(6) Transferring the callus of step (5) onto a screening medium to obtain a resistant callus;

(7) Transferring the resistant callus to a differentiation regeneration medium to differentiate into seedlings; and

(8) Transferring the seedlings in the step (7) into a rooting culture medium for rooting.