CN110760540A - Gene editing artificial system for rice and application thereof - Google Patents

Abstract

The invention provides a set of gene editing artificial system for rice and application thereof. The artificial system comprises a nucleotide sequence having the I regulatory element of amino acid sequence I; the amino acid sequence I is selected from one of the following 1) to 3): 1) amino acid sequences shown as SEQ ID No.1 and SEQ ID No. 2; 2) the amino acid sequences shown as SEQ ID No.3, SEQ ID No.1, SEQ ID No.4 and SEQ ID No.2 are shown in sequence from the N end to the C end; 3) the second mutant amino acid sequence of SEQ ID No.5, SEQ ID No.1 and the amino acid sequence shown in SEQ ID No.2 are shown in sequence from the N end to the C end; a II regulatory element comprising a II-1 nucleotide sequence package comprising the target nucleotide sequence and a II-2 nucleotide sequence comprising the sgRNA nucleic acid sequence.

Description

Gene editing artificial system for rice and application thereof

Technical Field

The invention relates to a set of gene editing artificial system for rice and application thereof.

Background

The genome site-directed editing technology is an effective high-quality technical means, and can be used for plant functional genome research and crop molecular genetic breeding. The genome editing technology is mainly realized by the following three artificial endonucleases: zinc finger nucleases, ZFNs, transcription activator-like effector nucleases, TALENs, and RNA-guided endonucleases based on CRISPR/Cas systems. The process of gene editing is the generation of double stranded DNA breaks (DSBs) at genomic target sites that can be repaired by non-homologous end joining (NHEJ) and homologous recombination (HDR). Endonucleases in the RNA-guided endonuclease system of the CRISPR-Cas9 system, such as Cas9, have been demonstrated to be multifunctional tool enzymes for plant gene editing and regulation. Especially, the base editor developed based on the system has important application value in functional genomics research and crop precision molecular breeding. However, when the gRNA directs Cas9 to bind to the genomic DNA target site, it is necessary to rely on a conserved PAM sequence 3' of the target site. Base editing technology developed based on the CRISPR/SpCas9 system also has limited base editing efficiency due to the specificity of the edited target site and the possible absence of a proper PAM sequence, which both greatly limit the application of the CRISPR/Cas9 system in plant genome editing. At present, the commonly used SpCas9 derived from streptococcus pyogenes mainly recognizes 5'-NGG-3' PAM, and various mutants obtained by artificially modifying SpCas9 protein can recognize different PAMs, such as SpCas9-VQR recognizing 5'-NAG-3' PAM and SpCas9-NG recognizing 5'-NG-3' PAM. These PAM extended editing tools still do not fully satisfy the variety of editing scenarios encountered during practical applications.

Therefore, if a highly efficient genome site-directed editing technology capable of recognizing different PAM sequences in plants, especially rice, can be developed, the editing range of the existing genome editing technology can be widened, and the technology has important promotion effects on plant functional genomics research and crop molecular breeding.

Disclosure of Invention

One of the invention provides a set of gene editing artificial system, which comprises:

an I regulatory element comprising a nucleotide sequence capable of encoding a protein of amino acid sequence I; wherein the amino acid sequence I is selected from one of the following 1) to 3):

1) the amino acid sequence shown as SEQ ID No.1 and the amino acid sequence shown as SEQ ID No. 2;

2) the amino acid sequences of SEQ ID No.3, SEQ ID No.1, SEQ ID No.4 and SEQ ID No.2 are shown in sequence from the N end to the C end; wherein, the first mutant amino acid sequence of SEQ ID No.1 is obtained by mutating the 10 th amino acid in the SEQ ID No.1 from aspartic acid D to alanine A, and other amino acid sequences are unchanged;

3) the second mutant amino acid sequence of SEQ ID No.5, SEQ ID No.1 and the amino acid sequence shown in SEQ ID No.2 are shown in sequence from the N end to the C end; wherein the second mutant amino acid sequence of SEQ ID No.1 is identical to the first mutant amino acid sequence of SEQ ID No. 1;

a II regulatory element comprising a II-1 nucleotide sequence and a II-2 nucleotide sequence in this order from the 5 'end to the 3' end; the II-1 nucleotide sequence comprises a target nucleotide sequence; the II-2 nucleotide sequence comprises a sgRNA nucleic acid sequence; said II-1 nucleotide sequence and said II-2 nucleotide sequence being transcriptionally fused, the product of which is capable of directing the protein encoded by the I regulatory element to a target site to be mutated in the genome of at least one of the gramineae plants, and

when the amino acid sequence I is 1), the genome of the gramineous plant is cut at the target site and an insertion or deletion mutation occurs upon gene editing; wherein the relative position of the target site is between the 15 th and 17 th positions of the target nucleotide sequence from the 5 'end to the 3' end based on the target nucleotide sequence;

a C-mutant T at the target site in the genome of the gramineae upon gene editing when the amino acid sequence I is 2); wherein the relative position of the target site is from the 2 nd position to the 10 th position of the target nucleotide sequence from the 5 'end to the 3' end based on the target nucleotide sequence;

an A mutation G at the target site in the genome of the gramineous plant upon gene editing when the amino acid sequence I is 3); wherein the relative position of the target site is from position 2 to position 8 of the target nucleotide sequence from 5 'to 3' based on the target nucleotide sequence;

when the II th regulatory element is plural, the plural II-1 th nucleotide sequences contained therein are different two by two.

In one embodiment, the nucleotide sequence of the regulatory element I is a nucleotide sequence suitable for expression in rice and the nucleotide sequence of the regulatory element II is a nucleotide sequence suitable for transcription in rice.

In one embodiment, the nucleotide coding sequence capable of encoding the amino acid sequence shown as SEQ ID No.1 is shown as SEQ ID No. 6; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.2 is shown as SEQ ID No. 7; the nucleotide coding sequence capable of coding the first mutant amino acid sequence as shown in SEQ ID No.1 differs from the nucleotide sequence shown in SEQ ID No.6 in that adenine A at position 29 of the nucleotide sequence shown in SEQ ID No.6 is replaced by cytosine C; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.3 is shown as SEQ ID No. 8; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.4 is shown as SEQ ID No. 9; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.5 is shown as SEQ ID No. 10.

In one embodiment, the nucleotide sequence of II-2 is shown in SEQ ID No. 11.

In one embodiment, the II-1 nucleotide sequence includes a type IIS restriction enzyme cleavage site, and the target nucleotide sequence can be cloned via the type IIS restriction enzyme cleavage site to transcriptionally fuse the II-1 nucleotide sequence with the II-2 sequence.

In a specific embodiment, when said IIth regulatory element is plural, said type IIS restriction enzyme used for cloning different target nucleotide sequences has two or more different cleavage sites.

Since the target nucleotide sequence varies depending on the gene editing site, other elements may be constructed, including the restriction enzyme cleavage site of the restriction enzyme previously cloned in the relevant position. Before use, the target nucleotide sequence is cloned by cleavage and ligation of the restriction sites of restriction enzymes according to gene editing purposes. When the number of the second regulatory element is multiple, the restriction enzyme cutting sites of the multiple second II-1 nucleotide sequences contained in the multiple second regulatory elements are different pairwise, so that different target nucleotides can be effectively guaranteed to be successfully cloned to a target position. Multiple target nucleotide sequences can be used for base editing of multiple target sites to be mutated on the genome of the target organism.

In one embodiment, it is preferred that the nucleotide sequence of the cloning site comprises two BsaI cleavage sites and/or two BtgZI cleavage sites.

In a specific embodiment, the target nucleotide sequence is determined by:

1) determining a nucleotide sequence to be modified on the genome of said graminaceous plant;

2) judging that the nucleotide sequence to be modified determined in the step 1) is a specific sequence in the genome,

judging whether the change caused by the mutation of the base of the nucleotide site to be mutated is in accordance with the expectation according to the I-th regulating element; or judging whether the change caused by the mutation of the reverse complementary base of the nucleotide site to be mutated is in accordance with the expected result according to the I-th regulating element;

for the prospective, the nucleotide site to be mutated is a potential target site;

3) screening for a target sequence in the nucleotide sequence to be engineered or its reverse complement: searching in the direction of the 3' end of the potential target site to confirm the presence of a recognition motif that can be recognized by the amino acid sequence encoded by said regulatory element I, and

when the amino acid sequence I is 1), the target site is at a position-3 to-5 upstream of the 5 'end of the recognition module, and the thus determined 17 to 21 nucleotide sequences upstream of the 5' end of the recognition module are the target nucleotide sequence;

when the amino acid sequence I is 2), the target site is at a position-19 to-11 upstream of the 5 'end of the recognition module, and the nucleotide sequence 17 to 21 upstream of the 5' end of the recognition module thus determined is the target nucleotide sequence;

when the amino acid sequence I is 3), the target site is at a position-19 to-13 upstream of the 5 'end of the recognition module, and the nucleotide sequence 17 to 21 upstream of the 5' end of the recognition module thus determined is the target nucleotide sequence.

