CN108753815A - A kind of method that big flux screening plant virus replicates required host's gene - Google Patents
A kind of method that big flux screening plant virus replicates required host's gene Download PDFInfo
- Publication number
- CN108753815A CN108753815A CN201810631815.8A CN201810631815A CN108753815A CN 108753815 A CN108753815 A CN 108753815A CN 201810631815 A CN201810631815 A CN 201810631815A CN 108753815 A CN108753815 A CN 108753815A
- Authority
- CN
- China
- Prior art keywords
- virus
- gene
- plant
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
Abstract
A kind of method that big flux screening plant virus replicates required host's gene, belongs to gene engineering technology field.It is low that the present invention is directed to virus infection efficiency in current infectious clone construction method, gene expression problem rambunctious, the present invention provides a kind of methods that big flux screening plant virus replicates required host's gene, inducible promoter structure induction type viral infectivity is specifically utilized to clone, pass through agrobacterium mediation converted plant, mutant library is built with genetically modified plants, after mutant germination, virus infection is induced using derivant, carry out the screening of mutant, obtain the mutant plant that virus cannot be induced, in conjunction with the positioning of the method for map based cloning and genome sequencing and the required host's gene of cloning plant virus duplication, the present invention is suitable for disposable big flux screening plant virus and replicates required host's gene.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of big required host of flux screening plant virus duplication
The method of gene.
Background technology
The RNA of plant positive sense RNA virus have infectivity, into plant cell after can be used as ribosomes of the mRNA by cell
Translation generates virus replication required protein (Flasinski et al., 1996), and then starts the duplication of virus, movement
Etc. life processes.Plant positive sense RNA virus can be transformed by building infectious clone to facilitate long-term preservation
(Flasinski et al.,1996,Takahashi et al.,1997).Infecting there are many plant positive sense RNA virus at present
Property clone be reported, summary method can be classified as two classes:1) cDNA of the full-length genome of virus is inserted into constitutive promoter,
Zou cauliflowers mosaic virus (CaMV) 35S promoter downstream is such as spent, virus genome RNA is expressed in plant by Agrobacterium;2) will
The cDNA of the full-length genome of virus is inserted into the downstream protokaryon transcripting promoter (such as SP6 and T7), and virus is obtained by in-vitro transcription
Then full-length genome RNA passes through mechanical friction inoculated plant.There is following defects for above two method:1) composing type starts
Son starts to express once entering cell, therefore controls the time of expression with being unable to conditionity;2) due to the physical feature of RNA,
The viral RNA that protokaryon transcripting promoter transcription generates is very easy to be degraded by RNA enzyme in environment, causes virus infection efficiency
Lowly.
Plant base can theoretically be covered by screening a kind of plant virus and replicating required host's gene and need to build one
Because organizing the mutant library of all genes, then by virus inoculation one by one, the mutant of the viral not reproducible of screening obtains.It is this
Method needs largely to plant mutant to certain plant height and carries out virus inoculation one by one, need there are an apparent defect
Very big manpower, speed is slow, greenhouse and experiment material.
Invention content
Low, gene expression problem rambunctious, this hair for virus infection efficiency in current infectious clone construction method
It is bright to provide a kind of method that big flux screening plant virus replicates required host's gene, include the following steps:
1) structure of induction type viral infectivity clone:The expression vector includes agrobatcerium T-DNA left margin sequence, agriculture
Bacillus T-DNA right border sequences, inducible promoter, plant positive sense RNA virus full-length cDNA, eukaryotic transcription terminator, large intestine
Bacillus and Agrobacterium replicate required element and resistance screening gene, wherein plant positive sense RNA virus full-length cDNA is located at induction type
Between promoter and eukaryotic transcription terminator sequence, agrobatcerium T-DNA right border sequence is located at inducible promoter upstream, agriculture bar
Bacterium T-DNA left margin sequences are located at eukaryotic transcription terminator downstream;The induction type viral infectivity Cloning Transformation large intestine bar of acquisition
In bacterium host strain, positive transformant is obtained;
2) genetic transformation of induction type viral infectivity clone:The positive transformant that step 1) is obtained imports Agrobacterium,
Then induction type viral infectivity clone is transferred in plant, obtains genetically modified plants;
3) plant virus replicates the big flux screening of indispensable gene:Mutant library, mutant hair are built with genetically modified plants
After bud, virus infection is induced using derivant, carries out the screening of mutant, obtains the mutant plant that virus cannot be induced,
Determine that the plant virus of screening replicates indispensable gene in conjunction with the method for map based cloning and genome sequencing.
