CN106591335A - Codon vegetalization-transformed LbCpf1 gene and application thereof - Google Patents
Codon vegetalization-transformed LbCpf1 gene and application thereof Download PDFInfo
- Publication number
- CN106591335A CN106591335A CN201610979713.6A CN201610979713A CN106591335A CN 106591335 A CN106591335 A CN 106591335A CN 201610979713 A CN201610979713 A CN 201610979713A CN 106591335 A CN106591335 A CN 106591335A
- Authority
- CN
- China
- Prior art keywords
- lbcpf1
- codon
- genes
- vegetalization
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention provides a codon vegetalization-transformed LbCpf1 gene and application thereof, the codon vegetalization-transformed LbCpf1 gene is designed and synthesized by utilizing optimized rice codon. Furthermore, the invention provides an expression cassette and an expression carrier, as well as application of the expression cassette and the expression carrier on aspect of rice gene editing. A plant expression carrier is constructed by utilizing the transformed LbCpf1 gene, further a rice targeting carrier is constructed, and the rice targeting carrier is introduced into rice cells to cause DNA Double chain shearing of a rice specific genetic locus. The codon vegetalization-transformed LbCpf1 gene is suitable for rice genome shearing, so that rice gene targeting can be realized.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to a kind of password
The sub application through the LbCpf1 genes of vegetalization transformation in terms of paddy gene target practice.
Background technology
CRISPR- nucleic acid zymotechnics are a kind of eucaryote specific site gene editing technologies for developing in recent years.Should
What the nuclease involved by technology had now been found that mainly has two kinds：Cas9 nucleases and Cpf1 nucleases.CRISPR-Cas9 technologies
From 2012 find since, because its is simple to operate, efficient, be widely used in the animals such as zebra fish, mouse, rat and
In the gene editing of the plants such as arabidopsis, tobacco, sweet orange, corn, paddy rice.CRISPR-Cpf1 is to find for nearly 2 years, and
It is successfully applied to the gene editing of the animals such as rat.CRISPR-Cpf1 has the advantage that compared to CRISPR-Cas9：1、Cpf1
Not only can cutting DNA, can also cut RNA；What the 2nd, Cpf1 can be independent is processed to form maturation to pre-crRNA
crRNA；3rd, form cohesive end after Cpf1 Protein cleavages DNA double chain, be more beneficial for a certain extent replace generation or
Cause disappearance or the insertion of large fragment；4th, to provide more sites for gene editing selective for Cpf1.
But the LbCpf1 for currently using is separated from prokaryotes Escherichia coli, and prokaryotes and eucaryon life
There is different codon preference and base composition in thing.Monocotyledon for example with paddy rice as representative, its G/C content is high, more carefully
The species such as bacterium and dicotyledon, codon preference is strong.Therefore directly using the LbCpf1 designed without artificial optimization, can shadow
Its expression efficiency in eukaryotic is rung, so as to affect its cutting efficiency to DNA double chain.Further, since LbCpf1 from
In Escherichia coli, transformation receptor genome may be adversely affected, it is also possible to cause the worry to its security.
The content of the invention
For the problems referred to above, it is within the contemplation of the invention that carrying out codon vegetalization transformation to LbCpf1.It is contemplated that will
LbCpf1 gene pairs codon is transformed through vegetalization, and is incorporated in expression vector, and corresponding target practice is built on this basis
Carrier, is then realized to paddy rice specific gene editor by rice transformation.
Specifically, in the first aspect, the present invention provides a kind of LbCpf1 genes of codon vegetalization transformation, name
For plant LbCpf1, the LbCpf1 genes are including at least the nucleotide sequence as shown in SEQ ID NO.1 in sequence table.
Preferably, the gene is by SEQ ID NO:Nucleotide sequence shown in 1 is constituted.The sequence is crop paddy rice in mode
Based on codon transformation obtain, i.e., maintain encoding amino acid sequence it is constant on the premise of, using inventor from paddy rice
The codon filtered out in gene-correlation codon replaces original codon, obtains the plant LbCpf1 sequences of vegetalization transformation
Row, then be chemically synthesized.Shear efficiency can be significantly improved using the gene of the present invention.
In second aspect, the present invention provides a kind of plant expression vector containing the plant LbCpf1 genes.Should
The construction method of plant expression vector be using NotI/SacI restriction enzyme sites, with NotI/SacI digestion pHUN600 carriers and time
Receive, because the plant LbCpf1 sequences two ends for synthesizing are added with NotI/SacI restriction enzyme sites, it is possible to use T4 ligases will
PlantLbCpf1 is connected to pHUN600 carriers, obtains plant expression vector pHUN-plant LbCpf1 (pHUN 611).
On the other hand, it is experimental to be actually needed on the basis of expression vector, build corresponding gene targeting and carry
Body.
On the other hand, the present invention provides a kind of expression cassette, it is characterised in that above-mentioned LbCpf1 is included in the expression cassette
Gene.
