CN110283838A - A kind of high shear efficiency ScCas9 gene and its application - Google Patents

Abstract

The present invention provides a kind of high shear efficiency ScCas9 gene and its applications.The high shear efficiency ScCas9 gene has nucleotide sequence shown in SEQ ID No:1.High shear efficiency ScCas9 gene provided by the invention can significantly improve shear efficiency.The present invention also provides the expression cassettes based on high shear efficiency ScCas9 gene.Also, high shear efficiency ScCas9 gene is connected in expression vector and forms recombinant expression carrier by the present invention.Carrier of the invention is PUC57-AMP or pHUN400.In addition, the present invention obtains genetically modified mutant using the high shear efficiency ScCas9 gene.

Description

A kind of high shear efficiency ScCas9 gene and its application

Technical field

The present invention relates to biotechnologys and field of plant genetic project technology.Specifically, the present invention relates to a kind of high shears Efficiency ScCas9 gene, expression cassette, expression vector containing the high shear efficiency ScCas9 gene, targeting vector, transgenosis are thin Born of the same parents and their application.

Background technique

Genome editing system CRISPR-Cas9 has become the very important tool of one of medical research, and most Eventually significant impact may be generated in fields such as agricultural, bioenergy and food safeties.CRISPR-Cas9 can pass through short RNA piece Section (i.e. guide RNA, gRNA) be directed to the different loci on genome, then using it is a kind of be known as Cas9 DNA nickase with Change the editor needed for site carries out again afterwards.However, although this gene editing tool achieves considerable success, it The bit number of points being able to access that on genome are still limited.This is because CRISPR-Cas9 needs a kind of referred to as space before Sequence is present in the target position on genome adjacent to the specific dna sequence of motif (protospacer adjacent motif, PAM) Point two sides, so that it be allowed to identify target site.For example, coming from streptococcus pyogenes as a kind of most widely used Cas9 enzyme The PAM sequence of the Cas9 (SpCas9) of (Streptococcus pyogenes) is 5 '-NGG-3 '.In this PAM sequence, two A continuous bases G there are the bit number of points that limits SpCas9 significantly and can target, only account on genome about 9.9% site, target area are extremely limited to.

It finally found that a kind of most successful enzyme that they find is from streptococcus canis (Streptococcus canis) Cas9 (ScCas9), it is closely similar with the SpCas9 enzyme being widely used.ScCas9 is the variant of base edition SpCas9, two The amino acid sequence of person is closely similar, but it can target the target DNA sequence that SpCas9 can not be targeted.The PAM of ScCas9 Sequence is 5 '-NNG-3 '.In this PAM sequence, there is only a bases Gs, this allows for ScCas9 ratio SpCas9 to target More sites in genome: the nearly site of half is accounted in genome.In addition, ScCas9 use is identical with SpCas9 gRNA。

But the ScCas9 used now is separated from prokaryotes Escherichia coli, and such ScCas9 gene was both There is potential risks, and are difficult to realize the high shear efficiency to DNA double chain.

Summary of the invention

The purpose of the invention is to overcome drawbacks described above of the existing technology, a kind of high shear efficiency ScCas9 is provided Gene and its application in Plant Genome editor,

To achieve the goals above, one aspect of the present invention provides a kind of high shear efficiency ScCas9 gene, the high shear Efficiency ScCas9 gene has nucleotide sequence shown in nucleotide sequence shown in SEQ ID No:1 or SEQ ID No:1 Homologous sequence.

Second aspect of the present invention provides a kind of expression cassette, and the expression cassette contains high shear efficiency ScCas9 as described above Gene.

Third aspect present invention provides a kind of expression vector, and the expression vector is inserted with high shear efficiency as described above ScCas9 gene or expression cassette as described above.

Fourth aspect present invention provides a kind of targeting vector, and the targeting vector is inserted with high shear efficiency as described above ScCas9 gene or expression cassette as described above and target site sequence.

Fifth aspect present invention provides a kind of transgenic cell, and the transgenic cell has been transferred to high shear as described above Efficiency ScCas9 gene, expression cassette as described above, expression vector as described above or targeting vector as described above.

Sixth aspect present invention provides high shear efficiency ScCas9 gene as described above, expression cassette as described above, such as Upper expression vector, targeting vector as described above or the transgenic cell as described above are in Plant Genome editor Using, wherein the Plant Genome editor includes shearing to Plant Genome, obtains transgenosis containing mutation sites Plant or plant part.

On the other hand, the present invention provides a kind of method for obtaining rice mutant using non-bacterial source Cas9 gene, In, the method includes high shear efficiency ScCas9 genes described in artificial synthesized claim 1, by high shear efficiency ScCas9 gene is connected to carrier and obtains recombinant expression carrier, the recombinant expression carrier is imported in plant cell, to described Genome in plant cell is sheared, and genetically modified mutant is obtained.

High shear efficiency ScCas9 gene provided by the invention is obtained not by bacterial pathway, but is chemically synthesized , the ScCas9 for reducing bacterial origin may adversely affect transformant acceptor gene group bring.And using the present invention Gene can significantly improve shear efficiency.

Detailed description of the invention

Fig. 1 is the PHUN4C11 vector plasmid schematic diagram that embodiment 2 constructs.

Fig. 2 is the targeting mutation that ScCas9 of the invention in the transgenic plant of the building of embodiment 3 is generated.WT expression is not dashed forward The sequence of change, drawing horizontal line part is PAM sequence, and d indicates missing, and i indicates insertion, digital representation base number.

Specific embodiment

Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.

The endpoint of disclosed range and any value are not limited to the accurate range or value herein, these ranges or Value should be understood as comprising the value close to these ranges or value.For numberical range, between the endpoint value of each range, respectively It can be combined with each other between the endpoint value of a range and individual point value, and individually between point value and obtain one or more New numberical range, these numberical ranges should be considered as specific open herein.