Preferably, the host strain of the Escherichia coli is Escherichia coli Trans10, and the Agrobacterium is Agrobacterium
GV3101。
Preferably, the agrobatcerium T-DNA left margin sequence such as SEQ ID NO:Shown in 1;On the right of the agrobatcerium T-DNA
Boundary's sequence such as SEQ ID NO:Shown in 2;The Escherichia coli and Agrobacterium replicate the sequence such as SEQ ID NO of required element:3
It is shown.
Preferably, step 1) the plant positive sense RNA virus is potyvirus or potexvirus disease
Poison;The potyvirus include Brassica 2 et 4, marmor upsilon, marmor solani, plumpox virus,
Papaya ringspot virus, soybean mosaic virus and marmor erodens;The potexvirus virus includes potato X
Virus, potato Ao Guba mosaic virus, garcinia mangostana mosaic virus, plantago mosaic virus and foxtail mosaic virus.
Preferably, step 1) the plant positive sense RNA virus full-length cDNA is the full-length cDNA of Brassica 2 et 4, sequence
Row such as SEQ ID NO:Shown in 4.
Preferably, step 1) the plant positive sense RNA virus full-length cDNA is the full-length cDNA of potato virus X, sequence
Row such as SEQ ID NO:Shown in 5.
Preferably, the inducible promoter described in step 1) is estrogen-inducible promoter XVE, sequence such as SEQ ID
NO:Shown in 6.
Preferably, step 1) the resistance screening gene is hygromycin gene, sequence such as SEQ ID NO:It is described shown in 7
Hygromycin gene, upstream are estrogen-inducible promoter XVE-1, sequence such as SEQ ID NO:It is female downstream shown in 8
Hormone inducible promoter XVE-2, sequence such as SEQ ID NO:Shown in 9;Plant positive sense RNA virus overall length described in step 1)
The promoter of cDNA, upstream are estrogen-inducible promoter XVE-2.
Preferably, step 1) the eukaryotic transcription terminator is T3A terminators, sequence such as SEQ ID NO:Shown in 10.
Preferably, the mutant screening described in step 3) uses estrogen revulsion.
It is to utilize agrobacterium-mediated transformation that induction type viral infectivity clone described in step 1) of the present invention, which is transferred in plant,
Or particle bombardment realization, the conversion plant described in step 2) is the arabidopsis Col-0 ecotypes or Nicotiana tabacum;Step 3) is described
Mutant library construction method use T-DNA methods or EMS mutagenesis;The plant virus replicates the screening of required host's gene
It is to determine target gene in conjunction with map based cloning and genome sequencing method, when the plant of conversion is arabidopsis, passes through gene
The gene obtained is positioned, is inserted into the T-DNA sequences with herbicide resistance gene in the gene, it is determined that it is multiple for plant virus
The required host's gene of system;When the plant of conversion is tobacco, by the gene of assignment of genes gene mapping acquisition, the gene and reference gene
(i.e. unmutated gene) nucleotide sequence is compared to that can cause, coded amino acid changes or coded amino acid shifts to an earlier date eventually
Coding mutation only, it is determined that it replicates required host's gene for plant virus.
Advantageous effect
The present invention relates to a kind of big flux screening plant positive sense RNA virus to replicate, moves relevant required host's gene
Method.This method can disposably carry out the screening of mass mutation body, therefore can save a large amount of time, experiment material and funds,
Improve efficiency.
Description of the drawings
Fig. 1 induction type TuMV infectious clone carriers XVE::TuMV-GFP Vector maps.
Fig. 2 induction type PVX infectious clone carriers XVE::PVX-GFP Vector maps.
