CN110283838B - ScCas9 gene with high shearing efficiency and application thereof - Google Patents

Abstract

The invention provides a ScCas9 gene with high shearing efficiency and application thereof. The high-shearing efficiency ScCas9 gene has an amino acid sequence shown in SEQ ID No: 1. The ScCas9 gene with high shearing efficiency provided by the invention can obviously improve the shearing efficiency. The invention also provides an expression cassette based on the ScCas9 gene with high shearing efficiency. And, the invention links the ScCas9 gene with high shearing efficiency into an expression vector to form a recombinant expression vector. The vector of the invention is PUC57-AMP or pHUN 400. In addition, the invention utilizes the ScCas9 gene with high shearing efficiency to obtain a transgenic mutant.

Description

ScCas9 gene with high shearing efficiency and application thereof

Technical Field

The present invention relates to biotechnology and plant genetic engineering technology. Specifically, the invention relates to a high-shear-efficiency ScCas9 gene, an expression cassette, an expression vector, a targeting vector, a transgenic cell containing the high-shear-efficiency ScCas9 gene and application of the high-shear-efficiency ScCas9 gene and the expression vector.

Background

The genome editing system CRISPR-Cas9 has become a very important tool in medical research and may ultimately have a great impact in the fields of agriculture, bioenergy, and food safety. CRISPR-Cas9 can be directed to different sites on the genome by short RNA fragments (i.e. guide RNAs, grnas) and then the sites subsequently reformed for the required editing using a DNA cleaving enzyme called Cas 9. However, despite the considerable success of this gene editing tool, the number of sites that it can access on the genome is still limited. This is because CRISPR-Cas9 requires a specific DNA sequence called a pro-spacer adjacent motif (PAM) to be present on the genome on both sides of the target site, allowing it to recognize the target site. For example, as one of the most widely used Cas9 enzymes, the PAM sequence of Cas9(SpCas9) from Streptococcus pyogenes (Streptococcus pyogenes) is 5 '-NGG-3'. In this PAM sequence, the presence of two consecutive bases G significantly limits the number of sites that SpCas9 can target, accounting for only about 9.9% of the sites on the genome, with a very limited target area.

Finally, it was found that one of the most successful enzymes they sought was Cas9(ScCas9) from Streptococcus canis (Streptococcus canis), which is very similar to the SpCas9 enzyme that has been widely used. ScCas9 is a variant of the basal version of SpCas9, which are very similar in amino acid sequence, but which are capable of targeting target DNA sequences that SpCas9 is not capable of targeting. The PAM sequence of ScCas9 is 5 '-NNG-3'. In this PAM sequence, there is only one base G, which allows the ScCas9 to target more sites in the genome than the SpCas 9: occupies nearly half of the locus in the genome. In addition, ScCas9 used the same gRNA as SpCas 9.

However, the ScCas9 used at present is separated from prokaryotic Escherichia coli, and the ScCas9 gene has potential risks and is difficult to realize high shearing efficiency of a DNA double strand.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a ScCas9 gene with high shearing efficiency and application thereof in plant genome editing,

in order to achieve the above objects, one aspect of the present invention provides a high shear efficiency ScCas9 gene, the high shear efficiency ScCas9 gene having the amino acid sequence of SEQ ID No:1 or the nucleotide sequence shown in SEQ ID No:1, or a homologous sequence of the nucleotide sequence shown in 1.

In a second aspect, the present invention provides an expression cassette comprising a high shear efficiency ScCas9 gene as described above.

In a third aspect, the invention provides an expression vector into which the high shear efficiency ScCas9 gene or the expression cassette as described above is inserted.

In a fourth aspect, the invention provides a targeting vector, wherein the high-shear efficiency ScCas9 gene or the expression cassette and the target site sequence are inserted.

In a fifth aspect, the invention provides a transgenic cell, which is transformed with the ScCas9 gene with high shear efficiency, the expression cassette, the expression vector or the targeting vector.

In a sixth aspect, the present invention provides the use of the high shear efficiency ScCas9 gene as described above, the expression cassette as described above, the expression vector as described above, the targeting vector as described above or the transgenic cell as described above in plant genome editing, wherein the plant genome editing comprises shearing a plant genome to obtain a transgenic plant or plant part comprising a mutation site.

In another aspect, the present invention provides a method for obtaining a rice mutant by using a non-bacterially derived Cas9 gene, wherein the method comprises artificially synthesizing the high-shear efficiency ScCas9 gene as defined in claim 1, connecting the high-shear efficiency ScCas9 gene to a vector to obtain a recombinant expression vector, introducing the recombinant expression vector into a plant cell, and shearing the genome in the plant cell to obtain a transgenic mutant.

The ScCas9 gene with high shearing efficiency provided by the invention is not obtained through a bacterial way, but is chemically synthesized, so that the adverse effect of ScCas9 from bacteria on a transformant receptor genome is reduced. Moreover, the gene of the invention can obviously improve the shearing efficiency.

Drawings

FIG. 1 is a schematic diagram of the plasmid of the PHUN4C11 vector constructed in example 2.

FIG. 2 shows the targeted mutation of ScCas9 of the present invention in transgenic plants constructed in example 3. WT means an unmutated sequence, a PAM sequence in the horizontal line, d means deletion, i means insertion, and the number means the number of bases.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

In a first aspect, the present invention provides a high shear efficiency ScCas9 gene, said high shear efficiency ScCas9 gene having the amino acid sequence of SEQ ID No: 1.

It should be noted that, without specific mention, in the context of the present invention, the high shear efficiency ScCas9 gene provided by the present invention is referred to as ScCas9 or Op ScCas9, and the original ScCas9 gene, i.e., the ScCas9 gene of escherichia coli, is referred to as the original ScCas9 gene.