On the other hand, the present invention provides the application of a kind of said gene, expression cassette or carrier, it is characterised in that described to answer
The shearing of DNA double chain in paddy rice body is completed with the LbCpf1 genes for including being transformed using the codon vegetalization, and at itself
In the presence of repair system, the genetically modified plants with mutational site or plant part are obtained.
In yet another aspect, the present invention provides a kind of using pHUN-plantLbCpf1 (pHUN 611) expression vector (its
LbCpf1 genes containing codon vegetalization transformation), simply annealing, enzyme need to be only carried out on the basis of expression vector
The targeting vector (pHUN 611-BEL) of specific gene is obtained by cutting connection function, by the side of targeting vector Introduced into Rice cell
Method, comprises the steps：
(1) rice paddy seed is shelled, sterilize after embryo is separated, be placed on callus inducing medium with produce time
Level callus；
(2) secondary callus is transferred to into new callus inducing medium preculture；
(3) by the callus obtained in step (2) and the targeting vector (pHUN 611-BEL) for carrying plantLbCpf1
Agrobacterium contact 15 minutes；
(4) callus of step (3) is transferred to into upper three aseptic filter papers of upper pad (adds 2.5-3.5mL Agrobacteriums to hang
Floating culture medium) culture dish in, 21-23 DEG C cultivate 48 hours；
(5) callus of step (4) is placed on front screening and culturing medium and is cultivated 5-7 days；
(6) callus of step (5) is shifted on screening and culturing medium, to obtain resistant calli；
(7) resistant calli is transferred to into seedling differentiation in differentiation and regeneration culture medium；With
(8) seedling of step (7) is transferred in root media and is taken root.
Seed in wherein described step (1) is mature seed；Inducing culture in the step (1), (2) is explanation
Inducing culture listed by book table 1；Contacting with Agrobacterium in the step (3) is that callus is immersed in into the agriculture bar
In bacterium suspension；Agrobacterium suspension medium in the step (4) is the suspension medium listed by specification table 1；It is described
Front screening and culturing medium in step (5) is the front screening and culturing medium listed by specification table 1；Screening training in the step (6)
Foster base is the screening and culturing medium listed by specification table 1；Differentiation and regeneration culture medium in the step (7) is the institute of specification table 1
The differentiation and regeneration culture medium listed；Root media in the step (8) is the root media listed by specification table 1.
In preferred embodiments, wherein the paddy rice is Jing rice, it is highly preferred that the paddy rice is that Jing rice Japan is fine.
The exemplary formulations of the culture medium of table 1
" the N6 a great number of elements of optimization " being previously mentioned in form refer to [NO3-]/[NH4+] in the N6 a great number of elements=
40mM/10mM。
In preferred embodiments, the nucleotides sequence of the plant LbCpf1 marker gene is classified as SEQ ID NO:1
Shown nucleotide sequence, specifically such as：
atgtccaagctggagaagtttacaaactgttacagcctctccaaaaccctcaggtttaaagcgatcccggtgggcaa
gacccaggagaacatcgacaacaagaggctcctggtggaagacgagaagcgcgccgaagactacaagggcgtgaaga
agctgctcgataggtactacctcagctttattaacgacgtgctgcacagcatcaaactcaagaatctcaacaactac
atctccctcttccgcaaaaagacccgcaccgagaaggagaacaaggagctggagaacctggagatcaacctccgcaa
ggaaatcgccaaagcgttcaagggcaatgaagggtacaagagcctcttcaagaaagacatcatcgaaactatcctcc
cagagtttctcgatgacaaggacgagatcgcgctggtgaactcctttaacgggttcacaaccgcgtttaccggcttc
tttgataacagggaaaatatgttctccgaggaggccaagtccaccagcatcgccttcaggtgtatcaacgagaacct
cacccgctacatttccaatatggacattttcgagaaggtggatgcgatcttcgataagcacgaggtgcaggagatca
aagagaagattctcaattccgattatgacgtcgaggatttcttcgaaggggagttctttaattttgtgctcacacaa
gagggcattgacgtgtacaacgcgattatcgggggcttcgtcacagagtccggggagaagattaaggggctgaatga