Specific implementation mode
LB culture mediums:Tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, PH7.5;
LB solid mediums:Every liter of LB liquid medium adds 15g~20g agar powders;
MS solid mediums:Purchased from PhytoTech companies of the U.S., article No.:M401;
Gibson Assembly Master Mix kits are bought from NEB Biolabs companies, article No.:E2611;
Escherichia coli Trans10 competent cells are bought from Quan Shijin Bioisystech Co., Ltd, article No.:CD101;
The extraction of EasyPure Plasmid MiniPrep Kit kits is bought from Quan Shijin Bioisystech Co., Ltd,
Article No.:EM101;
The extraction of EasyPure PCR Purification Kit kits is bought from Quan Shijin Bioisystech Co., Ltd,
Article No.:EP101;
Estrogen derivant is bought from Sigma-Aldrich, article No.:E8875;
Herbicide is bought from Beijing Ku Laibo Science and Technology Ltd.s, article No.:CB2471;
Growth chamber is bought from Wuhan Rui Hua instrument and equipments Co., Ltd, article No.:AR1200 is used for cultivating quasi-
The condition of southern mustard is:Photoperiod is illumination in 18 hours, 6 hours dark;Temperature is 23 DEG C;
Black light lamp is bought from UVP companies of the U.S., article No. UVGL-55;
Other reagents or instrument unless otherwise specified, can be bought by existing commercialization approach and be obtained.
Embodiment 1:The method that big flux screening Brassica 2 et 4 replicates required host's gene.
Step 1. induction type Brassica 2 et 4 (Turnip mosaic virus, TuMV) infectivity expression vector establishment.
1) in order to which more intuitive simplicity has the genetically modified crops offspring of induction type viral vectors to screen conversion, this reality
It is template to apply example and utilize the TuMV infectivity plasmids pCambia-TuMV-GFP with green fluorescent label gene GFP labels, should
One is contained in pCambia-TuMV-GFP plasmids between encoding P1 and HcPro albumen inserted with encoding green fluorescent protein
(GFP) the TuMV genomes (TuMV-GFP) of sequence, are shown in SEQ ID NO:Shown in 11, the infectivity plasmid pCambia-
TuMV-GFP is documented in Cotton S, Grangeon R, Thivierge K, et al., 2009.Turnip mosaic virus
RNA replication complex vesicles are mobile,align with microfilaments,and are
each derived from a single viral genome.J Virol 83,10460-71。
Fluorescent marker gene is not added, can equally realize the performance of above-mentioned vector construction and function vector, mutant
It identifies then after Genetic Transformation in Higher Plants, using corresponding screening pressure or inductive condition (such as the screening of herbicide or estrogen
Under induction) it is carried out by the methods of character analysis and Molecular Detection.
With following primer sequence is denoted as to carrying out PCR reactions, the sequence between amplification TuMV-GFP genomes 1-6487nt
A, including the segment total size of estrogen-inducible promoter sequence is 6507bp.
The primer pair is:
Primer 1:(lower-case portion is 5 '-gttcatttcatttggagaggAAAAAATATAAAAACTCAACATAAC-3 '
Estrogen-inducible promoter sequence);
Primer 2:5′-TTGATGGTGAACTGCCTCAAGAGC-3′;
With following primer to carrying out PCR reactions, TuMV genome 6464-10578nt and polyA sequences are expanded, are denoted as
Sequence B, including the segment total size of TuMV-GFP genome polyA sequences and pMDC sequences are 4213bp.
The primer pair is:
Primer 3:5′-GCTCTTGAGGCAGTTCACCATCAA-3′;
Primer 4:(upper-case portion comes from 5 '-gacgaaagctgggaggcctgGTCGACTCTAGGGGGATCCGA-3 '
PCambia-TuMV-GFP plasmids, lower-case portion come from pMDC7);
Above-mentioned PCR reaction conditions are:95 DEG C of pre-degeneration 3min, into PCR cycle:95 DEG C of denaturation 15sec, 65 DEG C of annealing
10sec, 72 DEG C of extension 3.30min, 30 cycles;Last 72 DEG C of extensions 7min.
It is detected with 1% agarose gel electrophoresis after PCR reactions and recycles PCR product.The PCR product recycling is using complete
The EasyPure PCR Purification Kit kits of Shi Jin Bioisystech Co., Ltd.
2) using the plant binary expression vector pMDC7 with estrogen-inducible promoter XVE as masterplate, which records
In Curtis MD, Grossniklaus U, 2003.A gateway cloning vector set for high-
throughput functional analysis of genes in planta.Plant Physiol 133,462-9。
With following primer to carrying out PCR reactions, expand in pMDC7 comprising XVE inducible promoters, plant hygromycin selection
Gene, agrobatcerium T-DNA left margin, Escherichia coli and Agrobacterium replicate and resistance screening sequence, Agrobacterium T DNA right margins with
And sequence between T3A terminators, it is denoted as sequence C, clip size 11447bp.