The invention also needs to explain that the gene "has SEQ ID No:1 "does not mean any nucleotide sequence comprising a nucleotide sequence other than SEQ ID No:1, but refers to a nucleotide or nucleotide sequence other than the nucleotide sequence shown in SEQ ID No:1 or to achieve the nucleotide sequence shown in SEQ ID No:1, or a nucleotide or nucleotide sequence contained therein without affecting the function thereof, for example, an enzyme cleavage site, a marker gene, a selection gene, etc. Thus, the "peptide having the amino acid sequence of SEQ ID No:1 refers to a nucleotide sequence having the sequence shown in SEQ ID No:1, but still achieves the nucleotide sequence shown in SEQ ID No:1, or a nucleotide sequence function thereof.

According to a specific embodiment of the invention, the nucleotide sequence of the Op ScCas9 gene is shown in SEQ ID No:1 is shown.

The construction method of the expression vector of the invention can be performed according to the conventional method in the art, for example, the Op ScCas9 gene and the vector to be inserted are cut by the same restriction enzyme, and then the Op ScCas9 gene is connected to the vector by using ligase to obtain the expression vector of the invention.

The restriction enzyme can be specifically selected according to the enzyme cutting site introduced into the Op ScCas9 gene, and for example, the restriction enzyme can be NotI/SacI restriction enzyme.

The ligase may be any one of various ligases conventionally used in the art capable of ligating two nucleic acid fragments, and may be, for example, T4 ligase.

Among them, the vector may be various vectors conventionally used in the art, and preferably, the vectors may be PUC57-AMP and pHUN400, which are commercially available. The pHUN400 vector and the Op ScCas9 gene can be cut by NotI/SacI enzyme cutting sites and recovered, and then the Op ScCas9 gene is connected to the pHUN400 vector by T4 ligase, so that the plant expression vector pHUN-Op ScCas9 (pHUN 4C00 for short) is obtained. A synthetic guide RNA (sgRNA) expression cassette. The method comprises the following steps: a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator (the sequence is shown as SEQ ID No: 2). The pHUN4C 00 and sgRNA expression frame fragments were digested with HindIII enzyme, and the sgRNA expression frame fragments were ligated into the pHUN4C 00 fragment with T4 ligase to obtain a plant expression vector pHUN4C 00-sgRNA, which was designated as pHUN4C 11.

The targeting vector of the present invention is inserted with the high shear efficiency ScCas9 gene as described above or the expression cassette and target site sequence as described above.

The target site sequence may be determined according to the sequence actually required for genome editing, but the target site sequence requires a PAM sequence that includes NNG characteristics. According to a specific embodiment of the present invention, the target site sequence is SEQ ID No: nucleotide sequence shown in (3) (OsPDS gene of rice (Os03g 0184000))1440-1462 nucleotide sequence of CATTGCCTGCACCCTTAAATGGThe underlined part is the PAM sequence of NNG structure, where N is a, T, G or C).

The targeting vector can be obtained by simple annealing and enzyme digestion ligation on the basis of an expression vector.

The application of the high-shear-efficiency ScCas9 gene comprises the steps of recognizing a PAM sequence with NNG characteristics by using the high-shear-efficiency ScCas9 gene, completing shearing of DNA double chains in rice bodies, and obtaining transgenic plants or plant parts with mutation sites under the action of a self-repair system.

The method for introducing the targeting vector into the plant cell can be performed according to a method conventional in the art, and will not be described in detail.

According to a specific embodiment of the present invention, a method for introducing a targeting vector into rice cells comprises the steps of:

after the glumes of the mature rice seeds are removed, the seeds are soaked in 70% alcohol for 1min, and the alcohol is poured off. Seeds were soaked for 40min (150r/min) with 1 drop of Tween20 in 50% sodium hypochlorite (stock solution available chlorine concentration greater than 4%). And pouring off sodium hypochlorite, and washing for 5 times by using sterile water until the solution is clear and has no sodium hypochlorite taste. The seeds were soaked in sterile water overnight. The embryos were peeled off with a scalpel along the aleurone layer of the seeds and inoculated on callus induction medium. And after dark culture for 11 days at the temperature of 30 ℃, separating the callus from endosperm and embryo, and pre-culturing the primary callus with good bud removal state and vigorous division for 3-5 days for agrobacterium transformation.

Agrobacterium tumefaciens into which the targeting vector has been transferred in the above-mentioned process is used to carry out Agrobacterium-mediated genetic transformation to obtain a pOsitive transgenic rice Plant, and methods such as genetic transformation, transformant screening and transgenic Plant regeneration are proposed with reference to Yongbo Duan (Yongbo Duan, Chengg Zhai, et al. an effective and high-throughput protocol for Agrobacterium mediated transformation based on phtophosmannsome isoenzyme pOstitive selection in Japonica rice (Oryza sativa L.) [ J ]. Plant Cell Report,2012.DOI10.1007/s 00299-01201275-3).

In a preferred embodiment, wherein the rice is japonica rice, more preferably, the rice is japonica Nipponbare.