In one embodiment, the I regulatory element encodes a protein with a recognition motif of 5' -N₁N₂G-3', the target nucleotide sequence is a nucleotide sequence of 17 to 21 nucleotides at the upstream of the 5' end of the identification module sequence, and the nucleotide sequence containing five continuous T is eliminated; wherein, the N is₁And N₂Independently one of A, G, C and T.

In a specific embodiment, said artificial system further comprises a first promoter at the 5' end of said I regulatory element capable of being used in said gramineae and capable of promoting transcription of said I regulatory element; and/or said artificial system further comprises a second promoter at the 5' end of said second regulatory element capable of being used in said gramineae and capable of promoting transcription of said second regulatory element; said artificial system further comprising a first terminator at the 3' end of said I regulatory element, which is capable of being used in said gramineae and of terminating the transcription of said I regulatory element; and/or the artificial system further comprises a second terminator at the 3' end of said second regulatory element, which terminator is capable of being used in said gramineae and of terminating the transcription of said second regulatory element.

In a specific embodiment, the first promoter is an RNA polymerase II type promoter; and/or the second promoter is an RNA polymerase type III promoter.

In one embodiment, the first promoter is the Ubip promoter (SEQ ID No. 12); and/or the second promoter is the U6 promoter (SEQ ID No. 21).

In one embodiment, the first terminator is a NOS terminator (SEQ ID No. 13); and/or the second terminator is a (T)8 terminator (SEQ ID No. 23).

In one embodiment, said I regulatory element and said II regulatory element are capable of being cloned into at least one vector.

In one embodiment, the I regulatory element can be cloned into pCAMBIA1300 and the II regulatory element into the entry vector pENTR 4.

In one embodiment, the first promoter, ith regulatory element, and first terminator can be cloned into the pCAMBIA1300 vector.

In one embodiment, the second promoter, the second regulatory element II, and the second terminator can be cloned into the pENTR4 vector.

In one embodiment, the I regulatory element and the II regulatory element can be integrated on the same vector or distributed over multiple vectors for use together.

The second aspect of the invention provides the use of the artificial system according to any of the first aspect of the invention for at least one of knocking out an endogenous gene in the genome of at least one of gramineae plants, site-directed mutating a C to a T in the genome of at least one of gramineae plants, or site-directed mutating an a to a G in the genome of at least one of gramineae plants.

In a specific embodiment, the graminaceous plant is rice.

The third invention provides a method for knocking out endogenous genes in the genome of at least one of gramineae plants, mutating C in the genome of at least one of gramineae plants to T at a fixed point, or mutating A in the genome of at least one of gramineae plants to G at a fixed point, which comprises the following steps:

A) introducing the artificial system according to any one of the invention into callus of the gramineous plant or protoplast of the gramineous plant by one of methods of agrobacterium-mediated transformation, gene gun bombardment or PEG-mediated transformation, and then culturing to obtain a plant of the gramineous plant;

B) screening to obtain a plant of the gramineae plant containing gene knockout mutation or site-directed mutation;

when the amino acid sequence I is 1), the genome of the gramineous plant is cut at the target site upon gene editing, and an inserted or deleted knockout mutation occurs;

a C-mutant T at the target site in the genome of the gramineae upon gene editing when the amino acid sequence I is 2);

when the amino acid sequence I is 3), the genome of the gramineae has an A mutation G at the target site upon gene editing.

In one embodiment, the plant of the Poaceae plant is capable of producing rice seeds containing a knockout mutation or a site-directed substitution of a base.

In a specific embodiment, the graminaceous plant is rice.

The invention has the beneficial effects that:

a) the number of the second regulatory element may be plural, so that plural bands 5' -N in rice cells can be edited simultaneously₁N₂Gene target sites for G-3' PAM.

b) By selecting different I-th regulatory elements in the artificial gene editing system, gene knockout (frame shift mutation introduced by deletion or insertion of a few bases) in the rice genome, or conversion from base pair A/T to base pair G/C, or conversion from base pair G/C to base pair A/T can be realized.

c) The invention provides a method for identifying new 5' -N₁N₂A gene editing tool system is provided in G-3' PAM, the application range of plant genome fixed-point editing is widened, and the gene editing tool system can be widely applied to the knockout of target genes or the directional mutation of single bases in rice genomes so as to create gene function inactivation or acquired mutant materials. In particular, the method is beneficial to realizing the base conversion of any site, provides an important gene function research tool for scientific researchers in the plant research field, and provides a new strategy for cultivating new rice varieties in the rice gene function research and molecular breeding directions.

Drawings

FIG. 1 shows the editing effect of pUbi-ScCas9 in OsCPK6 gene recognition of 5'-cgg-3' PAM.

FIG. 2 is a graph showing the editing effect of pUbi-ScCas9 in recognition of 5'-gag-3' PAM by OsMPK16 gene.

FIG. 3 shows the editing effect of pUbi-ScCas9 in OsMPK9 gene recognition of 5'-ctg-3' PAM.

FIG. 4 shows the editing effect of pUbi-ScCas9 in OsCPK6 gene recognition of 5'-gcg-3' PAM.

FIG. 5 is a graph showing the editing effect of pUbi-rBE25 at the target site of OsBZR1 gene.

FIG. 6 is a graph showing the editing effect of pUbi-rBE26 at the target site of OsGS1 gene.

Detailed Description

The present invention will be described in detail with reference to examples. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

The reagents in the following examples were all commercially available unless otherwise specified.

pCAMBIA1300 was derived from the Biovector NTCC type culture Collection. An attR1-ccdB-attR2 module was inserted into pCAMBIA1300 for gateway reaction to accept an attL 1-targeting sequence transcription module-attL 2 module from an entry vector.

pENTR4 vector was purchased from Invitrogen, USA.

The pBluescript SK vector was purchased from Clontech.

Example 1: construction of recombinant plasmid

The technical route for constructing the vector is as follows:

1.1 construction of pUbi-ScCas9 recombinant plasmid.

The amino acid sequence of the ScCas9 is shown as SEQ ID No.1, the sequence SEQ ID No.6 is formed after the nucleotide coding sequence is subjected to artificial codon optimization, a 4125bp ScCas9 gene fragment is artificially synthesized and cloned to pUC57, and the gene fragment is named as pUC57-ScCas9 (the sequence synthesis and cloning work are completed by the company Limited in the biological engineering (Shanghai)). Then, SEQ ID No.12 (maize ubiquitin promoter Ubip), SEQ ID No.6, SEQ ID No.7 (nuclear localization signal NLS), and SEQ ID No.13(Nos terminator) were cloned into pCAMBIA1300 vector in the 5 'to 3' direction, and the plasmid was named pUbi-ScCas 9. The plasmid pUbi-ScCas9 was constructed in the following order: CaMV35S promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), hygromycin gene (genebank accession number KY420085.1), NOS terminator (as shown in SEQ ID No.13), pVS1 RepA (genebank accession number KY420084.1, nucleotide sequence 5755 to 6435), pVS1 origin of replication (genebank accession number KY420084.1, nucleotide sequence 4066 to 5066), attR1 (genebank accession number KR233518.1, nucleotide sequence 2055 to 2174), ccdB expression cassette (genebank accession number KR233518.1, nucleotide sequence 3289 to 3594), attR2 (genebank accession number KR233518.1, nucleotide sequence 3635 to 3759), Ubip promoter (as shown in SEQ ID No.12), gene sca 9 (as shown in SEQ ID No. 6), nuclear localization signal (SEQ ID No.7) and nuclear localization signal SEQ ID No.13 (as shown in SEQ ID No. 13).

1.2 pUbi-rBE25 recombinant plasmid construction

First, EcoRI and SpeI were used to double-cleave the laboratory self-vector pUbi-rBE9(Improved base plasmid for influencing genetic variations in rice with CRISPR/Cas9.Ren Bin, YanFang, Kuang Yongjie, Li Na, Zhang Daweii, Zhou Xueyepin, Lin Honghui and Zhouhuanbin. molecular Plant,2018,11:623-626) and the cloning vector pBluescript SK purchased from Clontech, respectively, recovering the 5.05kb fragment and the 3kb linearized vector backbone, joining them, named pBS-rBE9, and preparing for use after colony PCR and cleavage confirmation.

UGI-F3 (shown as SEQ ID No. 14) and rAPO-R2 (shown as SEQ ID No. 15) are used as primers, and I-5 is utilized^TM2 × HighFidelity Master Mix (purchased from Kroming (Beijing) Biotechnology Co., Ltd.) was subjected to PCR amplification using the vector pBS-rBE9 as a template, and a vector backbone of about 4kb was recovered. Meanwhile, the primers are ScCas9-F1 (shown as SEQ ID No. 16) and ScCas9-R1 (shown as SEQ ID No. 17), and I-5 is utilized^TM2 XHighFidelity Master Mix was PCR-amplified using pUC57-ScCas9 synthesized by the same company as a template to obtain a ScCas9n gene fragment of about 4kb, which was recovered, phosphorylated, ligated to the 4kb vector backbone, and named pBS-rBE 25. Sequencing for later use after colony PCR and enzyme digestion verification.