In a first aspect, the present invention provides a kind of high shear efficiency ScCas9 gene, the high shear efficiency ScCas9 gene With nucleotide sequence shown in SEQ ID No:1.

It should be noted that in case of no particular description, in the context of the present invention, height provided by the invention Shear efficiency ScCas9 base is known as ScCas9 or Op ScCas9, and original ScCas9 gene, that is, Escherichia coli ScCas9 gene, referred to as original ScCas9 gene.

The present invention should be noted " having nucleotide sequence shown in SEQ ID No:1 " of the present invention simultaneously It is non-refer to it is arbitrary containing the nucleotide sequence shown in the SEQ ID No:1 in addition to nucleotide or nucleotide sequence, and refer to According to the conventional means of those skilled in the art, for the ease of or be conducive to nucleotide sequence shown in SEQ ID No:1 into Row operation realizes duplication etc. of nucleotide sequence shown in SEQ ID No:1 and the nucleosides for not influencing its Function that contains Acid or nucleotide sequence, for example, restriction enzyme site, marker gene, screening-gene etc..Therefore, of the present invention " to there is SEQ ID Nucleotide sequence shown in No:1 " refers to nucleotide sequence shown in SEQ ID No:1, but still can be realized SEQ ID The sequence of nucleotide sequence function shown in No:1.

A kind of specific embodiment according to the present invention, the nucleotide sequence of the Op ScCas9 gene such as SEQ ID Shown in No:1.

The construction method of expression vector can be carried out according to the method for this field routine in the present invention, for example, using identical Restriction enzyme digestion is carried out to Op ScCas9 gene and the carrier that is inserted into, then reuse ligase for Op ScCas9 gene is connected in carrier, obtains expression vector of the invention.

Wherein, the restriction enzyme can carry out specific according to the restriction enzyme site being introduced into Op ScCas9 gene Selection, for example, can be NotI/SacI restriction enzyme.

Wherein, the ligase can be commonly used in the art various can be attached two kinds of nucleic acid fragments Ligase, for example, can be T4 ligase.

Wherein, the carrier can be various carriers commonly used in the art, it is preferred that the carrier can be PUC57-AMP and pHUN400, these carriers can be commercially available.It can use NotI/SacI restriction enzyme site, use NotI/SacI digestion pHUN400 carrier and Op ScCas9 gene simultaneously recycle, and utilize T4 ligase by Op ScCas9 gene later It is connected to pHUN400 carrier, obtains plant expression vector pHUN-Op ScCas9 (abbreviation pHUN 4C00).Synthesize guide RNA (sgRNA) expression cassette.It include: rice Os U3 promoter, spectinomycin resistance gene SpR, artificial synthesized sgRNA frame sequence With Poly-T terminator (sequence is as shown in SEQ ID No:2).Utilize HindIII enzyme digestion pHUN 4C00 and sgRNA expression cassette SgRNA expression cassette segment is connected into pHUN 4C00 segment with T4 ligase, obtains plant expression vector pHUN by segment 4C00-sgRNA is named as pHUN 4C11.

Targeting vector of the invention is inserted with high shear efficiency ScCas9 gene as described above or expression as described above Box and target site sequence.

Depending on the target site sequence can carry out the sequence of genome editor according to actual needs, but the target site Sequence need include NNG feature PAM sequence.A kind of specific embodiment according to the present invention, the target site sequence are SEQ Nucleotide sequence that ID No:3 shows (1440-1462 nucleotide sequences in rice Os PDS gene (Os03g0184000), Sequence is CATTGCCTGCACCCTTAAATGG, underscore part is the PAM sequence of NNG structure, wherein N A, T, G or C).

The targeting vector only need to simply be annealed on the basis of expression vector, digestion connection function can obtain ?.

The application of heretofore described high shear efficiency ScCas9 gene is including the use of the high shear efficiency ScCas9 base The PAM sequence of NNG feature is had because identifying, completes the shearing of DNA double chain in rice body, and in the effect of itself repair system Under, obtain the genetically modified plants with mutational site or plant part.

Targeting vector is imported into the method in plant cell can carry out according to the method for this field routine, here no longer It is described in detail.

A kind of specific embodiment according to the present invention, by the method for targeting vector Introduced into Rice cell, including following steps It is rapid:

After mature rice paddy seed removes glume, seed 1min is impregnated with 70% alcohol, outwells alcohol.It is dripped with containing 1 50% sodium hypochlorite (stoste effective chlorine density is greater than 4%) solution of Tween20 impregnates seed 40min (150r/min).It outwells Sodium hypochlorite, it is sterile to wash 5 times to solution clarification, no sodium hypochlorite taste.Sterile water impregnates seed and stays overnight.With scalpel along kind The aleurone of son peels embryo, and embryo is inoculated on calli induction media.At 30 DEG C after dark culture 11 days by callus with Endosperm and germ separation are used for after carrying out the primary callus in good condition, that division is vigorous for removing bud preculture 3~5 days The conversion of Agrobacterium.

Agrobacterium-mediated genetic transformation is carried out using the Agrobacterium tumefaciems for being transferred to targeting vector in the above process, is obtained Positive transgenic rice plant, the genetic transformation, transformant screening and transgenic plant regeneration etc. are referring to Yongbo Duan (Yongbo Duan,Chenguang Zhai,et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phOsphomannOse isomerase pOsitive selection in Japonica rice(Oryza sativa L.)[J].Plant Cell Report, The method of propositions such as 2012.DOI10.1007/s00299-01201275-3.).

In preferred embodiments, wherein the rice is japonica rice, it is highly preferred that the rice is japonica rice OryzasativaLcv.Nipponbare.