In a preferred embodiment, the nucleotide sequence of the Op ScCas9 marker gene is the nucleotide sequence shown in SEQ ID NO. 1, which is as follows:

ATGGAGAAAAAGTACTCCATCGGGCTCGACATTGGGACCAATAGCGTGGGGTGGGCCGTCATCACCGACGACTATAAGGTCCCAAGCAAAAAGTTCAAAGTGCTGGGGAACACAAATCGCAAGAGCATCAAGAAAAATCTGATGGGCGCGCTCCTCTTCGACAGCGGCGAAACCGCCGAAGCGACAAGGCTCAAGAGGACAGCGAGGCGCCGCTATACCCGCCGCAAAAATCGCATTCGCTATCTCCAAGAGATCTTCGCCAACGAGATGGCGAAGCTCGATGACAGCTTCTTCCAGAGGCTGGAGGAATCCTTTCTCGTCGAGGAAGACAAGAAGAATGAGCGCCACCCAATTTTCGGGAATCTCGCGGACGAGGTCGCCTACCATCGCAATTATCCAACCATTTATCATCTCCGCAAGAAGCTGGCCGACTCCCCGGAGAAGGCCGATCTGAGGCTCATCTACCTCGCGCTCGCGCACATCATTAAGTTTCGCGGGCACTTTCTCATCGAAGGCAAGCTGAACGCCGAAAATTCCGACGTCGCCAAGCTGTTCTATCAGCTCATTCAGACCTACAACCAGCTCTTCGAAGAGAGCCCGCTGGATGAGATCGAGGTGGATGCGAAGGGCATTCTCAGCGCGAGGCTCAGCAAGTCCAAAAGGCTCGAGAAGCTGATCGCCGTGTTCCCGAATGAGAAGAAGAATGGGCTGTTCGGCAATATTATTGCCCTCGCGCTCGGGCTGACACCGAATTTCAAGTCCAACTTCGACCTCACAGAGGACGCGAAGCTGCAGCTGAGCAAAGACACCTACGACGACGATCTCGACGAACTGCTCGGGCAAATTGGGGATCAGTATGCCGATCTGTTCTCCGCCGCCAAGAACCTCAGCGACGCGATTCTGCTCTCCGACATTCTGCGCTCCAACAGCGAAGTCACCAAAGCGCCACTCTCCGCGAGCATGGTGAAACGCTACGACGAGCATCATCAAGATCTCGCGCTCCTCAAGACCCTCGTGCGCCAGCAGTTCCCGGAAAAATACGCGGAGATTTTCAAGGACGACACCAAGAATGGGTACGCCGGCTACGTGGGGATCGGCATCAAGCATCGCAAGAGGACAACCAAGCTGGCGACACAAGAGGAGTTTTACAAGTTCATTAAGCCGATCCTCGAGAAGATGGACGGCGCGGAGGAACTGCTGGCCAAACTCAACCGCGATGACCTCCTCCGCAAGCAAAGGACCTTCGACAACGGCTCCATTCCACACCAGATCCACCTCAAAGAACTGCATGCCATTCTGCGCCGCCAAGAGGAGTTCTACCCGTTTCTCAAAGAGAATCGCGAGAAAATTGAGAAAATCCTCACCTTCCGCATTCCATACTACGTCGGGCCACTGGCGAGGGGGAATTCTCGCTTCGCGTGGCTCACACGCAAGAGCGAGGAGGCGATTACCCCATGGAACTTCGAGGAGGTCGTGGATAAGGGCGCGTCCGCCCAGTCCTTTATTGAGCGCATGACCAATTTTGACGAGCAGCTCCCGAATAAGAAGGTGCTGCCGAAGCACTCTCTCCTCTATGAATATTTTACCGTCTACAACGAACTCACCAAAGTCAAGTACGTCACCGAGCGCATGAGGAAGCCGGAGTTTCTCAGCGGGGAGCAGAAAAAAGCCATCGTGGATCTCCTCTTTAAGACCAACCGCAAGGTGACCGTGAAGCAACTCAAAGAGGATTATTTTAAGAAGATTGAGTGCTTTGACAGCGTGGAGATCATCGGGGTCGAAGACCGCTTCAACGCCAGCCTCGGGACCTACCACGACCTCCTCAAGATTATTAAAGACAAAGACTTTCTGGATAACGAGGAGAACGAAGACATCCTCGAAGATATCGTGCTCACCCTCACACTCTTTGAGGACCGCGAGATGATCGAGGAGAGGCTCAAGACCTATGCGCATCTCTTTGACGACAAGGTGATGAAGCAGCTCAAGAGGCGCCATTACACCGGCTGGGGGAGGCTCTCTCGCAAGATGATCAACGGCATTAGGGACAAACAGTCCGGCAAGACCATTCTCGACTTCCTCAAGTCCGATGGCTTCAGCAATAGGAACTTCATGCAGCTGATCCACGATGATTCTCTCACATTCAAGGAGGAAATTGAGAAAGCCCAAGTGTCCGGCCAAGGCGACTCCCTCCATGAGCAGATCGCCGATCTGGCGGGGTCCCCAGCCATTAAAAAGGGGATCCTCCAGACCGTGAAAATTGTGGACGAACTCGTCAAGGTCATGGGGCATAAGCCGGAGAACATCGTCATCGAGATGGCCCGCGAAAACCAGACCACCACAAAAGGCCTCCAGCAGAGCCGCGAGCGCAAAAAGCGCATCGAGGAGGGCATCAAAGAACTCGAGAGCCAGATTCTCAAAGAGAATCCAGTCGAGAACACCCAACTCCAGAACGAAAAGCTCTACCTCTACTATCTGCAAAACGGGCGCGACATGTATGTCGACCAAGAACTCGACATCAATAGGCTCTCCGACTATGATGTCGATCACATCGTCCCGCAGAGCTTTATCAAGGACGATTCCATCGACAACAAGGTGCTCACACGCAGCGTCGAGAATCGCGGCAAAAGCGATAACGTCCCAAGCGAAGAGGTGGTCAAGAAGATGAAGAACTACTGGAGGCAGCTGCTCAACGCCAAGCTCATCACACAGCGCAAGTTCGACAACCTCACAAAGGCCGAACGCGGGGGGCTCTCCGAAGCGGATAAAGCGGGCTTCATCAAGAGGCAACTCGTGGAGACACGCCAGATTACCAAACATGTGGCGCGCATCCTCGACTCTCGCATGAACACCAAACGCGACAAGAATGATAAGCCGATCCGCGAGGTGAAGGTCATTACACTCAAATCCAAGCTCGTGTCCGATTTCCGCAAGGATTTCCAGCTCTACAAAGTGAGGGACATCAACAATTACCACCACGCCCACGATGCGTATCTCAATGCGGTGGTCGGCACCGCGCTCATTAAGAAGTACCCAAAGCTCGAGTCCGAATTTGTCTACGGGGACTACAAGGTGTACGACGTGCGCAAGATGATTGCGAAATCCGAACAAGAGATTGGCAAGGCCACAGCCAAGAGGTTCTTTTACAGCAACATTATGAATTTCTTCAAGACAGAGGTCAAGCTGGCCAACGGCGAGATTCGCAAAAGGCCGCTGATCGAGACAAATGGCGAAACCGGCGAAGTCGTCTGGAACAAGGAAAAGGACTTTGCCACCGTCCGCAAAGTGCTGGCCATGCCACAAGTGAACATCGTGAAGAAAACCGAGGTCCAAACCGGCGGCTTTAGCAAGGAGTCCATTCTGAGCAAGCGCGAATCCGCGAAACTCATCCCACGCAAGAAGGGCTGGGACACAAGGAAGTACGGCGGCTTCGGCTCCCCGACAGTGGCCTATTCCATTCTGGTCGTCGCCAAGGTGGAAAAGGGCAAGGCGAAGAAGCTGAAATCCGTCAAGGTGCTGGTGGGCATCACAATTATGGAAAAGGGGAGCTATGAGAAGGACCCAATCGGCTTCCTCGAAGCCAAGGGGTATAAAGATATCAAAAAGGAACTCATCTTCAAGCTGCCGAAGTATTCTCTCTTCGAACTCGAAAATGGGAGGCGCCGCATGCTGGCGTCCGCCACAGAGCTGCAGAAGGCCAACGAGCTGGTGCTCCCACAACATCTCGTGAGGCTGCTCTACTATACACAGAACATCAGCGCCACAACCGGCTCCAATAATCTCGGGTATATCGAGCAGCACCGCGAAGAGTTCAAGGAGATTTTCGAAAAAATTATCGACTTCAGCGAAAAATATATTCTCAAGAATAAGGTGAATAGCAATCTGAAGTCCAGCTTCGACGAACAATTTGCGGTGAGCGACAGCATTCTGCTGAGCAACAGCTTCGTGTCTCTGCTCAAATATACCAGCTTTGGCGCCAGCGGGGGCTTCACCTTTCTCGACCTCGATGTGAAGCAAGGGAGGCTCCGCTATCAGACAGTGACAGAGGTCCTCGATGCGACCCTCATCTACCAGAGCATTACCGGGCTCTACGAGACACGCACCGATCTGTCCCAGCTCGGGGGGGATTGA