The vectors pBS-rBE25 and pUbi-ScCas9 were digested with BamHI and SpeI, respectively, to recover a 5.03kb rBE25 fragment and an about 12kb vector backbone, and the 5.03kb rBE25 fragment was ligated to the about 12kb vector backbone with T4 DNA ligase, and the plasmid was named pUbi-rBE 25. The plasmid pUbi-rBE25 was constructed in the following order: CaMV35S promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), hygromycin gene (genebank accession number KY420085.1), NOS terminator (as shown in SEQ ID No.13), pVS1 RepA (genebank accession number KY420084.1, nucleotide sequence 5755 to 6435), pVS1 origin of replication (genebank accession number KY420084.1, nucleotide sequence 4066 to 5066), attR1 (genebank accession number KR233518.1, nucleotide sequence 2055 to 2174), ccdB expression cassette (genebank accession number KR233518.1, nucleotide sequence 3289 to 3594), attR2 (genebank accession number KR233518.1, nucleotide sequence 3635 to 3759), Ubip promoter (as shown in SEQ ID No.12), gene Δ ID 738, nucleotide sequence SEQ ID No. GCS 739, nucleotide sequence SEQ ID No. GCS 9, nucleotide sequence SEQ ID No. GCS promoter (SEQ ID No. GCS accession number: SEQ ID No. GCS No., the NOS terminator (shown in SEQ ID No. 13). Wherein, the amino acid sequence coded by the hAID delta gene is shown as SEQ ID No. 3; the ScCas9n gene encodes amino acid sequence, except that the 10 th amino acid in the SEQ ID No.1 is mutated from aspartic acid to alanine, the other amino acid sequence is not changed; the amino acid sequence of UGI gene coding is shown as SEQ ID No. 4.

1.3 construction of pUbi-rBE26 recombinant plasmid

The TadA amino acid sequence is shown as SEQ ID No.5, the sequence SEQ ID No.10 is formed after artificial codon optimization is carried out on the nucleotide coding sequence, a 1191bp TadA gene segment shown as SEQ ID No.10 is artificially synthesized and then cloned to pUC57 to be named as pUC57-TadA (the process is entrusted to be completed by Beijing Optimalaceae New Biotechnology Co., Ltd.).

Using pUC57-F1 (shown as SEQ ID No. 18) and TadA-R3 (shown as SEQ ID No. 19) as primers and I-5^TM2 × HighFidelity Master Mix was PCR-amplified using pUC57-TadA as a template to obtain a 4.13kb vector backbone. Then uses I-5 with ScCas9-F1 (shown as SEQ ID No. 16) and NLS-R3 (shown as SEQ ID No. 20)^TM2 Xhigh Fidelity Master Mix was PCR-amplified using pUC57-ScCas9 as a template to obtain a gene fragment of ScCas9n of about 4kb, which was recovered and then phosphorylated, ligated to the 4.13kb vector backbone, and named pUC57-rBE 26. Sequencing for later use after colony PCR and enzyme digestion verification.

The above vectors pUC57-rBE26 and pUbi-ScCas9 were digested with BamHI and SpeI, respectively, to recover a rBE26 fragment of 5.33kb and a vector backbone of about 12kb, respectively, and a rBE26 fragment was ligated to the vector backbone using T4 DNA ligase, and the plasmid was named pUbi-rBE 26. The plasmid pUbi-rBE26 was constructed in the following order: CaMV35S promoter (genebank accession number FJ362600.1, nucleotide sequence 10382 to 11162), hygromycin gene (genebank accession number KY420085.1), NOS terminator (as shown in SEQ ID No.13), pVS1 RepA (genebank accession number KY420084.1, nucleotide sequence 5755 to 6435), pVS1 origin of replication (genebank accession number KY420084.1, nucleotide sequence 4066 to 5066), attR1 (genebank accession number KR233518.1, nucleotide sequence 2055 to 2174), ccdB expression cassette genebank accession number KR233518.1, nucleotide sequence 3289 to 3594), attR2 (genebank accession number KR233518.1, nucleotide sequence 3635 to 3759), Ubip promoter (as shown in SEQ ID No.12), TadA gene (as shown in SEQ ID No. 3210), cDNA sequence of the genebank accession number Sc n (SEQ ID No. 29) is replaced by adenine sequence shown in SEQ ID No.29, other bases were not changed), a nuclear localization signal (SEQ ID No.7), and a NOS terminator (shown in SEQ ID No. 13). Wherein, the amino acid sequence coded by the TadA gene is shown in SEQ ID No. 5.

1.4 construction of pENTR4-sgRNA

According to the direction from 5 'end to 3' end, a U6 promoter sequence (shown as SEQ ID No.21), a nucleotide sequence containing two BtgZI enzyme cutting sites (shown as SEQ ID No. 22), a sgRNA sequence (shown as SEQ ID No. 11), a (T)8 termination sequence (shown as SEQ ID No.23), a U6 promoter sequence (shown as SEQ ID No.21), a nucleotide sequence containing two BsaI enzyme cutting sites (shown as SEQ ID No. 24), a sgRNA sequence (shown as SEQ ID No. 11) and a (T)8 termination sequence (shown as SEQ ID No.23) which are connected in sequence are artificially synthesized, and the sequences are cloned into a pENTR4 vector and named as pENTR 4-sgRNA. Wherein, the two BtgZI or two BsaI enzyme cutting sites are used for cloning a target nucleotide sequence of a specific gene, and the target nucleotide sequences inserted into the BtgZI and BsaI enzyme cutting sites are different.

Example 2: rice endogenous gene knockout by using pUbi-ScCas9

2.1 identification sequence design and cloning for OsCPK6, OsMPK9, OsMPK16 genes

The transcription sequences and genome sequences of OsCPK6, OsMPK9 and OsMPK16 genes are obtained from MSU/TIGR rice genome database (http://rice.plantbiology.msu.edu/)。

For the OsCPK6 gene, a primer containing a target nucleotide sequence (SEQ ID No.25, PAM (polyacrylamide) cgg) which is connected and matched with the end of the BsaI enzyme cutting site is designed as follows: gOsCPK6-F1(SEQ ID No.26, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 25) and gOsCPK6-R1(SEQ ID No. 27). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form double strands, and cloned into the BsaI cleavage site of pENTR4-sgRNA vector using gOsCPK6-F1/gOsCPK6-R1, and the sequencing results showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsCPK 6-F1. The cloned carrier is linearized by ApaI enzyme digestion and then cloned into pUbi-ScCas9 through the LR reaction of Gateway to obtain pUbi-ScCas9-gOsCPK 6-1.

For the OsMPK16 gene, primers containing a target nucleotide sequence (SEQ ID No.28, PAM gag) ligated and matched with the end of BsaI cleavage site were designed as follows: gOsMPK16-F1(SEQ ID No.29, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 29) and gOsMPK16-R1(SEQ ID No. 30). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form double strands, and cloned into the BsaI cleavage site of pENTR4-sgRNA vector using gOsMPK16-F1/gOsMPK16-R1, and the sequencing results showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsMPK 16-F1. The cloned carrier is linearized by ApaI enzyme digestion and then cloned into pUbi-ScCas9 through the LR reaction of Gateway to obtain pUbi-ScCas9-gOsMPK 16-1.

For the OsMPK9 gene, a primer containing a target nucleotide sequence (SEQ ID No.31, PAM ctg) which is connected and matched with the end of the BsaI enzyme cutting site is designed as follows: gOsMPK9-F2(SEQ ID No.32, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 31) and gOsMPK9-R2(SEQ ID No. 33). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form double strands, and cloned into the BsaI cleavage site of pENTR4-sgRNA vector using gOsMPK9-F2/gOsMPK9-R2, and the sequencing results showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsMPK 9-F2. The cloned carrier is linearized by ApaI enzyme digestion and then cloned into pUbi-ScCas9 through the LR reaction of Gateway to obtain pUbi-ScCas9-gOsMPK 9-2.

For the OsCPK6 gene, a primer containing a target nucleotide sequence (SEQ ID No.34, PAM gcg) which is connected and matched with the end of the BsaI enzyme cutting site is designed as follows: gOsCPK6-F2(SEQ ID No.35, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 34) and gOsCPK6-R2(SEQ ID No. 36). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form double strands, and cloned into the BsaI cleavage site of pENTR4-sgRNA vector using gOsCPK6-F2/gOsCPK6-R2, and the sequencing results showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsCPK 6-F2. The cloned carrier is linearized by ApaI enzyme digestion and then cloned into pUbi-ScCas9 through the LR reaction of Gateway to obtain pUbi-ScCas9-gOsCPK 6-2.

2.2 transformation of japonica Rice variety Kitaake

1) Rice callus induction:

treating the dehulled mature rice seeds with 50% commercial sterilizing solution for 45 minutes; cleaning with sterile water for 3-5 times, transferring the seeds to a sterile culture dish, and sucking out excessive water; placing the seeds on MSD plate (4.43g/LMS powder; 30g/L sucrose; 2 ml/L2, 4-D; 8g/L plant gel; pH5.7), culturing in light culture room for 10 days, and inducing callus formation; embryos and shoots of the seeds were removed and the calli were transferred to a new MSD petri dish and cultured for 5 days until they could be used for agrobacterium transformation.