gtacatcaatctgtacaatcagaagaccaagcagaaactgccgaaattcaagccgctctacaagcaagtcctgtccg
atagggaaagcctctccttctacggcgagggctataccagcgacgaggaggtgctggaagtcttccgcaacacactg
aataagaatagcgagattttctcctccatcaagaagctcgagaagctctttaagaactttgacgagtacagctccgc
cgggattttcgtgaagaacgggccggcgatcagcaccatctccaaggacatctttggcgagtggaacgtcatcaggg
acaagtggaacgccgagtacgacgacatccacctgaagaagaaggcggtggtgaccgagaagtatgaggacgatcgc
aggaagtccttcaaaaaaatcggctccttcagcctcgaacagctccaggagtatgccgatgcggatctgtccgtcgt
cgagaagctgaaggaaatcatcattcagaaggtcgacgagatctataaagtgtacgggtccagcgagaagctgttcg
acgccgactttgtgctcgagaagtccctcaaaaagaatgacgccgtggtggccattatgaaagacctgctcgactcc
gtgaagtccttcgaaaattacattaaagcgttctttggggaggggaaggaaactaacagggatgagtccttctatgg
cgactttgtcctcgcgtacgacatcctgctgaaggtcgaccacatttacgacgcgatccgcaactacgtgacacaga
agccgtactccaaagacaagttcaagctgtacttccagaacccgcaatttatggggggctgggacaaggataaagag
acagactaccgcgcgacaattctccgctatggctccaaatactatctggccatcatggacaagaagtacgcgaagtg
cctgcagaagatcgacaaagacgacgtcaatggcaactatgaaaagatcaactacaagctgctgccgggcccgaaca
agatgctcccgaaggtgttcttcagcaagaagtggatggcctactacaatccaagcgaggatattcagaaaatctat
aaaaacgggaccttcaagaagggggacatgtttaacctcaacgactgccacaagctcattgatttcttcaaggatag
catttcccgctacccgaaatggtccaatgcgtacgattttaacttctccgagacagaaaagtacaaagacatcgcgg
gcttttacagggaggtggaggagcaagggtataaagtttcttttgaatccgcgagcaagaaggaagtcgacaagctc
gtcgaggagggcaagctctacatgttccaaatttataacaaggacttttccgacaagagccatgggaccccaaacct
ccacaccatgtacttcaaactgctctttgacgagaacaaccacgggcaaatcaggctgagcggcggcgccgaattat
tcatgcgcagggcctccctcaagaaggaagagctggtcgtccatccagccaattccccgatcgcgaacaagaacccg
gacaatccgaaaaagaccaccaccctgtcctacgacgtctacaaggacaaacgcttcagcgaagaccagtacgaatt
acacatcccaattgcgattaataagtgcccaaagaatatcttcaaaattaatacagaggtcagggtgctgctcaaac
acgacgacaatccgtatgtcatcggcattgacaggggcgagcgcaatctgctctatatcgtggtcgtggatgggaag
ggcaatattgtggagcagtactccctgaacgagattatcaacaacttcaatgggattaggattaagaccgactatca
cagcctgctcgacaagaaagaaaaagagaggtttgaggcccgccaaaactggacctccattgagaatatcaaagaat
taaaggccggctatatttcccaagtcgtccacaagatctgcgagctggtggagaaatatgacgccgtgattgcgctc
gaagacttaaattctgggttcaagaactcccgcgtgaaggtggaaaaacaggtgtatcagaaattcgagaaaatgct
gatcgacaaactcaattatatggtggataagaagtccaacccgtgtgccacagggggcgcgctgaagggctatcaga
tcaccaacaagttcgagagcttcaagagcatgagcacccagaacgggtttattttctacatcccggcgtggctcacc
tccaagattgacccgagcaccggcttcgtgaacctcctgaagacaaagtatacctccattgccgacagcaagaagtt
tatctcctccttcgaccgcattatgtatgtgccggaggaggacctcttcgagttcgccctcgactacaaaaacttca
gccgcacagatgcggattacatcaagaagtggaagctgtactcctacgggaacaggatccgcatcttcaggaatcca
aaaaaaaataacgtctttgactgggaggaagtgtgcctgacatccgcctacaaggaactgttcaataaatacggcat
caattaccagcagggcgacattcgcgccctcctctgtgagcagtccgacaaagcgttttactccagcttcatggccc
tcatgtccctgatgctccaaatgaggaatagcatcacagggcgcaccgacgtcgacttcctcatcagcccggtgaag
aactccgacgggatcttttacgactcccgcaactatgaggcgcaagagaatgcgatcctcccgaagaacgccgatgc
gaacggggcctataatatcgccaggaaagtgctctgggccatcgggcagttcaaaaaggcggaggatgagaagctcg
acaaggtgaaaattgccatttccaacaaggagtggctggagtacgcgcagacctccgtgaagcacaaaaggccggcg
gccacgaaaaaggccggccaggcaaaaaagaaaaagggatcctacccatacgatgttccagattacgcttatcccta
cgacgtgcctgattatgcatacccatatgatgtccccgactatgcctaa
Description of the drawings
Fig. 1-1 to Fig. 1-4 is the plantLbCpf1 and original LbCpf1 nucleotide sequences of codon vegetalization transformation
Compare.Wherein Optimized is the nucleotide sequence of the plantLbCpf1 after optimization, and Original is the core of original LbCpf1
Nucleotide sequence.
Fig. 2 is the amino of the plantLbCpf1 with original LbCpf1 gene coded proteins of codon vegetalization transformation
Acid sequence is compared.Optimized is the amino acid sequence of plantLbCpf1 gene codes after optimization, and Original is original
The amino acid sequence of LbCpf1 codings.
Fig. 3 is PHUN611 (LbCpf1) vector plasmid schematic diagram.
Fig. 4 detects electrophoretogram for the PCR of transfer-gen plant.Amplified fragments are the part of LbCpf1 genes, and clip size is
496bp.M is DL2kbmarker；PC is positive control；NC is negative control；1-8 is the transfer-gen plant selected at random.