The primer pair is:
Primer 5:5′-cctctccaaatgaaatgaacttc-3′;
Primer 6:5′-caggcctcccagctttcgtccgtatc-3′.
PCR reaction conditions:95 DEG C of pre-degeneration 3min, into PCR cycle:95 DEG C of denaturation 15sec, 65 DEG C of 10sec that anneal, 72
DEG C extend 6min, 30 cycle;Last 72 DEG C of extensions 7min.
3) with reference to Gibson Assembly Master Mix kit specifications, using the method for homologous recombination by sequence
A, sequence B and sequence C are spliced into an induction type TuMV infectious clone carrier, and sequence D is named as XVE::TuMV-GFP is shown in
Shown in Fig. 1, wherein plant hygromycin selection gene order is located inside inducible promoter XVE, hygromycin gene upstream
Promoter be estrogen-inducible promoter XVE-1, sequence such as SEQ ID NO:Shown in 8;On TuMV full length cDNA sequences
The promoter of trip is estrogen-inducible promoter XVE-2, sequence such as SEQ ID NO:Shown in 9;The full-length cDNA position of TuMV
Between XVE inducible promoter XVE-2 and T3A terminators, 1229-1972nt in the full-length cDNA of TuMV-GFP, altogether
744nt, for the GFP fluorescent marker genes of insertion, agrobatcerium T-DNA right margin RB is located at estrogen-inducible promoter XVE-1
Upstream, agrobatcerium T-DNA left margin LB are located at the downstreams eukaryotic transcription terminator T3A.
The 258-1709bp of wherein XVE-1 encodes a manual transcription factor, and the manual transcription factor is by large intestine bar
The DNA binding structural domains of bacterium LexA albumen, 3 part group of the protein transcription activation structure domains VP16 and human estrogen receptor structural domain
At.The DNA binding structural domains of LexA albumen have the function of identifying XVE-2 sequences, the protein transcription activation structure domains VP16 and people
Oestrogen receptor domain component part has estrogen-dependent transcriptional activation function, i.e., can be with initial when combining estrogen
The transcription of TuMV full-length cDNAs gene after XVE-2.
The agrobatcerium T-DNA left margin LB, sequence such as SEQ ID NO:Shown in 1;Agrobatcerium T-DNA right border sequence
RB, sequence such as SEQ ID NO:Shown in 2;Escherichia coli and Agrobacterium replicate required element, sequence such as SEQ ID NO:3 institutes
Show;The full-length cDNA of TuMV, sequence such as SEQ ID NO:Shown in 4;Estrogen-inducible promoter XVE, sequence such as SEQ
ID NO:Shown in 6;Resistance screening gene hygromycin gene, sequence such as SEQ ID NO:Shown in 7;Estrogen-inducible promoter
XVE-1, sequence such as SEQ ID NO:Shown in 8;Estrogen-inducible promoter XVE-2, sequence such as SEQ ID NO:9 institutes
Show;Eukaryotic transcription terminator T3A, sequence such as SEQ ID NO:Shown in 10.
By XVE::TuMV-GFP carriers convert in Escherichia coli Trans10 competent cells, and operating method is said according to product
Bright book carries out.After conversion, the LB solids training containing kanamycins (final concentration of 50 μ g/ml) is applied to after being cultivated 1 hour in 37 DEG C
Support base, 37 DEG C of overnight incubation cultures.
With bacterium colony PCR screening positive clones.Bacterium colony PCR reaction primer pair used is:Primer 7:5′-
ggctttcaagcgccagtgcgag-3′;Primer 8:5′-gaagtgctcttgcacaagggtg-3′;The target fragment of amplification is big
Small is 824bp.
Bacterium colony PCR reaction systems are 50 μ L, wherein 2 × Taq PCR mix, 25 μ L, 8 each 1 μ L of primer 7 and primer, masterplate
For the escherichia coli cloning of conversion, remaining is aqua sterilisa.Reaction condition:94 DEG C of pre-degeneration 3min, into PCR cycle:94 DEG C of changes
Property 30sec, 60 DEG C annealing 20sec, 72 DEG C extension 1min, 30 cycle;Last 72 DEG C of extensions 7min.