2) And (3) agrobacterium transformation:

respectively transferring pUbi-ScCas9-gOsCPK6-1, pUbi-ScCas9-gOsMPK16-1, pUbi-ScCas9-gOsMPK9-2 and pUbi-ScCas9-gOsCPK6-2 into agrobacterium strain EHA105 competence by electric shock method, and culturing in TY culture medium (5g/L tryptone; 3g/L yeast extract; pH7.0) overnight at room temperature for 12 hours; the Agrobacterium was collected by centrifugation and resuspended in MSD broth to OD₆₀₀Stand up to 0.2 for use.

3) Agrobacterium infection of rice callus:

respectively placing the callus in the six kinds of agrobacterium tumefaciens suspension for 30 minutes; removing the agrobacterium suspension, transferring the callus onto sterile absorbent paper to remove redundant agrobacterium liquid, transferring the callus onto a new MSD culture medium containing 100 mu M acetosyringone, and culturing for 3 days at room temperature in a dark place.

4, rice resistance callus screening:

transferring the dark cultured callus onto MSD culture medium (containing 100mg/L timentin; 50mg/L hygromycin B) for 2 weeks to 2 months until the surface of the callus shows resistant callus; the medium was changed every 2 weeks.

5) Resistant callus differentiation and rooting

Transferring the resistant callus to a regeneration culture medium (4.43g/L MS powder, 30g/L sucrose, 25g/L sorbitol, 0.5mg/L NAA, 3mg/L BA, 100mg/L timentin, 50mg/L hygromycin B, 12g/L agar powder, pH5.7) until the resistant callus grows into a plant seedling, and transferring the resistant callus once every 7-10 days; the seedlings were transferred to 1/2MS medium (2.21g/L MS powder; 15g/L sucrose; 8g/L plant gel; pH5.7) for rooting.

2.3 identification of OsCPK6, OsMPK9 and OsMPK16 gene target sites in transgenic rice of T0 generation

Extracting the genome DNA of the rice seedling by a CTAB method.

pUbi-ScCas9-gOsCPK 6-1: specific PCR primers for identification were designed based on the target site DNA sequence of OsCPK6 gene: OsCPK6-F1(SEQ ID No.37) and OsCPK6-R1(SEQ ID No.38) using the genomic DNA of the corresponding resistant callus as a template and using I-5^TM2 XHighFidelity Master Mix was used to PCR amplify target fragment 566bp, and the PCR product was directly sequenced. The sequenced OsCPK6 target nucleotide sequence was analyzed, and 47 nucleotide insertions/deletions were detected in 48 rice seedlings, which indicated that the editing efficiency of the ScCas9 system on the OsCPK6 target site was 97.92%. This indicates that ScCas9 can recognize the PAM motif of 5'-cgg-3' and complete gene editing to the target site. One of the editing effects of pUbi-ScCas9 in OsCPK6 gene recognition of 5'-cgg-3' PAM is shown in FIG. 1.

pUbi-ScCas9-gOsMPK 16-1: specific PCR primers for identification were designed based on the target site DNA sequence of OsMPK16 gene: OsMPK16-F1(SEQ ID No.39) and OsMPK16-R1(SEQ ID No.40) using the genomic DNA of the corresponding resistant callus as a template and I-5^TM2 × HighFidelity Master Mix for PCR amplificationThe augmented fragment is 320bp, and the PCR product is directly subjected to sequencing detection. The sequenced target nucleotide sequence of OsMPK16 is analyzed, 31-strain insertion/deletion is detected in 34-strain rice seedlings, and the editing efficiency of the ScCas9 system on the OsMPK16 target site is 91.18%. This indicates that ScCas9 can recognize the PAM motif of 5'-gag-3' and complete gene editing to the target site. One of the editing effects of pUbi-ScCas9 on OsMPK16 gene 5'-gag-3' PAM is shown in FIG. 2.

pUbi-ScCas9-gOsMPK 9-2: specific PCR primers for identification were designed based on the target site DNA sequence of OsMPK9 gene: OsMPK9-F1(SEQ ID No.41) and OsMPK9-R1(SEQ ID No.42) take the genomic DNA of corresponding resistant callus as a template and utilize I-5^TM2 XHighFidelity Master Mix is used for PCR amplification of a target fragment of 420bp, and the PCR product is directly subjected to sequencing detection. The sequenced target nucleotide sequence of OsMPK9 was analyzed, and 4-strain insertion/deletion was detected in 56-strain rice seedlings, which indicated that the editing efficiency of the ScCas9 system on the OsMPK9 target site was 7.14%. This indicates that ScCas9 can recognize the PAM motif of 5'-ctg-3' and complete gene editing to the target site. One of the editing effects of pUbi-ScCas9 on OsMPK9 gene 5'-ctg-3' PAM is shown in FIG. 3.

pUbi-ScCas9-gOsCPK 6-2: specific PCR primers for identification were designed based on the target site DNA sequence of OsCPK6 gene: OsCPK6-F1(SEQ ID No.37) and OsCPK6-R1(SEQ ID No.38) using the genomic DNA of the corresponding resistant callus as a template and using I-5^TM2 XHighFidelity Master Mix was used to PCR amplify target fragment 566bp, and the PCR product was directly sequenced. Analyzing the sequenced OsCPK6 target nucleotide sequence, identifying the 5'-NCG-3' PAM target site by the OsCPK6 gene, detecting and finding 14 strains in 30 rice seedlings, and showing that the editing efficiency of the ScCas9 system on the OsCPK6 target site is 46.67%. This indicates that ScCas9 can recognize the PAM motif of 5'-gcg-3' and complete gene editing to the target site. One of the editing effects of pUbi-ScCas9 in OsCPK6 gene recognition of 5'-gcg-3' PAM is shown in FIG. 4.

Example 3: c > T replacement of target base of rice endogenous gene by using pUbi-rBE25

An OsBZR1 gene is selected, and a primer containing a target nucleotide sequence (SEQ ID No.43, PAM gag) which is connected and matched with the end of a BsaI enzyme cutting site is designed as follows: gOsBZR1-F3(SEQ ID No.44, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 43) and gOsBZR1-R3(SEQ ID No. 45). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form a double strand, and cloned into the BsaI cleavage site of pENTR4-sgRNA vector using gOsBZR1-F3/gOsBZR1-R3, and the sequencing results showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsBZR 1-F3. The cloned carrier is linearized by ApaI enzyme digestion and then cloned into pUbi-rBE25 through LR reaction of Gateway to obtain pUbi-rBE25-gOsBZR 1-3.

The procedure for transforming Kitaake japonica rice and the procedure for extracting genomic DNA from callus were the same as in example 2.

And (3) identification: specific PCR primers for identification were designed based on the target site DNA sequence of OsBZR1 gene: OsBZR1-F3(SEQ ID No.46) and OsBZR1-R3(SEQ ID No.47) using the genomic DNA of the corresponding resistant callus as a template and using I-5^TMThe target fragment 415bp is amplified by 2 Xhigh Fidelity Master Mix through PCR, and the PCR product is directly sequenced and detected. Analyzing the sequenced target nucleotide sequence of OsBZR1, wherein the-18 th, -16 th, -15 th and-14 th positions of the target nucleotide sequence contain base C, and detecting 46 rice seedlings shows that the-18 th, -16 th, -15 th and-14 th base C can be mutated into T, and 17 plants are subjected to base C-to-T change. The target site editing efficiency of the pUbi-rBE25 system on OsBZR1 was 36.96%. This suggests that rBE25 recognizes the PAM motif of 5'-gag-3' to effect a cytosine to thymine conversion. One of the editing effects of pUbi-rBE25 at the target site of the OsBZR1 gene is shown in FIG. 5.

Example 4: a > G substitution of target base of rice endogenous gene by pUbi-rBE26

The OsGS1 gene is selected, and primers containing a target nucleotide sequence (SEQ ID No.48, PAM gag) which is connected and matched with the end of the BsaI enzyme cutting site are designed as follows: gOsGS-F2(SEQ ID No.49, BsaI restriction cohesive end gtg introduced at the 5' end of the target nucleotide sequence SEQ ID No. 48) and gOsGS-R2(SEQ ID No. 50). After the primers were synthesized, the primers were phosphorylated using T4 polynucleotide kinase, annealed to form a double strand, and the gOsGS-F2/gOsGS-R2 was cloned into the BsaI cleavage site of pENTR4-sgRNA vector, and the sequencing result showed correct. Wherein the target nucleotide sequence inserted into the BsaI site on pENTR4-sgRNA vector is represented by forward primer gOsGS-F2. The cloned vector is linearized by ApaI enzyme digestion and then cloned into pUbi-rBE26 through LR reaction of Gateway to obtain pUbi-rBE 26-gOsGS-2.

The procedure for transforming Kitaake japonica rice and the procedure for extracting genomic DNA from callus were the same as in example 2.