Specific embodiment
Embodiments of the invention are described below in conjunction with accompanying drawing.It should be noted that following embodiments are only used for showing the present invention
Example property implementation is illustrated, and not carries out any restriction to the present invention.Those skilled in the art can be to present invention work
Go out the change and conspicuously improved of some equivalents.
In the case where illustrating without other, the operation in following specific embodiments is using generally in the art
Routine operation is carrying out.Those skilled in the art easily can be obtained from the prior art with regard to such routine operation
Teaching, for example, be referred to textbook Sambrook and DavidRussell, Molecular Cloning:A
Laboratory Manual,3rd ed.,Vols1,2；CharlesNeal Stewart,Alisher Touraev,Vitaly
Citovsky and Tzvi Tzfira, PlantTransformation Technologies etc..It is used in following embodiments
Medicinal raw material, reagent, material etc., if no special instructions, be commercially available purchase product.
The codon vegetalization transformation of embodiment 1 --- LbCpf1 genes
Information of the present inventor in GENBANK databases, collects 92188 CDS sequences of paddy rice, altogether
34132283 codons, in website http://www.kazusa.or.jp/codon/, analyzes these codons in paddy rice
Service condition.The same monoamino-acid of same species, the situation that different codons are used is different, and inventor is according in paddy rice
In each codon service condition, original codon is replaced using the combination of the codon of designed, designed, to from Escherichia coli
LbCpf1 genes carry out vegetalization transformation, obtain a new DNA sequence dna, and inclined plus paddy rice to this DNA sequence dna end
Good terminator codon TGA, forms a new gene, and the gene is named as plantLbCpf1, sequence such as SEQ ID NO:1
It is shown, see Fig. 1 with LbCpf1 sequence alignments.
Its base composition is further analyzed, 2 are the results are shown in Table.Known by table 2：The G/C content of plantLbCpf1 is up to
53.06%, hence it is evident that higher than the 50.30% of LbCpf1.So gene structure is more stable, because 3 hydrogen bonds can be formed between GC, and
2 between AT.
The gene base composition analysis of table 2plant LbCpf1 and LbCpf1.
The protein amino acid sequence of analysis plant LbCpf1 and LbCpf1 coded by said gene, comparison result is shown in Fig. 2.From figure
2 can be seen that, the two amino acid sequence is completely the same.
The plantLbCpf1 genes for designing are sent after the synthesis of Suzhou Jin Weizhi bio tech ltd, is connected to
On PUC57-AMP carriers, PUC57-AMP-plant LbCpf1 carriers are formed, and be loaded in Escherichia coli XL-blue bacterial strains.
Embodiment 2 --- the structure containing plant LbCpf1 gene plant targeting vectors
, containing the Escherichia coli XL-blue of PUC57-AMP-plant LbCpf1 carriers, carried with Axygen plasmids from above
Take and extract in kit plasmid, use NotI/SacI digestions, reclaim plantLbCpf1 fragments.NotI/SacI enzymes pair are utilized simultaneously
PHUN600 carries out linearization process, reclaims pHUN600, and above-mentioned plantLbCpf1 fragments and pHUN600 fragments are connected with T4
Connect enzyme (being purchased from TaKaRa companies) to be attached, obtain plant expression vector pHUN600-plant LbCpf1 (Fig. 3), be named as
pHUN 611。
Select the nucleotide sequence of 2463-2487 positions in paddy rice BEL genes (LOC_Os03g55240)
TTTGGAAGAGAGTGACTGCGCTAGCAATC, (underscore part is TTTG parts in 5 ' TTTN- (N) X-3 ' structures),
As target practice site.Target site sequence and pHUN611 are merged to form pHUN611-BEL.Plant expression is carried using freeze-thaw method
Body proceeds to (Academy of Agri-Science and Technology Anhui Province paddy rice in Agrobacterium tumefaciems (Agrobacterium tumefaciens) EHA105 bacterial strains
Research institute preserves), for genetic transformation.
Embodiment 3 --- the acquisition of rice transformation and mutant with pHUN611-BEL as targeting vector.
1st, the induction of mature embryo callus and preculture
The mature seed of Japanese fine (Paddy Rice Inst., Anhui Agriculture Science Academy's preservations) is shelled, choose outward appearance normally,
The clean seed without mildew, uses 70% alcohol, rocks 90sec, outwells alcohol；It is (former with 50% sodium hypochlorite containing Tween20 again
Liquid effective chlorine density is more than 4%, adds 1 to drip Tween20 per 100 milliliters) solution cleaning seed, rocks 45min on shaking table
(180r/min).Sodium hypochlorite is outwelled, all over to sterilized water without sodium hypochlorite smell, is eventually adding, 30 DEG C are soaked aseptic washing 5-10
Bubble is overnight.Embryo is separated along aleurone with knife blade, scultellum is placed on upward on inducing culture (composition is shown in Table 1), 12/
Ware, 30 DEG C of light cultures are with evoked callus.
Occur spherical, coarse, lurid secondary callus after two weeks, preculture operation can be carried out, will be secondary
Callus is gone on new callus inducing medium, 30 DEG C of light culture precultures 5 days.After preculture terminates, by it is in good condition,
The vigorous little particle spoon of division is collected into the sterile centrifugation tube of 50mL, is infected for Agrobacterium.