In preferred embodiments, the nucleotides sequence of the Op ScCas9 marker gene is classified as shown in SEQ ID NO:1 Nucleotide sequence, it is specific as follows:

ATGGAGAAAAAGTACTCCATCGGGCTCGACATTGGGACCAATAGCGTGGGGTGGGCCGTCATCACCGAC GACTATAAGGTCCCAAGCAAAAAGTTCAAAGTGCTGGGGAACACAAATCGCAAGAGCATCAAGAAAAATCTGATGGG CGCGCTCCTCTTCGACAGCGGCGAAACCGCCGAAGCGACAAGGCTCAAGAGGACAGCGAGGCGCCGCTATACCCGCC GCAAAAATCGCATTCGCTATCTCCAAGAGATCTTCGCCAACGAGATGGCGAAGCTCGATGACAGCTTCTTCCAGAGG CTGGAGGAATCCTTTCTCGTCGAGGAAGACAAGAAGAATGAGCGCCACCCAATTTTCGGGAATCTCGCGGACGAGGT CGCCTACCATCGCAATTATCCAACCATTTATCATCTCCGCAAGAAGCTGGCCGACTCCCCGGAGAAGGCCGATCTGA GGCTCATCTACCTCGCGCTCGCGCACATCATTAAGTTTCGCGGGCACTTTCTCATCGAAGGCAAGCTGAACGCCGAA AATTCCGACGTCGCCAAGCTGTTCTATCAGCTCATTCAGACCTACAACCAGCTCTTCGAAGAGAGCCCGCTGGATGA GATCGAGGTGGATGCGAAGGGCATTCTCAGCGCGAGGCTCAGCAAGTCCAAAAGGCTCGAGAAGCTGATCGCCGTGT TCCCGAATGAGAAGAAGAATGGGCTGTTCGGCAATATTATTGCCCTCGCGCTCGGGCTGACACCGAATTTCAAGTCC AACTTCGACCTCACAGAGGACGCGAAGCTGCAGCTGAGCAAAGACACCTACGACGACGATCTCGACGAACTGCTCGG GCAAATTGGGGATCAGTATGCCGATCTGTTCTCCGCCGCCAAGAACCTCAGCGACGCGATTCTGCTCTCCGACATTC TGCGCTCCAACAGCGAAGTCACCAAAGCGCCACTCTCCGCGAGCATGGTGAAACGCTACGACGAGCATCATCAAGAT CTCGCGCTCCTCAAGACCCTCGTGCGCCAGCAGTTCCCGGAAAAATACGCGGAGATTTTCAAGGACGACACCAAGAA TGGGTACGCCGGCTACGTGGGGATCGGCATCAAGCATCGCAAGAGGACAACCAAGCTGGCGACACAAGAGGAGTTTT ACAAGTTCATTAAGCCGATCCTCGAGAAGATGGACGGCGCGGAGGAACTGCTGGCCAAACTCAACCGCGATGACCTC CTCCGCAAGCAAAGGACCTTCGACAACGGCTCCATTCCACACCAGATCCACCTCAAAGAACTGCATGCCATTCTGCG CCGCCAAGAGGAGTTCTACCCGTTTCTCAAAGAGAATCGCGAGAAAATTGAGAAAATCCTCACCTTCCGCATTCCAT ACTACGTCGGGCCACTGGCGAGGGGGAATTCTCGCTTCGCGTGGCTCACACGCAAGAGCGAGGAGGCGATTACCCCA TGGAACTTCGAGGAGGTCGTGGATAAGGGCGCGTCCGCCCAGTCCTTTATTGAGCGCATGACCAATTTTGACGAGCA GCTCCCGAATAAGAAGGTGCTGCCGAAGCACTCTCTCCTCTATGAATATTTTACCGTCTACAACGAACTCACCAAAG TCAAGTACGTCACCGAGCGCATGAGGAAGCCGGAGTTTCTCAGCGGGGAGCAGAAAAAAGCCATCGTGGATCTCCTC TTTAAGACCAACCGCAAGGTGACCGTGAAGCAACTCAAAGAGGATTATTTTAAGAAGATTGAGTGCTTTGACAGCGT GGAGATCATCGGGGTCGAAGACCGCTTCAACGCCAGCCTCGGGACCTACCACGACCTCCTCAAGATTATTAAAGACA AAGACTTTCTGGATAACGAGGAGAACGAAGACATCCTCGAAGATATCGTGCTCACCCTCACACTCTTTGAGGACCGC GAGATGATCGAGGAGAGGCTCAAGACCTATGCGCATCTCTTTGACGACAAGGTGATGAAGCAGCTCAAGAGGCGCCA TTACACCGGCTGGGGGAGGCTCTCTCGCAAGATGATCAACGGCATTAGGGACAAACAGTCCGGCAAGACCATTCTCG ACTTCCTCAAGTCCGATGGCTTCAGCAATAGGAACTTCATGCAGCTGATCCACGATGATTCTCTCACATTCAAGGAG GAAATTGAGAAAGCCCAAGTGTCCGGCCAAGGCGACTCCCTCCATGAGCAGATCGCCGATCTGGCGGGGTCCCCAGC CATTAAAAAGGGGATCCTCCAGACCGTGAAAATTGTGGACGAACTCGTCAAGGTCATGGGGCATAAGCCGGAGAACA TCGTCATCGAGATGGCCCGCGAAAACCAGACCACCACAAAAGGCCTCCAGCAGAGCCGCGAGCGCAAAAAGCGCATC GAGGAGGGCATCAAAGAACTCGAGAGCCAGATTCTCAAAGAGAATCCAGTCGAGAACACCCAACTCCAGAACGAAAA GCTCTACCTCTACTATCTGCAAAACGGGCGCGACATGTATGTCGACCAAGAACTCGACATCAATAGGCTCTCCGACT ATGATGTCGATCACATCGTCCCGCAGAGCTTTATCAAGGACGATTCCATCGACAACAAGGTGCTCACACGCAGCGTC GAGAATCGCGGCAAAAGCGATAACGTCCCAAGCGAAGAGGTGGTCAAGAAGATGAAGAACTACTGGAGGCAGCTGCT CAACGCCAAGCTCATCACACAGCGCAAGTTCGACAACCTCACAAAGGCCGAACGCGGGGGGCTCTCCGAAGCGGATA AAGCGGGCTTCATCAAGAGGCAACTCGTGGAGACACGCCAGATTACCAAACATGTGGCGCGCATCCTCGACTCTCGC ATGAACACCAAACGCGACAAGAATGATAAGCCGATCCGCGAGGTGAAGGTCATTACACTCAAATCCAAGCTCGTGTC CGATTTCCGCAAGGATTTCCAGCTCTACAAAGTGAGGGACATCAACAATTACCACCACGCCCACGATGCGTATCTCA ATGCGGTGGTCGGCACCGCGCTCATTAAGAAGTACCCAAAGCTCGAGTCCGAATTTGTCTACGGGGACTACAAGGTG TACGACGTGCGCAAGATGATTGCGAAATCCGAACAAGAGATTGGCAAGGCCACAGCCAAGAGGTTCTTTTACAGCAA CATTATGAATTTCTTCAAGACAGAGGTCAAGCTGGCCAACGGCGAGATTCGCAAAAGGCCGCTGATCGAGACAAATG GCGAAACCGGCGAAGTCGTCTGGAACAAGGAAAAGGACTTTGCCACCGTCCGCAAAGTGCTGGCCATGCCACAAGTG AACATCGTGAAGAAAACCGAGGTCCAAACCGGCGGCTTTAGCAAGGAGTCCATTCTGAGCAAGCGCGAATCCGCGAA ACTCATCCCACGCAAGAAGGGCTGGGACACAAGGAAGTACGGCGGCTTCGGCTCCCCGACAGTGGCCTATTCCATTC TGGTCGTCGCCAAGGTGGAAAAGGGCAAGGCGAAGAAGCTGAAATCCGTCAAGGTGCTGGTGGGCATCACAATTATG GAAAAGGGGAGCTATGAGAAGGACCCAATCGGCTTCCTCGAAGCCAAGGGGTATAAAGATATCAAAAAGGAACTCAT CTTCAAGCTGCCGAAGTATTCTCTCTTCGAACTCGAAAATGGGAGGCGCCGCATGCTGGCGTCCGCCACAGAGCTGC AGAAGGCCAACGAGCTGGTGCTCCCACAACATCTCGTGAGGCTGCTCTACTATACACAGAACATCAGCGCCACAACC GGCTCCAATAATCTCGGGTATATCGAGCAGCACCGCGAAGAGTTCAAGGAGATTTTCGAAAAAATTATCGACTTCAG CGAAAAATATATTCTCAAGAATAAGGTGAATAGCAATCTGAAGTCCAGCTTCGACGAACAATTTGCGGTGAGCGACA GCATTCTGCTGAGCAACAGCTTCGTGTCTCTGCTCAAATATACCAGCTTTGGCGCCAGCGGGGGCTTCACCTTTCTC GACCTCGATGTGAAGCAAGGGAGGCTCCGCTATCAGACAGTGACAGAGGTCCTCGATGCGACCCTCATCTACCAGAG CATTACCGGGCTCTACGAGACACGCACCGATCTGTCCCAGCTCGGGGGGGATTGA