the present invention will be described in detail below by way of examples.

The operations in the following detailed description are performed by conventional operations commonly used in the art, unless otherwise specifically indicated. The skilled person can easily derive teachings on such routine procedures from the prior art, for example with reference to the textbooks Sambrook and David Russell, molecular μ lar Cloning: A Laboratory Manual,3rd ed., Vols1, 2; charles neural Stewart, Alisher Touraev, Vitaly Citovsky and Tzvi Tzfira, Plant Transformation Technologies, and the like. The raw materials, reagents, materials and the like used in the following examples are all commercially available products unless otherwise specified.

Example 1 construction of Op ScCas9 Gene plant targeting vectors

1. The invention obtains the SEQ ID No: 1.

Entrusted Suzhou Jinwei Zhi Biotech limited as per SEQ ID No:1, and connecting the nucleotide sequence to a PUC57-AMP vector to form a PUC57-AMP-Op ScCas9 vector, and loading the vector into an Escherichia coli XL-blue strain.

2. Plasmid is extracted from the Escherichia coli XL-blue containing the PUC57-AMP-Op ScCas9 vector by using an Axygen plasmid extraction kit, and the Op ScCas9 fragment is recovered by using NotI/SacI enzyme digestion. At the same time, pHUN400 was linearized with NotI/SacI enzyme to recover pHUN400, and the Op ScCas9 fragment and pHUN400 fragment were ligated with T4 ligase (available from TaKaRa) to obtain plant expression vector pHUN400-Op ScCas9, which was named pHUN4C 00.

3. A synthetic guide RNA (sgRNA) expression cassette. The method comprises the following steps: a rice OsU3 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA framework sequence and a Poly-T terminator. Ligating the synthesized fragment to a PUC57-AMP vector to form a PUC57-AMP-sgRNA vector, and synthesizing the fragment; the two ends have HindIII restriction sites and are loaded into Escherichia coli XL-blue strain.

Plasmids were extracted from the E.coli XL-blue containing the PUC57-AMP-sgRNA vector using an Axygen plasmid extraction kit, digested with HindIII, and the sgRNA expression cassette fragment was recovered. At the same time, pHUN4C 00 was linearized with HindIII enzyme to recover pHUN4C 00, and the above sgRNA expression cassette fragment and pHUN4C 00 fragment were ligated with T4 ligase (available from TaKaRa) to obtain a plant expression vector pHUN4C 00-sgRNA, which was designated as pHUN4C 11.