2nd, the culture of agrobacterium strains and suspension prepare
By the agrobacterium strains EHA105 containing pHUN611-BEL carriers on the LB flat boards containing 50mg/L kanamycins
Line (composition is shown in Table 1), 28 DEG C of dark culturings use aseptic inoculation ring by the Agrobacterium inoculation for activating to fresh 50mg/ after 24h
On the LB flat boards of L kanamycins, second activation is carried out, 28 DEG C of dark culturings are overnight.Add in the sterile centrifugation tube of 50mL
20-30mL Agrobacterium suspension mediums (composition is shown in Table 1), is scraped the Agrobacterium for activating 2 times with oese, adjusts OD660
(Optical density660nm, 660nm light absorption value), to about 0.10-0.25, is stored at room temperature more than 30min.
3rd, infect and co-culture
To in ready callus (see step 1), plus agrobacterium suspension, 15min is soaked, gently shake frequently therebetween
It is dynamic.Liquid (as far as possible that liquid drop is net) is outwelled in immersion after terminating, with aseptic filter paper the unnecessary agriculture bar on callus surface is sucked
Bacterium bacterium solution, and dried up with sterile wind in super-clean bench.Three aseptic filters on the disposable sterilized culture dish pad of 100 × 25mm
Paper, adds 2.5mL Agrobacterium suspension mediums, the callus after blotting is dispersed on filter paper, 23 DEG C of dark culturings
48h。
4th, front screening and screening and culturing
After co-cultivation terminates, the callus that Jing is co-cultured is dispersed evenly in front screening and culturing medium (composition is shown in Table 1),
30 DEG C of dark culturings 5 days.After front screening and culturing terminates, callus is gone to into (composition is shown in Table 1) on screening and culturing medium, each training
Foster ware connects 25 callus, 30 DEG C of dark culturings, and after 2-3 is all, resistant calli growth is obvious, can carry out differentiation and regeneration behaviour
Make.
5th, differentiation and regeneration
Each independent transformants selects 2-3 good, the fresh little particle of growth conditions, goes on differentiation and regeneration culture medium
(composition is shown in Table 1).5 independent transformants are connect per culture dish.28 DEG C of illumination cultivations, periodicity of illumination is that 16h illumination 8h is dark, light intensity
Spend for 3000-6000lx.
6th, take root and transplanting
When the bud length of resistant calli differentiation is to about 2cm, each independent transformants only takes one plant of well-grown seedling,
Move to (composition is shown in Table 1) on root media, 28 DEG C of illumination cultivations, periodicity of illumination is that 16h illumination 8h is dark, and luminous intensity is
3000-6000lx.After two weeks, the seedling of well developed root system is selected, wash culture medium with water, transplanting is buried.
7th, Molecular Identification
Before transplanting, rice leaf sample is taken, carry out that DNA is little to be carried with CTAB methods.By resulting genomic DNA sample
Product are for PCR analyses.For expand codon vegetalization transformation plantLbCpf1 PCR primer be 5 '-
TTCACAACCGCGTTTACC-3 ' and 5 '-TCACCACCGCCTTCTTCT-3 ', produces fragment of the length for 492bp.By PCR groups
Divide and kept for 5 minutes at 95 DEG C first, then carry out 32 circulations：94 DEG C 45 seconds, 56 DEG C 45 seconds, 72 DEG C 45 seconds, finally at 72 DEG C
Extend 10 minutes.8 transfer-gen plants are selected at random, it is identified, the positive is, positive rate reaches 100% (see Fig. 4).
Leaf DNA extraction is all carried out to 34 plant obtained by transgenosis, gained genome DNA sample is used for into PCR
Analysis.For expand BEL genetic fragments PCR primer be 5 '-GTGGAGGTCGACATGACTGAAG-3 ' and 5 '-
TTGCACATTCATACAAATTGGT-3 ', produces fragment of the length for 416bp.PCR components are kept for 5 minutes first at 95 DEG C,
Then 32 circulations are carried out：94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C 30 seconds, finally 72 DEG C extend 10 minutes.PCR primer is surveyed
Sequence.Measured result is compared with wild-type sequence.There are 14 plants to there occurs point mutation in the 34 plants of transfer-gen plants surveyed；It is prominent
Become efficiency into 41.2%.Illustrate that engineered Lbcpf1 can be sheared to rice genome, and with very high mutation
Efficiency.