The present invention will be described in detail by way of examples below.

In the case where no other illustrate, the operation in following specific embodiments is all made of generally in the art Routine operation carries out.Those skilled in the art can be easily obtained from the prior art about such routine operation Introduction, such as it is referred to textbook Sambrook and David Russell, Molec μ lar Cloning:A Laboratory Manual,3rd ed.,Vols1,2；Charles Neal Stewart,Alisher Touraev,Vitaly Citovsky and Tzvi Tzfira, Plant Transformation Technologies etc..It is used in following embodiments Medicinal raw material, reagent, material etc., unless otherwise specified, be commercially available products.

Embodiment 1 --- the building of Op ScCas9 gene plant targeting vector

1, the present invention obtains nucleotide sequence shown in SEQ ID No:1 by artificial synthesized mode.

Jin Weizhi Biotechnology Co., Ltd in Suzhou is entrusted to carry out sequence according to nucleotide sequence shown in SEQ ID No:1 Synthesis, is connected on PUC57-AMP carrier, forms PUC57-AMP-Op ScCas9 carrier, and be loaded into Escherichia coli XL- In blue bacterial strain.

2, it is mentioned from the above-mentioned Escherichia coli XL-blue containing PUC57-AMP-Op ScCas9 carrier with Axygen plasmid It takes kit to extract plasmid, with NotI/SacI digestion, recycles Op ScCas9 segment.NotI/SacI enzyme pair is utilized simultaneously PHUN400 carries out linearization process, recycles pHUN400, above-mentioned Op ScCas9 segment is connected with pHUN400 segment with T4 Enzyme (being purchased from TaKaRa company) is attached, and is obtained plant expression vector pHUN400-Op ScCas9, is named as pHUN 4C00.

3, guide RNA (sgRNA) expression cassette is synthesized.It include: rice Os U3 promoter, spectinomycin resistance gene SpR, people The sgRNA frame sequence and Poly-T terminator of work synthesis.The segment of synthesis is connected on PUC57-AMP carrier, is formed PUC57-AMP-sgRNA carrier, the segment of synthesis；Both ends have HindIII restriction enzyme site, and are loaded into Escherichia coli XL- In blue bacterial strain.

Reagent is extracted with Axygen plasmid from the above-mentioned Escherichia coli XL-blue containing PUC57-AMP-sgRNA carrier Box extracts plasmid, with HindIII digestion, recycles sgRNA expression cassette segment.PHUN 4C00 is carried out using HindIII enzyme simultaneously Linearization process recycles pHUN 4C00, by the T4 ligase (purchase of above-mentioned sgRNA expression cassette segment and pHUN 4C00 segment In TaKaRa company) it is attached, plant expression vector pHUN 4C00-sgRNA is obtained, pHUN 4C11 is named as.