The sequence of the sgRNA expression cassette is as follows, as shown in Seq ID No. 2:

AAGGGATCTTTAAACATACGAACAGATCACTTAAAGTTCTTCTGAAGCAACTTAAAGTTATCAGGCATGCATGGATCTTGGAGGAATCAGATGTGCAGTCAGGGACCATAGCACAAGACAGGCGTCTTCTACTGGTGCTACCAGCAAATGCTGGAAGCCGGGAACACTGGGTACGTTGGAAACCACGTGATGTGAAGAAGTAAGATAAACTGTAGGAGAAAAGCATTTCGTAGTGGGCCATGAAGCCTTTCAGGACATGTATTGCAGTATGGGCCGGCCCATTACGCAATTGGACGACAACAAAGACTAGTATTAGTACCACCTCGGCTATCCACATAGATCAAAGCTGATTTAAAAGAGTTGTGCAGATGATCCGTGGCAAGAGACCAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGGGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAATGTCTAGCTAGAAATTCGTTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAACTCAAGCGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTTTAAGCGTGCATAATAAGCCGGTCTCAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTT

example 2-acquisition of pHUN4C11-PDS targeting vector containing the target sequence.

1. Selecting nucleotide sequence of 1440-th and 1462-th site in rice (rice OsPDS gene (Os03g 0184000)) with sequence of CATTGCCTGCACCCTTAAATGG(PAM sequence of NNG structure, wherein N is A, T, G or C) as the targeting site.

2. Synthesizing (Shiwa Dagene Co., Ltd.) a forward oligonucleotide (OsPDS KO 1P 1) and a complementary reverse oligonucleotide (OsPDS KO 1P 2) at the selected target site,

the specific sequence is as follows:

OsPDS KO1 P1:TTCACATTGCCTGCACCCTTAAA(SEQ ID No：4)；

OsPDS KO1 P2:AAACATTTAAGGGTGCAGGCAATG(SEQ ID No：5)。

wherein the part not underlined is the sequence or the complementary sequence of the target site from which NNG has been removed, and the underlined part is the sticky end used for ligation to the vector.

3. OsPDS KO 1P 1 and OsPDS KO 1P 2 were annealed to form double-stranded DNA with cohesive ends as an insert for constructing a recombinant vector, and both OsPDS KO 1P 1 and OsPDS KO 1P 2 were annealed to form double-stranded DNA with cohesive ends.

4. The rice CRISPR/Cas9 gene engineering vector pHUN4C containing a guide RNA expression cassette (nucleotide sequence shown as Seq ID No: 2) capable of being expressed in rice cells was digested with BsaI endonuclease (NEB) at 37 ℃ for 112 hours, and the digestion system was inactivated at 65 ℃ for 10 minutes, to serve as a backbone fragment for constructing a recombinant vector.

5. The recombinant vector backbone fragment and the insert fragment were ligated with T4 ligase (NEB) and transformed into E.coli. After sequencing verification, a positive transformant is extracted to form a recombinant vector plasmid pHUN4C11-PDS for targeting the rice PDS gene CRISPR/Cas 9.

6. The plant expression vector pHUN4C11-PDS was transferred into Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 strain (stored by the Rice research institute of agricultural sciences, Anhui) by a freeze-thaw method for genetic transformation.

Example 3 genetic transformation of Rice Using pHUN4C11-PDS as targeting vector and obtaining of mutant.

1. Induction and preculture of mature embryo calli

Removing shells of mature seeds of Nipponbare, selecting seeds with normal appearance, cleanness and no mildew stains, shaking for 90sec with 70% alcohol, and pouring off the alcohol; and then 50% sodium hypochlorite (the effective chlorine concentration of the stock solution is more than 4%, wherein the 50% sodium hypochlorite is the solution obtained by diluting the stock solution by 1 time, 1 drop of Tween20 is added to each 100 ml) solution containing Tween20 to clean the seeds, and the seeds are shaken on a shaking table for 45min (180 r/min). Pouring out sodium hypochlorite, washing with sterile water for 5-10 times until no smell of sodium hypochlorite exists, adding sterile water, and soaking at 30 deg.C overnight. Embryos were separated along the aleurone layer with scalpel blade, scutellum up placed on callus induction medium, 12 grains/dish, dark cultured at 30 ℃ to induce callus.

Spherical, rough and light yellow secondary callus appears after two weeks, and the preculture operation can be carried out, that is, the secondary callus is transferred to a new callus induction culture medium and precultured for 5 days at 30 ℃ in dark. After the pre-culture is finished, collecting the small particles with good state and vigorous division into a 50mL sterile centrifuge tube by using a spoon for agrobacterium infection.

2. Culture and suspension preparation of Agrobacterium strains

The Agrobacterium strain EHA105 containing the pHUN4C11-PDS vector was streaked on LB solid medium containing 50mg/L kanamycin, cultured in the dark at 28 ℃ for 24 hours, and then the activated Agrobacterium was inoculated to a fresh LB plate containing 50mg/L kanamycin using a sterile inoculating loop, activated for the second time, and cultured in the dark at 28 ℃ overnight. Adding 20-30mL of Agrobacterium suspension culture medium into a 50mL sterile centrifuge tube, scraping the activated Agrobacterium for 2 times with an inoculating loop, adjusting OD660(Optical density 660nm, 660nm absorbance) to about 0.10-0.25, and standing at room temperature for more than 30 min.

3. Infection and Co-cultivation

To the prepared callus (see step 1), the Agrobacterium suspension was added and soaked for 15min with occasional gentle shaking. After soaking, pouring off the liquid (dripping the liquid as far as possible), sucking the redundant agrobacterium liquid on the surface of the callus by using sterile filter paper, and drying the callus by using sterile wind in a super clean bench. Three pieces of sterile filter paper are placed on a disposable sterile culture dish pad with the diameter of 100 multiplied by 25mm, 2.5mL of agrobacterium suspension culture medium is added, the callus after being sucked dry is evenly dispersed on the filter paper, and the mixture is cultured in the dark for 48h at the temperature of 23 ℃.