And (3) identification: specific PCR primers for identification were designed based on the target site DNA sequence of OsGS1 gene: OsGS-P4-F1(SEQ ID No.51) and OsGS-P4-R1(SEQ ID No.52) using the genomic DNA of the corresponding resistant callus as a template and using I-5^TM2 Xhigh Fidelity Master Mix is used for PCR amplification of the target fragment 651bp, and the PCR product is directly subjected to sequencing detection. The target nucleotide sequence of the OsGS1 after sequencing is analyzed, the 15 th site of the target nucleotide sequence contains the base A, and detection of 40 rice seedlings shows that 19 rice seedlings have target base A to G change. The target site editing efficiency of pUbi-rBE26 system on OsGS1 was 47.50%. This suggests that rBE26 recognizes the PAM motif of 5'-gag-3' to effect the conversion of adenine to guanine. The editing effect of pUbi-rBE26 at the target site of OsGS1 gene is shown in FIG. 6.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

<120> a set of gene editing artificial system for rice and application thereof

<130>LHA1960749

<160>52

<170>SIPOSequenceListing 1.0

<210>1

<211>1375

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>1

Met Glu Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val

1 5 10 15

Gly Trp Ala Val Ile Thr Asp Asp Tyr Lys Val Pro Ser Lys Lys Phe

20 25 30

Lys Val Leu Gly Asn Thr Asn Arg Lys Ser Ile Lys Lys Asn Leu Met

35 40 45

Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu

50 55 60

Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Arg

65 70 75 80

Tyr Leu Gln Glu Ile Phe Ala Asn Glu Met Ala Lys Leu Asp Asp Ser

85 90 95

Phe Phe Gln Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys

100 105 110

Asn Glu Arg His Pro Ile Phe Gly Asn Leu Ala Asp Glu Val Ala Tyr

115 120 125

His Arg Asn Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Ala Asp

130 135 140

Ser Pro Glu Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His

145 150 155 160

Ile Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Lys Leu Asn Ala

165 170 175

Glu Asn Ser Asp Val Ala Lys Leu Phe Tyr Gln Leu Ile Gln Thr Tyr

180 185 190

Asn Gln Leu Phe Glu Glu Ser Pro Leu Asp Glu Ile Glu Val Asp Ala

195 200 205

Lys Gly Ile Leu Ser Ala Arg Leu Ser Lys Ser Lys Arg Leu Glu Lys

210 215 220

Leu Ile Ala Val Phe Pro Asn Glu Lys Lys Asn Gly Leu Phe Gly Asn

225 230 235 240

Ile Ile Ala Leu Ala Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe

245 250 255

Asp Leu Thr Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp

260 265 270

Asp Asp Leu Asp Glu Leu Leu Gly Gln Ile Gly Asp Gln Tyr Ala Asp

275 280 285

Leu Phe Ser Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp

290 295 300

Ile Leu Arg Ser Asn Ser Glu Val Thr Lys Ala Pro Leu Ser Ala Ser

305 310 315 320

Met Val Lys Arg Tyr Asp Glu His His Gln Asp Leu Ala Leu Leu Lys

325 330 335

Thr Leu Val Arg Gln Gln Phe Pro Glu Lys Tyr Ala Glu Ile Phe Lys

340 345 350

Asp Asp Thr Lys Asn Gly Tyr Ala Gly Tyr Val Gly Ile Gly Ile Lys

355 360 365

His Arg Lys Arg Thr Thr Lys Leu Ala Thr Gln Glu Glu Phe Tyr Lys

370 375 380

Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Ala Glu Glu Leu Leu

385 390 395 400

Ala Lys Leu Asn Arg Asp Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp

405 410 415

Asn Gly Ser Ile Pro His Gln Ile His Leu Lys Glu Leu His Ala Ile

420 425 430

Leu Arg Arg Gln Glu Glu Phe Tyr Pro Phe Leu Lys Glu Asn Arg Glu

435 440 445

Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro

450 455 460

Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Leu Thr Arg Lys Ser Glu

465 470 475 480

Glu Ala Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala

485 490 495

Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Glu Gln Leu

500 505 510

Pro Asn Lys Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe

515 520 525

Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Arg Met

530 535 540

Arg Lys Pro Glu Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp

545 550 555 560

Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu

565 570 575

Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ile Gly

580 585 590

Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu

595 600 605

Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp

610 615 620

Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu

625 630 635 640

Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys

645 650 655

Val Met Lys Gln Leu Lys Arg Arg His Tyr Thr Gly Trp Gly Arg Leu

660 665 670

Ser Arg Lys Met Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr

675 680 685

Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ser Asn Arg Asn Phe Met

690 695 700

Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu Glu Ile Glu Lys

705 710 715 720

Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu Gln Ile Ala Asp

725 730 735

Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys

740 745 750

Ile Val Asp Glu Leu Val Lys Val Met Gly His Lys Pro Glu Asn Ile

755 760 765

Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Thr Lys Gly Leu Gln

770 775 780

Gln Ser Arg Glu Arg Lys Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu

785 790 795 800

Glu Ser Gln Ile Leu Lys Glu Asn Pro Val Glu Asn Thr Gln Leu Gln

805 810 815

Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr

820 825 830

Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp

835 840 845

His Ile Val Pro Gln Ser Phe Ile Lys Asp Asp Ser Ile Asp Asn Lys

850 855 860

Val Leu Thr Arg Ser Val Glu Asn Arg Gly Lys Ser Asp Asn Val Pro

865 870 875 880

Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu

885 890 895

Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala

900 905 910

Glu Arg Gly Gly Leu Ser Glu Ala Asp Lys Ala Gly Phe Ile Lys Arg

915 920 925

Gln Leu Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Arg Ile Leu

930 935 940

Asp Ser Arg Met Asn Thr Lys Arg Asp Lys Asn Asp Lys Pro Ile Arg

945 950 955 960

Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg

965 970 975

Lys Asp Phe Gln Leu Tyr Lys Val Arg Asp Ile Asn Asn Tyr His His

980 985 990

Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys

995 1000 1005

Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val

1010 1015 1020

Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys

1025 1030 1035 1040

Ala Thr Ala Lys Arg Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys

1045 1050 1055

Thr Glu Val Lys Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile

1060 1065 1070

Glu Thr Asn Gly Glu Thr Gly Glu Val Val Trp Asn Lys Glu Lys Asp

1075 1080 1085

Phe Ala Thr Val Arg Lys Val Leu Ala Met Pro Gln Val Asn Ile Val

1090 1095 1100

Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu

1105 1110 1115 1120

Ser Lys Arg Glu Ser Ala Lys Leu Ile Pro Arg Lys Lys Gly Trp Asp

1125 1130 1135

Thr Arg Lys Tyr Gly Gly Phe Gly Ser Pro Thr Val Ala Tyr Ser Ile

1140 1145 1150

Leu Val Val Ala Lys Val Glu Lys Gly Lys Ala Lys Lys Leu Lys Ser

1155 1160 1165

Val Lys Val Leu Val Gly Ile Thr Ile Met Glu Lys Gly Ser Tyr Glu

1170 1175 1180

Lys Asp Pro Ile Gly Phe Leu Glu Ala Lys Gly Tyr Lys Asp Ile Lys

1185 1190 1195 1200

Lys Glu Leu Ile Phe Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu

1205 1210 1215

Asn GlyArg Arg Arg Met Leu Ala Ser Ala Thr Glu Leu Gln Lys Ala

1220 1225 1230

Asn Glu Leu Val Leu Pro Gln His Leu Val Arg Leu Leu Tyr Tyr Thr

1235 1240 1245

Gln Asn Ile Ser Ala Thr Thr Gly Ser Asn Asn Leu Gly Tyr Ile Glu

1250 1255 1260

Gln His Arg Glu Glu Phe Lys Glu Ile Phe Glu Lys Ile Ile Asp Phe

1265 1270 1275 1280

Ser Glu Lys Tyr Ile Leu Lys Asn Lys Val Asn Ser Asn Leu Lys Ser

1285 1290 1295

Ser Phe Asp Glu Gln Phe Ala Val Ser Asp Ser Ile Leu Leu Ser Asn

1300 1305 1310

Ser Phe Val Ser Leu Leu Lys Tyr Thr Ser Phe Gly Ala Ser Gly Gly

1315 1320 1325

Phe Thr Phe Leu Asp Leu Asp Val Lys Gln Gly Arg Leu Arg Tyr Gln

1330 1335 1340

Thr Val Thr Glu Val Leu Asp Ala Thr Leu Ile Tyr Gln Ser Ile Thr

1345 1350 1355 1360

Gly Leu Tyr Glu Thr Arg Thr Asp Leu Ser Gln Leu Gly Gly Asp

1365 1370 1375

<210>2

<211>10

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>2

Arg Pro Lys Lys Lys Arg Lys Val Gly Gly

1 5 10

<210>3

<211>211

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>3

Met Asp Ser Leu Leu Met Asn Arg Arg Glu Phe Leu Tyr Gln Phe Lys

1 5 10 15

Asn Val Arg Trp Ala Lys Gly Arg Arg Glu Thr Tyr Leu Cys Tyr Val

20 25 30

Val Lys Arg Arg Asp Ser Ala Thr Ser Phe Ser Leu Asp Phe Gly Tyr

35 40 45

Leu Arg Asn Lys Asn Gly Cys His Val Glu Leu Leu Phe Leu Arg Tyr

50 55 60

Ile Ser Asp Trp Asp Leu Asp Pro Gly Arg Cys Tyr Arg Val Thr Trp

65 70 75 80

Phe Ile Ser Trp Ser Pro Cys Tyr Asp Cys Ala Arg His Val Ala Asp

85 90 95

Phe Leu Arg Gly Asn Pro Asn Leu Ser LeuArg Ile Phe Thr Ala Arg

100 105 110

Leu Tyr Phe Cys Glu Asp Arg Lys Ala Glu Pro Glu Gly Leu Arg Arg

115 120 125

Leu His Arg Ala Gly Val Gln Ile Ala Ile Met Thr Phe Lys Asp Tyr

130 135 140

Phe Tyr Cys Trp Asn Thr Phe Val Glu Asn His Gly Arg Thr Phe Lys

145 150 155 160

Ala Trp Glu Gly Leu His Glu Asn Ser Val Arg Leu Ser Arg Gln Leu

165 170 175

Arg Arg Ile Leu Leu Pro Leu Tyr Glu Val Asp Asp Leu Arg Asp Ala

180 185 190

Phe Arg Thr Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr

195 200 205

Pro Glu Ser

210

<210>4

<211>91

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>4

Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly

1 5 10 15

Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val

20 25 30

Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr

35 40 45

Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp

50 55 60

Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly

65 70 75 80

Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser

85 90

<210>5

<211>397

<212>PRT

<213> Artificial sequence (Artificial sequence)