The sequence of sgRNA expression cassette is as follows, as shown in Seq ID No.2:

AAGGGATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATG CATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGTGCTACCAGCA AATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGATGTGAAGAAGTAAGATAAACTGTAGGAGAAAAG CATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAA CAAAGACTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGATTTAAAAGAGTTGTGCAGATGATCCGT GGCAAGAGACCAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAA CTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTT TTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGC AGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGGGGGAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACG GCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAA ACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGT AGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAAT GGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAA GCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATT TGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTA CGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAG CGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGC CTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATGTC TAGCTAGAAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTCAAGCGTTAGATGCACTAAGCACATAAT TGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCATAATAAGCCGGTCTCAGTTTCAG AGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT GCTTTTTTTT

Embodiment 2 --- the acquisition of the pHUN4C11-PDS targeting vector containing target sequence.

1, rice (1440-1462 nucleotide sequences, sequence in rice Os PDS gene (Os03g0184000) are selected It is classified as CATTGCCTGCACCCTTAAATGG, (underscore part is the PAM sequence of NNG structure, wherein N A, T, G or C) is made For target practice site.

2, by the positive oligonucleotide chain (OsPDS KO1 P1) of selected target site synthesis (commission Huada gene company) and Can reverse oligonucleotide chain (OsPDS KO1 P2) complementary to it,

Particular sequence are as follows:

OsPDS KO1 P1:TTCACATTGCCTGCACCCTTAAA (SEQ ID No:4)；

OsPDS KO1 P2:AAACATTTAAGGGTGCAGGCAATG (SEQ ID No:5).

The part not marked by underscore wherein is the sequence or complementary series that NNG is removed in above-mentioned target site, underscore Part is the cohesive end for connecting carrier.

3, cycle of annealing is carried out to OsPDS KO1 P1 and OsPDS KO1 P2, by OsPDS KO1 P1 and OsPDS KO1 Two chain of P2 anneals to form the double-stranded DNA with cohesive end, the Insert Fragment as building recombinant vector.

It 4, include the guide that can be expressed in rice cell in 37 DEG C of digestions with BsaI restriction endonuclease (production of NEB company) The rice CRISPR/Cas9 engineering carrier pHUN4C11 2 of rna expression frame (nucleotide sequence such as Seq ID No:2 shows) is small When, 65 DEG C inactivation digestion system 10 minutes, as building recombinant vector skeleton segment.

5, recombinant vector skeleton segment is connected with T4 ligase (production of NEB company) with Insert Fragment, is transferred to large intestine bar In bacterium.After sequence verification, its positive transformant is extracted, constitutes the recombination practiced shooting for rice Os CHI gene C RISPR/Cas9 Vector plasmid pHUN4C11-PDS.

6, plant expression vector pHUN4C11-PDS is transferred to Agrobacterium tumefaciems (Agrobacterium using freeze-thaw method Tumefaciens) (Paddy Rice Inst., Anhui Agriculture Science Academy's preservation) in EHA105 bacterial strain, it is used for genetic transformation.

Embodiment 3 --- using pHUN4C11-PDS as the acquisition of the rice transformation of targeting vector and mutant.

1, the induction and preculture of mature embryo callus

By the mature seed decladding of OryzasativaLcv.Nipponbare, chooses normal, the clean seed without mildew of appearance and rocked with 70% alcohol 90sec outwells alcohol；With 50% sodium hypochlorite containing Tween20, (stoste effective chlorine density is greater than 4%, wherein 50% time again Sodium chlorate is the solution after stoste is diluted 1 times, and every 100 milliliters are added 1 drop Tween20) solution cleaning seed, shakes on shaking table Dynamic 45min (180r/min).Sodium hypochlorite is outwelled, sterile washing 5-10 times to no sodium hypochlorite smell, is eventually adding sterile water, 30 DEG C of soaked overnights.Embryo is separated along aleurone with knife blade, scultellum is placed on callus inducing medium upward, and (ingredient is shown in Table 1) on, 12/ware, 30 DEG C of dark cultures are with evoked callus.

Occur spherical, coarse, lurid secondary callus after two weeks, preculture operation can be carried out, i.e., it will be secondary Callus is gone on new callus inducing medium, 30 DEG C dark culture preculture 5 days.After preculture, by it is in good condition, It divides vigorous little particle to be collected with spoon into the sterile centrifugation tube of 50mL, be infected for Agrobacterium.

2, the culture of agrobacterium strains and suspension prepare

By the agrobacterium strains EHA105 containing pHUN4C11-PDS carrier in the LB solid containing 50mg/L kanamycins It crosses on culture medium, 28 DEG C of dark culturings use aseptic inoculation ring by the Agrobacterium inoculation of activation to fresh 50mg/L card afterwards for 24 hours It on the LB plate of that mycin, carries out second and activates, 28 DEG C of dark culturings are stayed overnight.20- is added in the sterile centrifugation tube of 50mL The Agrobacterium for activating 2 times is scraped with oese, adjusts OD660 (Optical density by 30mL Agrobacterium suspension medium 660nm, 660nm light absorption value) to about 0.10-0.25, it is stored at room temperature 30min or more.