4. Pre-screening and screening cultures

After the co-culture was completed, the co-cultured calli were uniformly spread on the pre-screening medium and cultured in the dark at 30 ℃ for 5 days. After the pre-screening culture is finished, transferring the callus onto a screening culture medium, inoculating 25 callus to each culture dish, carrying out dark culture at 30 ℃, and after the 45-day culture is finished, obviously growing the resistant callus and carrying out differentiation and regeneration operation.

5. Differentiation and regeneration

2-3 fresh small particles with good growth state are selected from each independent transformant and transferred to a differentiation regeneration culture medium. Each culture dish was inoculated with 5 independent transformants. Culturing at 28 ℃ under illumination, wherein the illumination period is 16h, the illumination period is 8h, and the light intensity is 3000-6000 lx.

6. Rooting and transplanting

When the bud of the resistant callus differentiation grows to about 2cm, only one well-grown seedling is taken from each independent transformant and transferred to a rooting medium for illumination culture at 28 ℃, the illumination period is 16h, the illumination period is 8h, the darkness is 8h, and the light intensity is 3000-. After two weeks, seedlings with developed root systems are selected, washed with water to remove the culture medium, and transplanted into soil.

7. Molecular identification

Before transplanting, 48 independent transformation events are respectively taken from two culture conditions, rice leaf samples are taken, and DNA is extracted by a CTAB method. The resulting genomic DNA samples were used for PCR analysis of the hygromycin resistance gene. The PCR primers used to amplify the hygromycin gene were: 5'-GCATGCAGTTTTCAACTACAAACCGG-3' (SEQ ID No: 6) and 5'-CAAGACGACCTCGTGACCAGGAAGTAGC-3' (SEQ ID No: 7). A fragment of 821bp in length was generated. 46 hygromycin positive plants are screened out. The DNA of these 46 plants was tested for targeting efficiency.

Genomic DNA of the obtained 14 regenerated plants was extracted using a plant genome miniprep kit (manufactured by Tiangen Biochemical Co., Ltd.). Using the DNA as a template, PCR amplification is carried out on a sequence containing a target region by using Phusion high fidelity DNA polymerase (produced by NEB company), wherein primers used for the PCR amplification are as follows:

OsPDS KO1 genome check FP:GCTTATCCCAACATACAGAACT(SEQ ID No：8)

OsPDS KO1 genome check RP:AAAGTAACCACCAATACGATGT(SEQ ID No：9)

2.4, directly sequencing the PCR amplified fragment obtained by using OsPDS KO1 genome check FP and RP as primer pairs, and analyzing the mutation of the target site. Sequencing results show that 28 plants among 46 tested plants have mutation on an OsPDS gene target sequence, and the mutation efficiency is 60%; the form of the mutation includes insertion and/or deletion of a base. FIG. 2 shows the results of the partial analysis (in FIG. 2, the first row WT sequence, the horizontal line segment is a PAM sequence, d represents deletion, i represents insertion, and the number represents the number of bases). Similarly, we constructed targeting vectors with the original ScCas9 gene and transformed rice, but did not obtain positive editing plants. Showing that the codon-optimized ScCas9 can achieve effective gene editing in plants under optimized culture conditions.

While the principles of the invention have been described in detail with respect to the preferred embodiments thereof, it will be understood by those skilled in the art that the foregoing embodiments are merely illustrative of exemplary implementations of the invention and are not limiting of the scope of the invention. The details of the embodiments are not to be interpreted as limiting the scope of the invention, and any obvious changes, such as equivalent alterations, simple substitutions and the like, based on the technical solution of the invention, can be interpreted without departing from the spirit and scope of the invention.

Sequence listing

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> ScCas9 gene with high shearing efficiency and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4128

<212> DNA

<213> Rice (rice)