<400>5

Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu

1 5 10 15

Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala

20 25 30

Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro

35 40 45

Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg

50 55 60

Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu

65 70 75 80

Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His

85 90 95

Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly

100 105 110

Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His

115 120 125

Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu

130 135 140

Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys

145 150 155 160

Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser

165 170 175

Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser

180 185 190

Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr

195 200 205

Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg

210 215 220

Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly

225 230 235 240

Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala

245 250 255

Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg

260 265 270

Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys

275 280 285

Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val

290 295 300

Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His

305 310 315 320

Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala

325 330 335

Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln

340 345 350

Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly

355 360 365

Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser

370 375 380

Ala ThrPro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser

385 390 395

<210>6

<211>4125

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

atggaaaaga aatactcaat cggcctcgat attggaacca attcggttgg gtgggcagtc 60

ataaccgatg actataaagt tccgagcaaa aaatttaagg tccttggtaa taccaacagg 120

aaaagcataa aaaagaatct gatgggtgct ttgctgttcg attcaggtga gacagccgag 180

gctacccggc ttaagcggac cgctcgcaga aggtacaccc ggagaaaaaa tcgcatccgc 240

tatctccagg aaattttcgc gaatgaaatg gcaaagttgg acgatagttt cttccagagg 300

ctggaagaat ccttccttgt cgaagaagat aagaaaaacg agagacaccc tatcttcgga 360

aacctggcag acgaagtggc gtaccataga aactacccta cgatttatca tctcaggaaa 420

aagctggcag attcaccgga gaaagccgac ctcaggttga tatacttggc actcgcgcac 480

attattaaat ttagaggtca cttccttatc gaagggaaac tgaatgcaga aaactcggat 540

gttgctaaac ttttttatca gttgatacaa acttacaatc agctgtttga agaatcccct 600

ttggacgaaa tcgaggttga tgctaagggc attctttctg ctaggttgtc aaagagcaaa 660

aggctcgaaa agctcattgc tgtctttccc aacgaaaaga agaatggact ttttgggaac 720

attatagctc ttgccctcgg cctgactcca aacttcaaaa gcaactttga tttgactgag 780

gacgccaaac tccaattgtc aaaggatact tacgatgacg acctggacga actcttgggt 840

cagatcgggg atcaatacgc ggatcttttc agtgctgcaa agaatctctc cgacgctatt 900

cttctttcag acatcctgcg ctcaaatagt gaggtcacta aggctccgtt gtccgcgtcg 960

atggttaaac ggtatgatga acatcaccag gacctcgcgc ttctgaaaac actcgtccgg 1020

caacagttcc ctgaaaagta tgcagaaata ttcaaagacg acacaaaaaa tggttacgct 1080

gggtacgtcg ggattggcat caagcataga aaacggacta ctaaacttgc tacccaagag 1140

gagttctaca agtttattaa gccaatcctg gaaaaaatgg atggcgcgga agaactcctt 1200

gccaagttga atagggatga cctcctccgg aagcaacgca cttttgacaa cggctctatc 1260

ccgcatcaga ttcacttgaa agagttgcac gcaatactcc gccgccaaga ggaattttac 1320

ccatttctca aggagaacag ggagaaaata gagaaaatct tgacgttcag gattccttac 1380

tatgtggggc ctcttgctcg gggtaattct cgctttgcct ggttgacaag aaaatctgaa 1440

gaagctatca ccccgtggaa tttcgaagaa gtcgttgata aaggcgccag cgctcaatct 1500

ttcattgagc ggatgacaaa cttcgacgag cagttgccga ataaaaaggt tctgccaaag 1560

cactcactgc tttatgagta ttttaccgtc tacaacgagt tgacgaaggt caaatacgtg 1620

actgagagga tgcggaaacc tgagtttttg tctggtgagc agaagaaagc cattgttgac 1680

cttcttttca agaccaaccg gaaggtgact gttaagcaac tcaaggaaga ttatttcaag 1740

aaaattgaat gcttcgactc cgttgagata ataggtgttg aggaccgctt caatgcgtca 1800

ctcggaacct atcacgactt gctcaaaata atcaaggaca aagactttct tgataacgaa 1860

gaaaatgaag acatattgga ggatatagtg ctcaccctta cattgttcga ggacagagaa 1920

atgatcgagg agcggcttaa gacctacgcg catctgttcg atgataaggt tatgaagcag 1980

ctgaagagga gacattacac gggttggggc cggctttcca ggaagatgat taacggtatc 2040

cgggataaac agtcaggaaa aactatactg gactttttga aatcagacgg tttctcaaac 2100

agaaacttca tgcaattgat tcatgacgat agtcttactt ttaaagagga aatcgagaag 2160

gcgcaagtga gcggacaagg agactcgctg cacgagcaaa tcgccgacct ggctgggtcg 2220

ccggctataa agaagggtat attgcagacc gtcaaaatcg tggacgagct ggtgaaggtt 2280

atggggcaca aacctgaaaa tattgttatt gagatggcta gggagaatca gactactacg 2340

aagggattgc aacagtctcg cgagcgcaag aaaaggatcg aggaaggtat taaggaactt 2400

gaatcccaga tactcaagga gaatcccgtc gagaacacac aacttcagaa cgaaaaactc 2460

tatctttact atcttcaaaa tggcagagat atgtatgtgg accaagagct ggatattaat 2520

aggctctctg attacgatgt tgaccatatc gtgccgcagt catttattaa agatgactct 2580

attgataaca aggtcctcac tcgctccgtc gaaaatcgcg gtaaatcaga caatgtcccc 2640

tcggaggaag tcgtgaagaa aatgaagaac tactggaggc agctgcttaa cgcaaagttg 2700

attactcagc gcaagtttga caacttgaca aaggccgaga ggggaggact ctctgaggcg 2760

gacaaggcag gtttcatcaa gcgccaactc gtcgagacac ggcagataac caaacacgtc 2820

gcaaggatat tggatagcag aatgaacaca aagagagata agaacgacaa accaatacgc 2880

gaagtgaaag tcatcacatt gaagtccaaa ttggttagtg atttccgcaa ggacttccaa 2940

ctgtacaaag tgagagacat caacaactac catcatgctc acgatgcata tctgaatgct 3000

gtcgtcggca cagctcttat aaagaaatac ccgaaactcg aatcggagtt cgtttatggg 3060

gattataagg tttatgacgt taggaagatg attgccaagt cagaacaaga aatcgggaag 3120

gctacagcga aacgcttttt ttattcgaac ataatgaatt tctttaaaac ggaggtcaaa 3180

cttgcgaacg gggaaatccg gaaacgcccg cttatcgaga caaatggaga aacaggtgaa 3240

gtcgtgtgga ataaagaaaa ggacttcgcc accgttcgga aagttctcgc catgccgcag 3300

gtcaacattg tcaagaaaac ggaggtccaa accgggggct tctccaagga atccattctc 3360

tcaaagaggg agagtgcaaa gctcatacct aggaagaagg gttgggacac acgcaaatac 3420

ggcgggtttg gcagtcccac ggtggcatac tctatccttg tggtcgccaa agtcgaaaag 3480

ggcaaggcga aaaaattgaa gagcgttaaa gtgcttgtcg ggatcaccat aatggagaag 3540

ggctcctacg agaaggaccc tatcgggttc ttggaagcga agggttataa agacattaag 3600

aaagagctga tcttcaaatt gccgaaatac agcctgttcg aactggagaa cggcaggcgg 3660

cgcatgttgg cgagtgccac cgagcttcag aaggctaatg agcttgtttt gccgcagcat 3720

ctcgtccgcc tcctctatta tacgcaaaat attagtgcta ctactgggtc aaataacctc 3780

ggatatattg aacaacatag ggaggagttt aaggagatat ttgagaaaat catagacttc 3840

tctgaaaagt atatactgaa aaataaggtg aactccaatc tcaagtcttc ctttgacgaa 3900

cagtttgctg tgtcggactc catacttctc agcaattctt tcgtttccct gttgaaatat 3960

acgtcatttg gcgcttccgg gggatttacc tttcttgatc ttgacgttaa acagggtagg 4020

ctcagatacc agactgtcac ggaagtgctc gatgccactc ttatatacca atcaattacg 4080

ggcctgtacg aaacgcggac agatttgtcccagctcggcg gcgac 4125

<210>7

<211>33

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

cggccaaaga agaagcggaa agtcggaggc tga 33

<210>8

<211>633

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

atggatagcc ttctcatgaa cagaagagag tttctctatc agtttaaaaa tgttcggtgg 60

gcgaagggga ggagagagac atatctctgc tatgttgtta agcggagaga ttctgcgacc 120

tcattctcac tcgattttgg ttatttgagg aacaagaatg gatgtcatgt cgaattgttg 180

tttctccggt atatttccga ctgggatttg gacccagggc ggtgttaccg ggtcacatgg 240

tttatttcct ggagtccatg ttacgactgt gcgcgccatg tcgccgactt cctcaggggt 300

aatcctaact tgtccttgcg gatttttaca gccagactct atttctgtga ggatcggaag 360

gcggaacccg aggggctgag aagactgcac cgcgctggcg tccaaatcgc catcatgact 420

tttaaggatt atttctactg ttggaacacg ttcgtcgaga accacggtcg gaccttcaaa 480

gcctgggaag ggctgcatga aaattccgtg aggttgtccc ggcaactccg cagaatactc 540

ctgccccttt atgaggtcga cgatctcaga gacgccttta gaactagcgg aagcgagacg 600

ccagggactt ctgaatcggc cacccccgag agc 633

<210>9

<211>273

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

tccggcggaa gtacaaacct ttcagacatt atagaaaagg aaaccggcaa gcaactcgtc 60

atccaggaat ccatacttat gctccctgaa gaggtggaag aagtgatcgg taataaacca 120