Sequence table
<110>Paddy Rice Inst., Anhui Agriculture Science Academy
<120>A kind of LbCpf1 genes of codon vegetalization transformation and its application
<130> HCI20160265
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 3822
<212> DNA
<213>Key plasmid vector
<400> 1:
atgtccaagc tggagaagtt tacaaactgt tacagcctct ccaaaaccct caggtttaaa 60
gcgatcccgg tgggcaagac ccaggagaac atcgacaaca agaggctcct ggtggaagac 120
gagaagcgcg ccgaagacta caagggcgtg aagaagctgc tcgataggta ctacctcagc 180
tttattaacg acgtgctgca cagcatcaaa ctcaagaatc tcaacaacta catctccctc 240
ttccgcaaaa agacccgcac cgagaaggag aacaaggagc tggagaacct ggagatcaac 300
ctccgcaagg aaatcgccaa agcgttcaag ggcaatgaag ggtacaagag cctcttcaag 360
aaagacatca tcgaaactat cctcccagag tttctcgatg acaaggacga gatcgcgctg 420
gtgaactcct ttaacgggtt cacaaccgcg tttaccggct tctttgataa cagggaaaat 480
atgttctccg aggaggccaa gtccaccagc atcgccttca ggtgtatcaa cgagaacctc 540
acccgctaca tttccaatat ggacattttc gagaaggtgg atgcgatctt cgataagcac 600
gaggtgcagg agatcaaaga gaagattctc aattccgatt atgacgtcga ggatttcttc 660
gaaggggagt tctttaattt tgtgctcaca caagagggca ttgacgtgta caacgcgatt 720
atcgggggct tcgtcacaga gtccggggag aagattaagg ggctgaatga gtacatcaat 780
ctgtacaatc agaagaccaa gcagaaactg ccgaaattca agccgctcta caagcaagtc 840
ctgtccgata gggaaagcct ctccttctac ggcgagggct ataccagcga cgaggaggtg 900
ctggaagtct tccgcaacac actgaataag aatagcgaga ttttctcctc catcaagaag 960
ctcgagaagc tctttaagaa ctttgacgag tacagctccg ccgggatttt cgtgaagaac 1020
gggccggcga tcagcaccat ctccaaggac atctttggcg agtggaacgt catcagggac 1080
aagtggaacg ccgagtacga cgacatccac ctgaagaaga aggcggtggt gaccgagaag 1140
tatgaggacg atcgcaggaa gtccttcaaa aaaatcggct ccttcagcct cgaacagctc 1200
caggagtatg ccgatgcgga tctgtccgtc gtcgagaagc tgaaggaaat catcattcag 1260
aaggtcgacg agatctataa agtgtacggg tccagcgaga agctgttcga cgccgacttt 1320
gtgctcgaga agtccctcaa aaagaatgac gccgtggtgg ccattatgaa agacctgctc 1380
gactccgtga agtccttcga aaattacatt aaagcgttct ttggggaggg gaaggaaact 1440
aacagggatg agtccttcta tggcgacttt gtcctcgcgt acgacatcct gctgaaggtc 1500
gaccacattt acgacgcgat ccgcaactac gtgacacaga agccgtactc caaagacaag 1560
ttcaagctgt acttccagaa cccgcaattt atggggggct gggacaagga taaagagaca 1620
gactaccgcg cgacaattct ccgctatggc tccaaatact atctggccat catggacaag 1680
aagtacgcga agtgcctgca gaagatcgac aaagacgacg tcaatggcaa ctatgaaaag 1740
atcaactaca agctgctgcc gggcccgaac aagatgctcc cgaaggtgtt cttcagcaag 1800
aagtggatgg cctactacaa tccaagcgag gatattcaga aaatctataa aaacgggacc 1860
ttcaagaagg gggacatgtt taacctcaac gactgccaca agctcattga tttcttcaag 1920
gatagcattt cccgctaccc gaaatggtcc aatgcgtacg attttaactt ctccgagaca 1980
gaaaagtaca aagacatcgc gggcttttac agggaggtgg aggagcaagg gtataaagtt 2040
tcttttgaat ccgcgagcaa gaaggaagtc gacaagctcg tcgaggaggg caagctctac 2100
atgttccaaa tttataacaa ggacttttcc gacaagagcc atgggacccc aaacctccac 2160
accatgtact tcaaactgct ctttgacgag aacaaccacg ggcaaatcag gctgagcggc 2220
ggcgccgaat tattcatgcg cagggcctcc ctcaagaagg aagagctggt cgtccatcca 2280
gccaattccc cgatcgcgaa caagaacccg gacaatccga aaaagaccac caccctgtcc 2340
tacgacgtct acaaggacaa acgcttcagc gaagaccagt acgaattaca catcccaatt 2400
gcgattaata agtgcccaaa gaatatcttc aaaattaata cagaggtcag ggtgctgctc 2460
aaacacgacg acaatccgta tgtcatcggc attgacaggg gcgagcgcaa tctgctctat 2520
atcgtggtcg tggatgggaa gggcaatatt gtggagcagt actccctgaa cgagattatc 2580
aacaacttca atgggattag gattaagacc gactatcaca gcctgctcga caagaaagaa 2640
aaagagaggt ttgaggcccg ccaaaactgg acctccattg agaatatcaa agaattaaag 2700
gccggctata tttcccaagt cgtccacaag atctgcgagc tggtggagaa atatgacgcc 2760
gtgattgcgc tcgaagactt aaattctggg ttcaagaact cccgcgtgaa ggtggaaaaa 2820
caggtgtatc agaaattcga gaaaatgctg atcgacaaac tcaattatat ggtggataag 2880
aagtccaacc cgtgtgccac agggggcgcg ctgaagggct atcagatcac caacaagttc 2940