<400> 1

atggagaaaa agtactccat cgggctcgac attgggacca atagcgtggg gtgggccgtc 60

atcaccgacg actataaggt cccaagcaaa aagttcaaag tgctggggaa cacaaatcgc 120

aagagcatca agaaaaatct gatgggcgcg ctcctcttcg acagcggcga aaccgccgaa 180

gcgacaaggc tcaagaggac agcgaggcgc cgctataccc gccgcaaaaa tcgcattcgc 240

tatctccaag agatcttcgc caacgagatg gcgaagctcg atgacagctt cttccagagg 300

ctggaggaat cctttctcgt cgaggaagac aagaagaatg agcgccaccc aattttcggg 360

aatctcgcgg acgaggtcgc ctaccatcgc aattatccaa ccatttatca tctccgcaag 420

aagctggccg actccccgga gaaggccgat ctgaggctca tctacctcgc gctcgcgcac 480

atcattaagt ttcgcgggca ctttctcatc gaaggcaagc tgaacgccga aaattccgac 540

gtcgccaagc tgttctatca gctcattcag acctacaacc agctcttcga agagagcccg 600

ctggatgaga tcgaggtgga tgcgaagggc attctcagcg cgaggctcag caagtccaaa 660

aggctcgaga agctgatcgc cgtgttcccg aatgagaaga agaatgggct gttcggcaat 720

attattgccc tcgcgctcgg gctgacaccg aatttcaagt ccaacttcga cctcacagag 780

gacgcgaagc tgcagctgag caaagacacc tacgacgacg atctcgacga actgctcggg 840

caaattgggg atcagtatgc cgatctgttc tccgccgcca agaacctcag cgacgcgatt 900

ctgctctccg acattctgcg ctccaacagc gaagtcacca aagcgccact ctccgcgagc 960

atggtgaaac gctacgacga gcatcatcaa gatctcgcgc tcctcaagac cctcgtgcgc 1020

cagcagttcc cggaaaaata cgcggagatt ttcaaggacg acaccaagaa tgggtacgcc 1080

ggctacgtgg ggatcggcat caagcatcgc aagaggacaa ccaagctggc gacacaagag 1140

gagttttaca agttcattaa gccgatcctc gagaagatgg acggcgcgga ggaactgctg 1200

gccaaactca accgcgatga cctcctccgc aagcaaagga ccttcgacaa cggctccatt 1260

ccacaccaga tccacctcaa agaactgcat gccattctgc gccgccaaga ggagttctac 1320

ccgtttctca aagagaatcg cgagaaaatt gagaaaatcc tcaccttccg cattccatac 1380

tacgtcgggc cactggcgag ggggaattct cgcttcgcgt ggctcacacg caagagcgag 1440

gaggcgatta ccccatggaa cttcgaggag gtcgtggata agggcgcgtc cgcccagtcc 1500

tttattgagc gcatgaccaa ttttgacgag cagctcccga ataagaaggt gctgccgaag 1560

cactctctcc tctatgaata ttttaccgtc tacaacgaac tcaccaaagt caagtacgtc 1620

accgagcgca tgaggaagcc ggagtttctc agcggggagc agaaaaaagc catcgtggat 1680

ctcctcttta agaccaaccg caaggtgacc gtgaagcaac tcaaagagga ttattttaag 1740

aagattgagt gctttgacag cgtggagatc atcggggtcg aagaccgctt caacgccagc 1800

ctcgggacct accacgacct cctcaagatt attaaagaca aagactttct ggataacgag 1860

gagaacgaag acatcctcga agatatcgtg ctcaccctca cactctttga ggaccgcgag 1920

atgatcgagg agaggctcaa gacctatgcg catctctttg acgacaaggt gatgaagcag 1980

ctcaagaggc gccattacac cggctggggg aggctctctc gcaagatgat caacggcatt 2040

agggacaaac agtccggcaa gaccattctc gacttcctca agtccgatgg cttcagcaat 2100

aggaacttca tgcagctgat ccacgatgat tctctcacat tcaaggagga aattgagaaa 2160

gcccaagtgt ccggccaagg cgactccctc catgagcaga tcgccgatct ggcggggtcc 2220

ccagccatta aaaaggggat cctccagacc gtgaaaattg tggacgaact cgtcaaggtc 2280

atggggcata agccggagaa catcgtcatc gagatggccc gcgaaaacca gaccaccaca 2340

aaaggcctcc agcagagccg cgagcgcaaa aagcgcatcg aggagggcat caaagaactc 2400

gagagccaga ttctcaaaga gaatccagtc gagaacaccc aactccagaa cgaaaagctc 2460

tacctctact atctgcaaaa cgggcgcgac atgtatgtcg accaagaact cgacatcaat 2520

aggctctccg actatgatgt cgatcacatc gtcccgcaga gctttatcaa ggacgattcc 2580

atcgacaaca aggtgctcac acgcagcgtc gagaatcgcg gcaaaagcga taacgtccca 2640

agcgaagagg tggtcaagaa gatgaagaac tactggaggc agctgctcaa cgccaagctc 2700

atcacacagc gcaagttcga caacctcaca aaggccgaac gcggggggct ctccgaagcg 2760

gataaagcgg gcttcatcaa gaggcaactc gtggagacac gccagattac caaacatgtg 2820

gcgcgcatcc tcgactctcg catgaacacc aaacgcgaca agaatgataa gccgatccgc 2880

gaggtgaagg tcattacact caaatccaag ctcgtgtccg atttccgcaa ggatttccag 2940

ctctacaaag tgagggacat caacaattac caccacgccc acgatgcgta tctcaatgcg 3000

gtggtcggca ccgcgctcat taagaagtac ccaaagctcg agtccgaatt tgtctacggg 3060

gactacaagg tgtacgacgt gcgcaagatg attgcgaaat ccgaacaaga gattggcaag 3120

gccacagcca agaggttctt ttacagcaac attatgaatt tcttcaagac agaggtcaag 3180

ctggccaacg gcgagattcg caaaaggccg ctgatcgaga caaatggcga aaccggcgaa 3240

gtcgtctgga acaaggaaaa ggactttgcc accgtccgca aagtgctggc catgccacaa 3300

gtgaacatcg tgaagaaaac cgaggtccaa accggcggct ttagcaagga gtccattctg 3360

agcaagcgcg aatccgcgaa actcatccca cgcaagaagg gctgggacac aaggaagtac 3420

ggcggcttcg gctccccgac agtggcctat tccattctgg tcgtcgccaa ggtggaaaag 3480

ggcaaggcga agaagctgaa atccgtcaag gtgctggtgg gcatcacaat tatggaaaag 3540

gggagctatg agaaggaccc aatcggcttc ctcgaagcca aggggtataa agatatcaaa 3600

aaggaactca tcttcaagct gccgaagtat tctctcttcg aactcgaaaa tgggaggcgc 3660

cgcatgctgg cgtccgccac agagctgcag aaggccaacg agctggtgct cccacaacat 3720

ctcgtgaggc tgctctacta tacacagaac atcagcgcca caaccggctc caataatctc 3780

gggtatatcg agcagcaccg cgaagagttc aaggagattt tcgaaaaaat tatcgacttc 3840

agcgaaaaat atattctcaa gaataaggtg aatagcaatc tgaagtccag cttcgacgaa 3900

caatttgcgg tgagcgacag cattctgctg agcaacagct tcgtgtctct gctcaaatat 3960

accagctttg gcgccagcgg gggcttcacc tttctcgacc tcgatgtgaa gcaagggagg 4020

ctccgctatc agacagtgac agaggtcctc gatgcgaccc tcatctacca gagcattacc 4080

gggctctacg agacacgcac cgatctgtcc cagctcgggg gggattga 4128

<210> 2

<211> 1696

<212> DNA

<213> Rice (rice)