3, it infects and co-cultures

(see step 1), add agrobacterium suspension into ready callus, impregnate 15min, gently shake frequently therebetween It is dynamic.Liquid (as far as possible dripping liquid net) is outwelled after immersion, and the extra agriculture bar on callus surface is sucked with aseptic filter paper Bacterium bacterium solution, and dried up in super-clean bench with sterile wind.Three sterile filters on the disposable sterilized culture dish pad of 100 × 25mm Paper is added 2.5mL Agrobacterium suspension medium, the callus after blotting is dispersed on filter paper, 23 DEG C of dark culturings 48h。

4, preceding screening and screening and culturing

After co-cultivation, before the callus through co-culturing is dispersed evenly in screening and culturing medium, 30 DEG C of dark trainings It supports 5 days.After preceding screening and culturing, callus is gone on screening and culturing medium, each culture dish connects 25 callus, and 30 DEG C dark culturing, after culture in 45 days, resistant calli growth is obvious, can carry out differentiation and regeneration operation.

5, differentiation and regeneration

Each independent transformants select the little particle that 2-3 growth conditions are good, fresh, go to differentiation and regeneration culture medium On.Every culture dish connects 5 independent transformants.28 DEG C of illumination cultivations, periodicity of illumination are 16h illumination 8h dark, luminous intensity 3000- 6000lx。

6, it takes root and transplants

When the bud of resistant calli differentiation it is long to about 2cm when, each independent transformants only take one plant of well-grown seedling, It moves on root media, 28 DEG C of illumination cultivations, periodicity of illumination is 16h illumination 8h dark, luminous intensity 3000-6000lx.Two Zhou Hou selects the seedling of well developed root system, and culture medium is washed with water, and transplanting is buried.

7, Molecular Identification

Before transplanting, 48 separate transformation events are taken to two kinds of condition of culture respectively, take rice leaf sample, used CTAB method carries out that DNA is small mentions.Obtained genome DNA sample is used for the PCR analysis of hygromycin gene.For expanding The PCR primer of hygromycin gene are as follows: 5 '-GCATGCAGTTTTCAACTACAAACCGG-3 ' (SEQ ID No:6) and 5 '- CAAGACGACCTCGTGACCAGGAAGTAGC-3 ' (SEQ ID No:7).Generate the segment that length is 821bp.Tide is filtered out altogether 46 plants of mycin positive plant.Target practice efficiency test is carried out to the DNA of this 46 plants of plant.

Using Plant Genome Mini Kit (production of Tiangeng biochemical corp), extraction obtains 14 regeneration plants Genomic DNA.It include target with Phusion high-fidelity DNA polymerase (production of NEB company) PCR amplification using the DNA as template The sequence in region, wherein primer used in PCR amplification are as follows:

OsPDS KO1 genome check FP:GCTTATCCCAACATACAGAACT (SEQ ID No:8)

OsPDS KO1 genome check RP:AAAGTAACCACCAATACGATGT (SEQ ID No:9)

2.4, pcr amplified fragment direct Sequencing is obtained using OsPDS KO1 genome check FP and RP by primer pair, point Analyse the mutation of target site.Sequencing result shows that in surveying 46 plant, 28 plant have OsPDS gene target sequence On mutation, mutation efficiency 60%；The form of mutation includes the insertion and/or missing of base.Partial results are as shown in Figure 2 (the first row WT sequence in Fig. 2, drawing horizontal line part is PAM sequence, and d indicates missing, and i indicates insertion, digital representation base number). Similarly, we equally construct targeting vector with original ScCas9 gene, carry out rice transformation, but do not obtain sun Property editor plant.ScCas9 after showing codon optimization can realize efficient gene under the condition of culture of optimization in plant Editor.

The principle of the present invention is described in detail in the preferred embodiment of the present invention, and those skilled in the art should manage Solution, above-described embodiment is only the explanation to exemplary implementation of the invention, not to the restriction of scope of the present invention. Details in embodiment is simultaneously not meant to limit the scope of the invention, without departing from the spirit and scope of the present invention, Any equivalent transformation based on technical solution of the present invention, simple replacement etc. obviously change, and all fall within present invention protection model Within enclosing.

Sequence table

<110>Paddy Rice Inst., Anhui Agriculture Science Academy

<120>a kind of high shear efficiency ScCas9 gene and its application

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4128

<212> DNA

<213>rice (rice)