gagagcgaca tacttgtcca caccgcttat gacgaaagta cagacgaaaa cgtcatgctt 180

ctgacgagtg atgcccccga atacaaacct tgggcgctcg tcatccagga ttccaatggg 240

gagaataaaa taaagatgct ctctggaggc agc 273

<210>10

<211>1191

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

atgtccgaag tggaatttag ccatgaatat tggatgcggc acgccctcac gcttgccaag 60

agagcctggg atgagaggga ggttcccgtc ggtgccgtgt tggtccataa caacagggtg 120

attggggaag gatggaacag acccattggg cgccatgatc caactgccca tgcagagatt 180

atggcgctca ggcaaggggg gttggttatg caaaactacc ggcttattga cgcaaccctg 240

tatgtcaccc ttgaaccctg tgttatgtgc gcgggggcca tgatacactc tcggataggg 300

cgggtggtgt tcggggctcg ggatgctaag accggagctg ctggttccct catggatgtc 360

ttgcatcatc ctggtatgaa ccatagagtc gagattactg aaggcattct cgcagacgaa 420

tgcgctgccc ttctctcaga tttctttaga atgcgcagac aggaaataaa ggctcaaaaa 480

aaagcacaga gttccacgga ttccggcggg tcgagcggtg gcagctccgg ctccgagaca 540

cccggtacga gtgaatccgc tacgcccgaa tcctcggggg gaagctctgg aggctcatca 600

gaagtcgagt tctcccatga gtattggatg aggcacgccc tcactcttgc gaagagggcc 660

agggacgaga gggaggtgcc ggtcggtgct gtcctggtct tgaataacag ggtgataggc 720

gaaggttgga acagggctat tggccttcat gaccctactg ctcatgcgga aatcatggca 780

cttagacagg ggggcctcgt tatgcaaaat taccgcctga tcgacgccac tctttatgtc 840

acatttgaac catgtgttat gtgtgcgggc gctatgatcc attcacgcat aggtcgcgtg 900

gtttttggag ttcgcaacgc gaaaacaggg gctgcaggct ctctgatgga cgttttgcac 960

tatccgggaa tgaaccatag agtcgaaatc acagaaggga ttttggcaga cgaatgcgcg 1020

gctcttcttt gttatttttt cagaatgccc cgccaagtgt ttaatgctca aaagaaagcg 1080

cagagtagca cagactcggg gggatcttct gggggctcgt ctggttccga gactcccgga 1140

acttccgagt cggcaacacc tgaatcctcc ggcggctctt cgggcggatc t 1191

<210>11

<211>76

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgc 76

<210>12

<211>1765

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

gcagcgtgac ccggtcgtgc ccctctctag agataatgag cattgcatgt ctaagttata 60

aaaaattacc acatattttt tttgtcacac ttgtttgaag tgcagtttat ctatctttat 120

acatatattt aaactttact ctacgaataa tataatctat agtactacaa taatatcagt 180

gttttagaga atcatataaa tgaacagtta gacatggtct aaaggacaat tgagtatttt 240

gacaacagga ctctacagtt ttatcttttt agtgtgcatg tgttctcctt tttttttgca 300

aatagcttca cctatataat acttcatcca ttttattagt acatccattt agggtttagg 360

gttaatggtt tttatagact aattttttta gtacatctat tttattctat tttagcctct 420

aaattaagaa aactaaaact ctattttagt ttttttattt aataatttag atataaaata 480

gaataaaata aagtgactaa aaattaaaca aatacccttt aagaaattaa aaaaactaag 540

gaaacatttt tcttgtttcg agtagataat gccagcctgt taaacgccgt cgacgagtct 600

aacggacacc aaccagcgaa ccagcagcgt cgcgtcgggc caagcgaagc agacggcacg 660

gcatctctgt cgctgcctct ggacccctct cgagagttcc gctccaccgt tggacttgct 720

ccgctgtcgg catccagaaa ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc 780

ggcctcctcc tcctctcacg gcacggcagc tacgggggat tcctttccca ccgctccttc 840

gctttccctt cctcgcccgc cgtaataaat agacaccccc tccacaccct ctttccccaa 900

cctcgtgttg ttcggagcgc acacacacac aaccagatct cccccaaatc cacccgtcgg 960

cacctccgct tcaaggtacg ccgctcgtcc tccccccccc cccctctcta ccttctctag 1020

atcggcgttc cggtccatgg ttagggcccg gtagttctac ttctgttcat gtttgtgtta 1080

gatccgtgtt tgtgttagat ccgtgctgct agcgttcgta cacggatgcg acctgtacgt 1140

cagacacgtt ctgattgcta acttgccagt gtttctcttt ggggaatcct gggatggctc 1200

tagccgttcc gcagacggga tcgatttcat gatttttttt gtttcgttgc atagggtttg 1260

gtttgccctt ttcctttatt tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc 1320

atgctttttt tttgtcttgg ttgtgatgat gtggtgtggt tgggcggtcg ttcattcgtt 1380

ctagatcgga gtagaatact gtttcaaact acctggtgta tttattaatt ttggaactgt 1440

atgtgtgtgt catacatctt catagttacg agtttaagat ggatggaaat atcgatctag 1500

gataggtata catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca 1560

tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt atgttttata 1620

attattttga tcttgatata cttggatgat ggcatatgca gcagctatat gtggattttt 1680

ttagccctgc cttcatacgc tatttatttg cttggtactg tttcttttgt cgatgctcac 1740

cctgttgttt ggtgttactt ctgca 1765

<210>13

<211>253

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210>14

<211>23

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>14

tccggcggaa gtacaaacct ttc 23

<210>15

<211>34

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

agcaagtccg attgaatact ttttctcgct ctcg 34

<210>16

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>16

attggaacca attcggttgg g 21

<210>17

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>17

gtcgccgccg agctggga 18

<210>18

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>18

gcgcgcttgg cgtaatca 18

<210>19

<211>33

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>19

agccagacca attgagtatt ttttctcaga tcc 33

<210>20

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>20

ctagttcagc ctccgacttt c 21

<210>21

<211>253

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>21

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210>22

<211>41

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>22

tgttggctag gatccatcgc agtcagcgat gagtacagca a 41

<210>23

<211>8

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>23

tttttttt 8

<210>24

<211>25

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>24

tgtgtagaga ccaaaggagg tctca 25

<210>25

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>25

tgggcaacta ctactcgtg 19

<210>26

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>26

gtgtgtgggc aactactact cgtg 24

<210>27

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>27

aaaccacgag tagtagttgc ccac 24

<210>28

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>28

tgtgacttcg gccttgctc 19

<210>29

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>29

gtgtgtgtga cttcggcctt gctc 24

<210>30

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>30

aaacgagcaa ggccgaagtc acac 24

<210>31

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>31

gatccaaagg accgtccaa 19

<210>32

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>32

gtgtggatcc aaaggaccgt ccaa 24

<210>33

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>33

aaacttggac ggtcctttgg atcc 24

<210>34

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>34

ggcaactact actcgtgcg 19

<210>35

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>35

gtgtgggcaa ctactactcg tgcg 24

<210>36

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>36

aaaccgcacg agtagtagtt gccc 24

<210>37

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>37

ctccgcttga cggaaggaaa 20

<210>38

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>38

acgatgtgca cgtacaggtt 20

<210>39

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>39

cgagcaccac cagttcttcc t 21

<210>40

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>40

ccatcttgtt gccacgtaat cc 22

<210>41

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>41

gggaggagac ttcagtgacc c 21

<210>42

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>42

gattggctgg catgatggtt c 21

<210>43

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>43

gcacccggac acgataccg 19

<210>44

<211>23

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>44

gtgtgcaccc ggacacgata ccg 23

<210>45

<211>23

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>45

aaaccggtat cgtgtccggg tgc 23

<210>46

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>46

tgcctcctcc cgttcctc 18

<210>47

<211>18

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>47

gcgtcaccct ccccttgt 18

<210>48

<211>19

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>48

gctcacacca actacaggt 19

<210>49

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>49

gtgtggctca caccaactac aggt 24

<210>50

<211>24

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>50

aaacacctgt agttggtgtg agcc 24

<210>51

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>51

tggtatcggt gctgacaagt 20

<210>52

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>52

tgagcttctc aatggcggac 20

Claims (10)