<400> 2

aagggatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60

tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 240

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 300

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 360

ttgtgcagat gatccgtggc aagagaccaa cccagtggac ataagcctgt tcggttcgta 420

agctgtaatg caagtagcgt atgcgctcac gcaactggtc cagaaccttg accgaacgca 480

gcggtggtaa cggcgcagtg gcggttttca tggcttgtta tgactgtttt tttggggtac 540

agtctatgcc tcgggcatcc aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt 600

tatggagcag caacgatgtt acgcagcagg gcagtcgccc taaaacaaag ttaaacatca 660

tgggggaagc ggtgatcgcc gaagtatcga ctcaactatc agaggtagtt ggcgtcatcg 720

agcgccatct cgaaccgacg ttgctggccg tacatttgta cggctccgca gtggatggcg 780

gcctgaagcc acacagtgat attgatttgc tggttacggt gaccgtaagg cttgatgaaa 840

caacgcggcg agctttgatc aacgaccttt tggaaacttc ggcttcccct ggagagagcg 900

agattctccg cgctgtagaa gtcaccattg ttgtgcacga cgacatcatt ccgtggcgtt 960

atccagctaa gcgcgaactg caatttggag aatggcagcg caatgacatt cttgcaggta 1020

tcttcgagcc agccacgatc gacattgatc tggctatctt gctgacaaaa gcaagagaac 1080

atagcgttgc cttggtaggt ccagcggcgg aggaactctt tgatccggtt cctgaacagg 1140

atctatttga ggcgctaaat gaaaccttaa cgctatggaa ctcgccgccc gactgggctg 1200

gcgatgagcg aaatgtagtg cttacgttgt cccgcatttg gtacagcgca gtaaccggca 1260

aaatcgcgcc gaaggatgtc gctgccgact gggcaatgga gcgcctgccg gcccagtatc 1320

agcccgtcat acttgaagct agacaggctt atcttggaca agaagaagat cgcttggcct 1380

cgcgcgcaga tcagttggaa gaatttgtcc actacgtgaa aggcgagatc accaaggtag 1440

tcggcaaata atgtctagct agaaattcgt tcaagccgac gccgcttcgc ggcgcggctt 1500

aactcaagcg ttagatgcac taagcacata attgctcaca gccaaactat caggtcaagt 1560

ctgcttttat tatttttaag cgtgcataat aagccggtct cagtttcaga gctatgctgg 1620

aaacagcata gcaagttgaa ataaggctag tccgttatca acttgaaaaa gtggcaccga 1680

gtcggtgctt tttttt 1696

<210> 3

<211> 22

<212> DNA

<213> Rice (rice)

<400> 3

cattgcctgc acccttaaat gg 22

<210> 4

<211> 23

<212> DNA

<213> Rice (rice)

<400> 4

ttcacattgc ctgcaccctt aaa 23

<210> 5

<211> 24

<212> DNA

<213> Rice (rice)

<400> 5

aaacatttaa gggtgcaggc aatg 24

<210> 6

<211> 26

<212> DNA

<213> Rice (rice)

<400> 6

gcatgcagtt ttcaactaca aaccgg 26

<210> 7

<211> 28

<212> DNA

<213> Rice (rice)

<400> 7

caagacgacc tcgtgaccag gaagtagc 28

<210> 8

<211> 22

<212> DNA

<213> Rice (rice)

<400> 8

gcttatccca acatacagaa ct 22

<210> 9

<211> 22

<212> DNA

<213> Rice (rice)

<400> 9

aaagtaacca ccaatacgat gt 22

Claims (9)

1. A high-shearing efficiency ScCas9 gene, wherein the high-shearing efficiency ScCas9 gene is shown as SEQ ID No:1 is shown.

2. An expression cassette comprising the high shear efficiency ScCas9 gene of claim 1.

3. An expression vector into which the high shear efficiency ScCas9 gene of claim 1 or the expression cassette of claim 2 is inserted.

4. The expression vector of claim 3, wherein the vector is PUC 57-AMP.

5. A targeting vector comprising the high shear efficiency ScCas9 gene of claim 1 or the expression cassette of claim 2 inserted therein.

6. A transgenic cell transformed with the high shear efficiency ScCas9 gene of claim 1, the expression cassette of claim 2, the expression vector of claim 3 or 4, or the targeting vector of claim 5, wherein the transgenic cell is a non-plant cell.

7. Use of the high shear efficiency ScCas9 gene of claim 1, the expression cassette of claim 2, the expression vector of claim 3 or 4, the targeting vector of claim 5 or the transgenic cell of claim 6 in rice genome editing, wherein the rice genome editing comprises shearing a plant genome to obtain a transgenic plant or plant part comprising a mutation site.

8. The use of claim 7, wherein the plant is japonica rice, which comprises Nipponbare.

9. A method for obtaining a rice mutant by using a non-bacterially-derived Cas9 gene, wherein the method comprises the steps of artificially synthesizing the high-shear-efficiency ScCas9 gene as defined in claim 1, connecting the high-shear-efficiency ScCas9 gene with a vector to obtain a recombinant expression vector, introducing the recombinant expression vector into a plant cell, and shearing the genome in the plant cell to obtain a transgenic mutant.

Images