gagagcttca agagcatgag cacccagaac gggtttattt tctacatccc ggcgtggctc 3000
acctccaaga ttgacccgag caccggcttc gtgaacctcc tgaagacaaa gtatacctcc 3060
attgccgaca gcaagaagtt tatctcctcc ttcgaccgca ttatgtatgt gccggaggag 3120
gacctcttcg agttcgccct cgactacaaa aacttcagcc gcacagatgc ggattacatc 3180
aagaagtgga agctgtactc ctacgggaac aggatccgca tcttcaggaa tccaaaaaaa 3240
aataacgtct ttgactggga ggaagtgtgc ctgacatccg cctacaagga actgttcaat 3300
aaatacggca tcaattacca gcagggcgac attcgcgccc tcctctgtga gcagtccgac 3360
aaagcgtttt actccagctt catggccctc atgtccctga tgctccaaat gaggaatagc 3420
atcacagggc gcaccgacgt cgacttcctc atcagcccgg tgaagaactc cgacgggatc 3480
ttttacgact cccgcaacta tgaggcgcaa gagaatgcga tcctcccgaa gaacgccgat 3540
gcgaacgggg cctataatat cgccaggaaa gtgctctggg ccatcgggca gttcaaaaag 3600
gcggaggatg agaagctcga caaggtgaaa attgccattt ccaacaagga gtggctggag 3660
tacgcgcaga cctccgtgaa gcacaaaagg ccggcggcca cgaaaaaggc cggccaggca 3720
aaaaagaaaa agggatccta cccatacgat gttccagatt acgcttatcc ctacgacgtg 3780
cctgattatg catacccata tgatgtcccc gactatgcct aa 3822
<210> 2
<211> 22
<212> DNA
<213>Primer
<400> 2:
gtggaggtcg acatgactga ag 22
<210> 3
<211> 22
<212> DNA
<213>Primer
<400> 3:
ttgcacattc atacaaattg gt 22
Claims (7)
1. the LbCpf1 genes that a kind of codon vegetalization is transformed, it is characterised in that the LbCpf1 genes are including at least such as sequence
Nucleotide sequence in list shown in SEQ ID NO.1.
2. the LbCpf1 genes that a kind of codon vegetalization according to claim 1 is transformed, it is characterised in that described
LbCpf1 genes are made up of the nucleotide sequence in sequence table shown in SEQ ID NO.1.
3. a kind of expression cassette, it is characterised in that comprising the LbCpf1 genes described in claim 1 in the expression cassette.
4. a kind of expression vector, it is characterised in that the expression vector includes the LbCpf1 genes or right described in claim 1
Require the expression cassette described in 2.
5. the carrier described in the gene described in a kind of claim 1, the expression cassette described in claim 3 or claim 4 should
With, it is characterised in that the application includes being realized to paddy gene using the LbCpf1 genes of codon vegetalization transformation
The shearing of group, obtains the genetically modified plants containing mutational site or plant part.
6. it is a kind of using containing described in claim 1 codon vegetalization transformation LbCpf1 genes expression vector establishment
Specific gene targeting vector, the method for targeting vector Introduced into Rice cell comprises the steps：
(1) rice paddy seed is shelled, sterilize after embryo is separated, be placed on callus inducing medium with produce secondary heal
Injured tissue；
(2) the secondary callus is transferred to into new callus inducing medium carries out preculture, obtains callus；
(3) callus obtained in step (2) is contacted 15 minutes with Agrobacterium, wherein, institute is introduced in the Agrobacterium
Targeting vector is stated, the LbCpf1 genes of the codon vegetalization transformation are carried in the targeting vector；
(4) callus after step (3) process is transferred to and be lined with thereon in the culture dish of aseptic filter paper, 21-23 DEG C of culture
48 hours；
(5) callus after step (4) process is placed on front screening and culturing medium and is cultivated 5-7 days；
(6) callus after step (5) process is shifted on screening and culturing medium, to obtain resistant calli；
(7) resistant calli is transferred to into seedling differentiation in differentiation and regeneration culture medium；With
(8) seedling obtained in step (7) is transferred in root media and is taken root.