<400> 1

atggagaaaa agtactccat cgggctcgac attgggacca atagcgtggg gtgggccgtc 60

atcaccgacg actataaggt cccaagcaaa aagttcaaag tgctggggaa cacaaatcgc 120

aagagcatca agaaaaatct gatgggcgcg ctcctcttcg acagcggcga aaccgccgaa 180

gcgacaaggc tcaagaggac agcgaggcgc cgctataccc gccgcaaaaa tcgcattcgc 240

tatctccaag agatcttcgc caacgagatg gcgaagctcg atgacagctt cttccagagg 300

ctggaggaat cctttctcgt cgaggaagac aagaagaatg agcgccaccc aattttcggg 360

aatctcgcgg acgaggtcgc ctaccatcgc aattatccaa ccatttatca tctccgcaag 420

aagctggccg actccccgga gaaggccgat ctgaggctca tctacctcgc gctcgcgcac 480

atcattaagt ttcgcgggca ctttctcatc gaaggcaagc tgaacgccga aaattccgac 540

gtcgccaagc tgttctatca gctcattcag acctacaacc agctcttcga agagagcccg 600

ctggatgaga tcgaggtgga tgcgaagggc attctcagcg cgaggctcag caagtccaaa 660

aggctcgaga agctgatcgc cgtgttcccg aatgagaaga agaatgggct gttcggcaat 720

attattgccc tcgcgctcgg gctgacaccg aatttcaagt ccaacttcga cctcacagag 780

gacgcgaagc tgcagctgag caaagacacc tacgacgacg atctcgacga actgctcggg 840

caaattgggg atcagtatgc cgatctgttc tccgccgcca agaacctcag cgacgcgatt 900

ctgctctccg acattctgcg ctccaacagc gaagtcacca aagcgccact ctccgcgagc 960

atggtgaaac gctacgacga gcatcatcaa gatctcgcgc tcctcaagac cctcgtgcgc 1020

cagcagttcc cggaaaaata cgcggagatt ttcaaggacg acaccaagaa tgggtacgcc 1080

ggctacgtgg ggatcggcat caagcatcgc aagaggacaa ccaagctggc gacacaagag 1140

gagttttaca agttcattaa gccgatcctc gagaagatgg acggcgcgga ggaactgctg 1200

gccaaactca accgcgatga cctcctccgc aagcaaagga ccttcgacaa cggctccatt 1260

ccacaccaga tccacctcaa agaactgcat gccattctgc gccgccaaga ggagttctac 1320

ccgtttctca aagagaatcg cgagaaaatt gagaaaatcc tcaccttccg cattccatac 1380

tacgtcgggc cactggcgag ggggaattct cgcttcgcgt ggctcacacg caagagcgag 1440

gaggcgatta ccccatggaa cttcgaggag gtcgtggata agggcgcgtc cgcccagtcc 1500

tttattgagc gcatgaccaa ttttgacgag cagctcccga ataagaaggt gctgccgaag 1560

cactctctcc tctatgaata ttttaccgtc tacaacgaac tcaccaaagt caagtacgtc 1620

accgagcgca tgaggaagcc ggagtttctc agcggggagc agaaaaaagc catcgtggat 1680

ctcctcttta agaccaaccg caaggtgacc gtgaagcaac tcaaagagga ttattttaag 1740

aagattgagt gctttgacag cgtggagatc atcggggtcg aagaccgctt caacgccagc 1800

ctcgggacct accacgacct cctcaagatt attaaagaca aagactttct ggataacgag 1860

gagaacgaag acatcctcga agatatcgtg ctcaccctca cactctttga ggaccgcgag 1920

atgatcgagg agaggctcaa gacctatgcg catctctttg acgacaaggt gatgaagcag 1980

ctcaagaggc gccattacac cggctggggg aggctctctc gcaagatgat caacggcatt 2040

agggacaaac agtccggcaa gaccattctc gacttcctca agtccgatgg cttcagcaat 2100

aggaacttca tgcagctgat ccacgatgat tctctcacat tcaaggagga aattgagaaa 2160

gcccaagtgt ccggccaagg cgactccctc catgagcaga tcgccgatct ggcggggtcc 2220

ccagccatta aaaaggggat cctccagacc gtgaaaattg tggacgaact cgtcaaggtc 2280

atggggcata agccggagaa catcgtcatc gagatggccc gcgaaaacca gaccaccaca 2340

aaaggcctcc agcagagccg cgagcgcaaa aagcgcatcg aggagggcat caaagaactc 2400

gagagccaga ttctcaaaga gaatccagtc gagaacaccc aactccagaa cgaaaagctc 2460

tacctctact atctgcaaaa cgggcgcgac atgtatgtcg accaagaact cgacatcaat 2520

aggctctccg actatgatgt cgatcacatc gtcccgcaga gctttatcaa ggacgattcc 2580

atcgacaaca aggtgctcac acgcagcgtc gagaatcgcg gcaaaagcga taacgtccca 2640

agcgaagagg tggtcaagaa gatgaagaac tactggaggc agctgctcaa cgccaagctc 2700

atcacacagc gcaagttcga caacctcaca aaggccgaac gcggggggct ctccgaagcg 2760

gataaagcgg gcttcatcaa gaggcaactc gtggagacac gccagattac caaacatgtg 2820

gcgcgcatcc tcgactctcg catgaacacc aaacgcgaca agaatgataa gccgatccgc 2880

gaggtgaagg tcattacact caaatccaag ctcgtgtccg atttccgcaa ggatttccag 2940

ctctacaaag tgagggacat caacaattac caccacgccc acgatgcgta tctcaatgcg 3000

gtggtcggca ccgcgctcat taagaagtac ccaaagctcg agtccgaatt tgtctacggg 3060

gactacaagg tgtacgacgt gcgcaagatg attgcgaaat ccgaacaaga gattggcaag 3120

gccacagcca agaggttctt ttacagcaac attatgaatt tcttcaagac agaggtcaag 3180

ctggccaacg gcgagattcg caaaaggccg ctgatcgaga caaatggcga aaccggcgaa 3240

gtcgtctgga acaaggaaaa ggactttgcc accgtccgca aagtgctggc catgccacaa 3300

gtgaacatcg tgaagaaaac cgaggtccaa accggcggct ttagcaagga gtccattctg 3360

agcaagcgcg aatccgcgaa actcatccca cgcaagaagg gctgggacac aaggaagtac 3420

ggcggcttcg gctccccgac agtggcctat tccattctgg tcgtcgccaa ggtggaaaag 3480

ggcaaggcga agaagctgaa atccgtcaag gtgctggtgg gcatcacaat tatggaaaag 3540

gggagctatg agaaggaccc aatcggcttc ctcgaagcca aggggtataa agatatcaaa 3600

aaggaactca tcttcaagct gccgaagtat tctctcttcg aactcgaaaa tgggaggcgc 3660

cgcatgctgg cgtccgccac agagctgcag aaggccaacg agctggtgct cccacaacat 3720

ctcgtgaggc tgctctacta tacacagaac atcagcgcca caaccggctc caataatctc 3780

gggtatatcg agcagcaccg cgaagagttc aaggagattt tcgaaaaaat tatcgacttc 3840

agcgaaaaat atattctcaa gaataaggtg aatagcaatc tgaagtccag cttcgacgaa 3900

caatttgcgg tgagcgacag cattctgctg agcaacagct tcgtgtctct gctcaaatat 3960

accagctttg gcgccagcgg gggcttcacc tttctcgacc tcgatgtgaa gcaagggagg 4020

ctccgctatc agacagtgac agaggtcctc gatgcgaccc tcatctacca gagcattacc 4080

gggctctacg agacacgcac cgatctgtcc cagctcgggg gggattga 4128

<210> 2

<211> 1696

<212> DNA

<213>rice (rice)