1. A set of gene editing artificial systems, said artificial systems comprising:

an I regulatory element comprising a nucleotide sequence capable of encoding a protein of amino acid sequence I; wherein the amino acid sequence I is selected from one of the following 1) to 3):

1) the amino acid sequence shown as SEQ ID No.1 and the amino acid sequence shown as SEQ ID No. 2;

2) the amino acid sequences of SEQ ID No.3, SEQ ID No.1, SEQ ID No.4 and SEQ ID No.2 are shown in sequence from the N end to the C end; wherein, the first mutant amino acid sequence of SEQ ID No.1 is obtained by mutating the 10 th amino acid in the SEQ ID No.1 from aspartic acid to alanine, and other amino acid sequences are unchanged;

3) the second mutant amino acid sequence of SEQ ID No.5, SEQ ID No.1 and the amino acid sequence shown in SEQ ID No.2 are shown in sequence from the N end to the C end; wherein the second mutant amino acid sequence of SEQ ID No.1 is identical to the first mutant amino acid sequence of SEQ ID No. 1;

a II regulatory element comprising a II-1 nucleotide sequence and a II-2 nucleotide sequence in this order from the 5 'end to the 3' end; the II-1 nucleotide sequence comprises a target nucleotide sequence; the II-2 nucleotide sequence comprises a sgRNA nucleic acid sequence; said II-1 nucleotide sequence and said II-2 nucleotide sequence being transcriptionally fused, the product of which is capable of directing the protein encoded by the I regulatory element to a target site to be mutated in the genome of at least one of the gramineae plants, and

when the amino acid sequence I is 1), the genome of the gramineous plant is cut at the target site and an insertion or deletion mutation occurs upon gene editing;

a C-mutant T at the target site in the genome of the gramineae upon gene editing when the amino acid sequence I is 2);

an A mutation G at the target site in the genome of the gramineous plant upon gene editing when the amino acid sequence I is 3);

when the II th regulatory element is plural, the plural II-1 th nucleotide sequences contained therein are different two by two.

2. The artificial system according to claim 1, wherein the nucleotide sequence of the regulatory element I is a nucleotide sequence which is suitable for expression in the grass family, and the nucleotide sequence of the regulatory element II is a nucleotide sequence which is suitable for transcription to occur in the grass family;

preferably, the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.1 is shown as SEQ ID No. 6; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.2 is shown as SEQ ID No. 7; the nucleotide coding sequence capable of coding the first mutant amino acid sequence as shown in SEQ ID No.1 differs from the nucleotide sequence shown in SEQ ID No.6 in that adenine at position 29 of the nucleotide sequence shown in SEQ ID No.6 is replaced with cytosine; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.3 is shown as SEQ ID No. 8; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.4 is shown as SEQ ID No. 9; the nucleotide coding sequence capable of coding the amino acid sequence shown as SEQ ID No.5 is shown as SEQ ID No. 10;

preferably, the II-2 nucleotide sequence is shown in SEQ ID No. 11.

3. The artificial system according to claim 1, wherein the II-1 nucleotide sequence comprises a cleavage site of a type IIS restriction enzyme, and the target nucleotide sequence can be cloned through the cleavage site of the type IIS restriction enzyme to transcriptionally fuse the II-1 nucleotide sequence with the II-2 sequence;

when the number of the second regulatory element is plural, the restriction sites of the type IIS restriction enzymes for cloning different target nucleotide sequences are different two by two.

4. An artificial system according to claim 1, characterized in that the target nucleotide sequence is determined by:

1) determining a nucleotide sequence to be modified on the genome of said graminaceous plant;

2) judging that the nucleotide sequence to be modified determined in the step 1) is a specific sequence in the genome,

judging whether the change caused by the mutation of the base of the nucleotide site to be mutated is in accordance with the expectation according to the I-th regulating element; or judging whether the change caused by the mutation of the reverse complementary base of the nucleotide site to be mutated is in accordance with the expected result according to the I-th regulating element;

for the prospective, the nucleotide site to be mutated is a potential target site;

3) screening for a target sequence in the nucleotide sequence to be engineered or its reverse complement: searching in the direction of the 3' end of the potential target site to confirm the presence of a recognition motif that can be recognized by the amino acid sequence encoded by said regulatory element I, and

when the amino acid sequence I is 1), the target site is at a position-3 to-5 upstream of the 5 'end of the recognition module, and the thus determined 17 to 21 nucleotide sequences upstream of the 5' end of the recognition module are the target nucleotide sequence;

when the amino acid sequence I is 2), the target site is at a position-19 to-11 upstream of the 5 'end of the recognition module, and the nucleotide sequence 17 to 21 upstream of the 5' end of the recognition module thus determined is the target nucleotide sequence;

when the amino acid sequence I is 3), the target site is at a position-19 to-13 upstream of the 5 'end of the recognition module, and the nucleotide sequence 17 to 21 upstream of the 5' end of the recognition module thus determined is the target nucleotide sequence.

5. A manual system according to claim 4,

the recognition module sequence of the protein coded by the I regulatory element is 5' -N₁N₂G-3', the target nucleotide sequence is a nucleotide sequence of 17 to 21 nucleotides at the upstream of the 5' end of the identification module sequence, and the nucleotide sequence containing five continuous T is eliminated;

wherein, the N is₁And N₂Independently one of A, G, C and T.

6. An artificial system according to any one of claims 1-5, further comprising a first promoter at the 5' end of the I regulatory element, which promoter is useful in plants of the Gramineae family and is capable of promoting transcription of the I regulatory element; and/or said artificial system further comprises a second promoter at the 5' end of said second regulatory element capable of being used in said gramineae and capable of promoting transcription of said second regulatory element;

preferably, the first promoter is an RNA polymerase type II promoter; and/or the second promoter is an RNA polymerase type III promoter;

more preferably, the first promoter is a Ubip promoter; and/or the second promoter is the U6 promoter;

said artificial system further comprising a first terminator at the 3' end of said I regulatory element, which is capable of being used in said gramineae and of terminating the transcription of said I regulatory element; and/or said artificial system further comprises a second terminator at the 3' end of said second regulatory element, which terminator is capable of being used in said gramineae and of terminating the transcription of said second regulatory element;

preferably, the first terminator is a NOS terminator; and/or the second terminator is a (T)8 terminator.

7. An artificial system according to any of claims 1-6, wherein the I regulatory element and the II regulatory element are capable of being cloned into at least one vector;

preferably, the regulatory element I can be cloned into pCAMBIA1300 and the regulatory element II into the entry vector pENTR 4;

preferably, the first promoter, regulatory element I and first terminator can be cloned into the pCAMBIA1300 vector;

preferably, the second promoter, the second regulatory element, and the second terminator can be cloned into pENTR4 vector.

8. A manual system according to any of claims 1-7, characterised in that the I and II regulatory elements can be integrated on the same vector or distributed over several vectors for use together.

9. Use of an artificial system according to any one of claims 1-8 for one of knocking out an endogenous gene in the genome of at least one of the graminaceous plants, site-directed mutating a C to a T in the genome of at least one of the graminaceous plants, or site-directed mutating an a to a G in the genome of at least one of the graminaceous plants; preferably, the gramineous plant is rice.

10. A method of knocking out an endogenous gene in the genome of at least one of gramineae, site-directed mutating C to T, or site-directed mutating a to G in the genome of at least one of gramineae, comprising the steps of:

A) introducing the artificial system of any one of claims 1 to 8 into callus of the gramineous plant or protoplast of the gramineous plant by one of Agrobacterium-mediated, particle gun bombardment or PEG-mediated transformation methods, and culturing to obtain a plant of the gramineous plant;

B) screening to obtain a plant of the gramineae plant containing gene knockout mutation or site-directed mutation;

when the amino acid sequence I is 1), the genome of the gramineous plant is cut at the target site and an insertion or deletion mutation occurs upon gene editing;

a C-mutant T at the target site in the genome of the gramineae upon gene editing when the amino acid sequence I is 2);

an A mutation G at the target site in the genome of the gramineous plant upon gene editing when the amino acid sequence I is 3);

preferably, the plant of the gramineae is capable of producing seeds of gramineae containing a knockout mutation or a site-directed substitution of a base;

preferably, the gramineous plant is rice.

Images