7. the expression vector establishment specific gene of the LbCpf1 genes of codon vegetalization transformation according to claim 1 is beaten
Targeting vector, by the method for targeting vector Introduced into Rice cell, it is characterised in that the paddy rice is Jing rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610979713.6A CN106591335A (en) | 2016-11-08 | 2016-11-08 | Codon vegetalization-transformed LbCpf1 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610979713.6A CN106591335A (en) | 2016-11-08 | 2016-11-08 | Codon vegetalization-transformed LbCpf1 gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106591335A true CN106591335A (en) | 2017-04-26 |
Family
ID=58590964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610979713.6A Pending CN106591335A (en) | 2016-11-08 | 2016-11-08 | Codon vegetalization-transformed LbCpf1 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591335A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099544A (en) * | 2017-06-28 | 2017-08-29 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
| CN107142271A (en) * | 2017-06-28 | 2017-09-08 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting |
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103993039A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for introducing foreign gene into cleistogamy japonica rice by utilizing PMI (phosphomannose isomerase) selection marker |
| CN104046636A (en) * | 2014-06-19 | 2014-09-17 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed PMI gene and applications thereof |
| CN105378084A (en) * | 2013-05-07 | 2016-03-02 | 瓦尔希伯伦私人肿瘤研究基金会 | Methods and compositions for the treatment of cancer |
| EP3009511A2 (en) * | 2015-06-18 | 2016-04-20 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| CN105907785A (en) * | 2016-05-05 | 2016-08-31 | 苏州吉玛基因股份有限公司 | Application of CRISPR (clustered regularly interspaced short palindromic repeats)/Cpf1 system with compounded crRNA in gene editing |
| WO2016166340A1 (en) * | 2015-04-16 | 2016-10-20 | Wageningen Universiteit | Nuclease-mediated genome editing |
-
2016
- 2016-11-08 CN CN201610979713.6A patent/CN106591335A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105378084A (en) * | 2013-05-07 | 2016-03-02 | 瓦尔希伯伦私人肿瘤研究基金会 | Methods and compositions for the treatment of cancer |
| CN103993039A (en) * | 2014-06-04 | 2014-08-20 | 安徽省农业科学院水稻研究所 | Method for introducing foreign gene into cleistogamy japonica rice by utilizing PMI (phosphomannose isomerase) selection marker |
| CN104046636A (en) * | 2014-06-19 | 2014-09-17 | 安徽省农业科学院水稻研究所 | Codon vegetalization-transformed PMI gene and applications thereof |
| WO2016166340A1 (en) * | 2015-04-16 | 2016-10-20 | Wageningen Universiteit | Nuclease-mediated genome editing |
| EP3009511A2 (en) * | 2015-06-18 | 2016-04-20 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| CN105907785A (en) * | 2016-05-05 | 2016-08-31 | 苏州吉玛基因股份有限公司 | Application of CRISPR (clustered regularly interspaced short palindromic repeats)/Cpf1 system with compounded crRNA in gene editing |
Non-Patent Citations (3)
| Title |
|---|
| DONG D 等: "The crystal structure of Cpf1 in complex with CRISPR RNA", 《NATURE》 * |
| NCBI: "type V CRISPR-associated protein Cpf1 [Lachnospiraceae bacterium ND2006]", 《GENBANK DATABASE》 * |
| 周宗梁 等: "水稻中cry1Ah1基因密码子优化方案的比较", 《生物工程学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099544A (en) * | 2017-06-28 | 2017-08-29 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice |
| CN107142271A (en) * | 2017-06-28 | 2017-09-08 | 安徽省农业科学院水稻研究所 | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting |
| CN110283840A (en) * | 2019-04-11 | 2019-09-27 | 华中农业大学 | The accurate efficient edit methods of upland cotton genome |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104046636B (en) | A kind of PMI genes of codon vegetalization transformation and its application | |
| CN110878305B (en) | Wide-window single-base editing gene and application and breeding method thereof | |
| CN112538492B (en) | SpCas9n variant capable of recognizing NRTH (Polyacrylamide) as PAM (Polyacrylamide) sequence and corresponding base editing system | |
| CN107099544A (en) | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice | |
| CN107142271A (en) | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting | |
| CN110283838A (en) | A kind of high shear efficiency ScCas9 gene and its application | |
| CN106591335A (en) | Codon vegetalization-transformed LbCpf1 gene and application thereof | |
| CN107353332A (en) | A kind of rice chloroplast developmental regulation Gene A HS1 and its coding protein and application | |
| CN1268752C (en) | Method of improving gene transfer efficiency into plant cells | |
| Qi et al. | Regeneration and transformation of Crambe abyssinica | |
| CN116732070A (en) | CGBE single base editor capable of realizing base transversion and application thereof | |
| CN105296492B (en) | A kind of javanese root knot nematode effector Mj-1-1, GAP-associated protein GAP and its application | |
| CN109929857A (en) | A kind of high editorial efficiency SaCas9 gene and its application | |
| CN110791487A (en) | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof | |
| CN102559673A (en) | Promoter specifically induced and expressed under condition of lack of phosphorus in cabbage type rape | |
| CN101838664A (en) | Method for enhancing freezing resistance of tobacco by using genetic engineering method | |
| CN109486840B (en) | Codon-plant-modified NmeCas9 gene and application thereof | |
| CN1733802A (en) | Plant DREB transcription factor and its coding gene and uses | |
| CN112430613A (en) | SpG gene with wide editing range and application thereof | |
| CN102181444A (en) | Rice callus-specific promoter and application thereof | |
| CN110257406B (en) | codon-Plant-modified Plant Nme2Cas9 gene and application thereof | |
| CN112575014B (en) | Base editor SpCas9-LjCDAL1 and construction and application thereof | |
| CN103627725A (en) | Plant chloroplast poly-gene transformation vector, and construction method and application thereof | |
| CN105400797B (en) | A kind of recombinant dna fragment containing anti insect gene and its application | |
| CN115820691B (en) | LbCPf1 variant-based rice base editing system and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170426 |