<400> 2

aagggatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60

tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 240

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 300

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 360

ttgtgcagat gatccgtggc aagagaccaa cccagtggac ataagcctgt tcggttcgta 420

agctgtaatg caagtagcgt atgcgctcac gcaactggtc cagaaccttg accgaacgca 480

gcggtggtaa cggcgcagtg gcggttttca tggcttgtta tgactgtttt tttggggtac 540

agtctatgcc tcgggcatcc aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt 600

tatggagcag caacgatgtt acgcagcagg gcagtcgccc taaaacaaag ttaaacatca 660

tgggggaagc ggtgatcgcc gaagtatcga ctcaactatc agaggtagtt ggcgtcatcg 720

agcgccatct cgaaccgacg ttgctggccg tacatttgta cggctccgca gtggatggcg 780

gcctgaagcc acacagtgat attgatttgc tggttacggt gaccgtaagg cttgatgaaa 840

caacgcggcg agctttgatc aacgaccttt tggaaacttc ggcttcccct ggagagagcg 900

agattctccg cgctgtagaa gtcaccattg ttgtgcacga cgacatcatt ccgtggcgtt 960

atccagctaa gcgcgaactg caatttggag aatggcagcg caatgacatt cttgcaggta 1020

tcttcgagcc agccacgatc gacattgatc tggctatctt gctgacaaaa gcaagagaac 1080

atagcgttgc cttggtaggt ccagcggcgg aggaactctt tgatccggtt cctgaacagg 1140

atctatttga ggcgctaaat gaaaccttaa cgctatggaa ctcgccgccc gactgggctg 1200

gcgatgagcg aaatgtagtg cttacgttgt cccgcatttg gtacagcgca gtaaccggca 1260

aaatcgcgcc gaaggatgtc gctgccgact gggcaatgga gcgcctgccg gcccagtatc 1320

agcccgtcat acttgaagct agacaggctt atcttggaca agaagaagat cgcttggcct 1380

cgcgcgcaga tcagttggaa gaatttgtcc actacgtgaa aggcgagatc accaaggtag 1440

tcggcaaata atgtctagct agaaattcgt tcaagccgac gccgcttcgc ggcgcggctt 1500

aactcaagcg ttagatgcac taagcacata attgctcaca gccaaactat caggtcaagt 1560

ctgcttttat tatttttaag cgtgcataat aagccggtct cagtttcaga gctatgctgg 1620

aaacagcata gcaagttgaa ataaggctag tccgttatca acttgaaaaa gtggcaccga 1680

gtcggtgctt tttttt 1696

<210> 3

<211> 22

<212> DNA

<213>rice (rice)

<400> 3

cattgcctgc acccttaaat gg 22

<210> 4

<211> 23

<212> DNA

<213>rice (rice)

<400> 4

ttcacattgc ctgcaccctt aaa 23

<210> 5

<211> 24

<212> DNA

<213>rice (rice)

<400> 5

aaacatttaa gggtgcaggc aatg 24

<210> 6

<211> 26

<212> DNA

<213>rice (rice)

<400> 6

gcatgcagtt ttcaactaca aaccgg 26

<210> 7

<211> 28

<212> DNA

<213>rice (rice)

<400> 7

caagacgacc tcgtgaccag gaagtagc 28

<210> 8

<211> 22

<212> DNA

<213>rice (rice)

<400> 8

gcttatccca acatacagaa ct 22

<210> 9

<211> 22

<212> DNA

<213>rice (rice)

<400> 9

aaagtaacca ccaatacgat gt 22

Claims (10)

1. a kind of high shear efficiency ScCas9 gene, which is characterized in that the high shear efficiency ScCas9 gene includes SEQ ID The homologous sequence of nucleotide sequence shown in nucleotide sequence shown in No:1 or SEQ ID No:1.

2. high shear efficiency ScCas9 gene according to claim 1, wherein the high shear efficiency ScCas9 gene Nucleotide sequence is as shown in SEQ ID No:1.

3. a kind of expression cassette, which is characterized in that the expression cassette contains high shear efficiency ScCas9 of any of claims 1 or 2 Gene.

4. a kind of expression vector, which is characterized in that the expression vector is inserted with high shear efficiency of any of claims 1 or 2 ScCas9 gene or expression cassette as claimed in claim 3.

5. expression vector according to claim 4, wherein the carrier is PUC57-AMP or pHUN400.

6. a kind of targeting vector, which is characterized in that the targeting vector is inserted with high shear efficiency of any of claims 1 or 2 ScCas9 gene or expression cassette as claimed in claim 3 and target site sequence.

7. a kind of transgenic cell, which is characterized in that the transgenic cell be transferred to have the right to require 1 or 2 described in high shear Efficiency ScCas9 gene, expression cassette as claimed in claim 3, expression vector described in claim 4 or 5 or claim 6 institute The targeting vector stated.

8. high shear efficiency ScCas9 gene of any of claims 1 or 2, expression cassette as claimed in claim 3, claim 4 Or expression vector described in 5, targeting vector as claimed in claim 6 or transgenic cell as claimed in claim 7 are in plant base Because of the application in group editor, wherein the Plant Genome editor includes shearing to Plant Genome, is obtained containing mutation The genetically modified plants in site or plant part.

9. application according to claim 8, wherein the plant is monocotyledon, preferably rice, more preferably round-grained rice Rice, further preferably japonica rice OryzasativaLcv.Nipponbare.

10. a kind of method for obtaining rice mutant using non-bacterial source Cas9 gene, wherein the method includes manually High shear efficiency ScCas9 gene described in claim 1 is synthesized, high shear efficiency ScCas9 gene is connected to carrier and is obtained Recombinant expression carrier is obtained, the recombinant expression carrier is imported in plant cell, the genome in the plant cell is carried out Shearing obtains genetically modified mutant.