The positive colony of acquisition, with the LB liquid medium containing kanamycins (final concentration of 50 μ g/ml), 37 DEG C overnight
Culture, EasyPure Plasmid MiniPrep Kit kits extract plasmid, serve Hai Sheng works Bioisystech Co., Ltd into
Row sequencing identifies that correct plasmid is named as XVE::TuMV-GFP, i.e. induction type Brassica 2 et 4 (Turnip
Mosaic virus, TuMV) infectivity expression vector.
The genetic transformation of step 2. induction type Brassica 2 et 4 (TuMV) infectivity expression vector
1) reference《Molecular Cloning:A Laboratory guide》, with electric shocking method by XVE::TuMV-GFP imports Agrobacterium GV3101 strains
(purchased from Beijing Hua Yue ocean biology), is coated on after conversion containing final concentration of 50 μ g/ml kanamycins and final concentration of 100 μ g/
On the LB solid mediums of ml rifampins, 28 DEG C culture to grow clone.6 clones of random picking carry out PCR detections, reactant
System, reaction condition isogeneous induction type Brassica 2 et 4 (Turnip mosaic virus, TuMV) infectious clone construction step 1
In 3) described in bacterium colony PCR.
2) with containing XVE::The Agrobacterium of TuMV-GFP plasmids impregnates arabidopsis Colombia type environmental (Col-0) flower
After sequence 10sec, growth chamber is put back to until solid, the seed for the inflorescence that collection is handled through Agrobacterium.The arabidopsis dips in flower
Method for transformation is with reference to Clough SJ, Bent AF, 1998.Floral dip:a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana.The Plant
journal:for cell and molecular biology 16,735-43.。
3) reference Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A,
2006.A rapid and robust method of identifying transformed Arabidopsis
thaliana seedlings following floral dip transformation.Plant Methods 2,
19.Takahashi Y,Takahashi T,Uyeda I,1997.A cDNA clone to clover yellow vein
The arabidopsis seed that potyvirus genome is highly infectious.Virus genes 14,235-43. are provided
The arabidopsis seed of collection is after 10% hydrogen peroxide carries out disinfection by the method for disinfection and screening with volume fraction, and tiling is to containing
On the MS solid mediums for having the final concentration of 15mg/L of hygromycin, after putting to 4 DEG C of vernalization 2 days 22 DEG C of plant incubator cultures into
Row illumination in 6 hours, dark, illumination in 1 day photoperiod processing in 2 days, filter out resistant plant, acquisition turns XVE::TuMV-GFP's
Arabidopsis positive plant.
4) positive plant is transferred in cultivation soil, plantation is to solid, then carries out the screening of the second generation and the sieve of the third generation
Choosing, until obtaining the homozygous third generation genetically modified plants no longer detached, the screening of the second generation, the third generation is the same as the first generation
Screening technique.
TuMV replicates the big flux screening of required host's gene in step 3. arabidopsis
1) with from arabidopsis Bio-Centers (ABRC;https://www.arabidopsis.org) purchase pDAP101 matter
Grain converts Agrobacterium GV3101 strains, and Herbicid resistant is carried in the pDAP101, between D-DNA right boundary sequences,
The same reference of concrete operations《Molecular Cloning:A Laboratory guide》, electric shocking method conversion Agrobacterium.
2) using step 2 obtain transgenic arabidopsis as material, in step 2 2) described in method, conversion is had
The Agrobacteriums of pDAP101 plasmids carries out the ecotypic conversions of arabidopsis Col-0, and to after solid, collection is handled through Agrobacterium for culture
Inflorescence seed;
3) 2) after the arabidopsis seed of middle collection being soaked in water, after 4 DEG C of placement vernalization 2 days, directly sowing is native to cultivation
In, it is sprayed with the herbicide basta aqueous solution of 10mg/L after all germinateing and (every other day sprays once, spray 3 altogether
It is secondary), transfer-gen plant of the screening with antiweed Basta resistances obtains a large amount of anti-transgenic arabidopsis generation seeds;By institute
There is generation seed to be planted, and collects second generation seed, structure Arabidopsis Mutants library.
4) according in step 2 3) described in the second generation seed collected of method processing, tiling is on MS solid mediums, 22
DEG C illumination cultivation sprays 1 times/day to germinateing with the estrogen aqueous solution derivant of 10mg/L, is sprayed in the daily same time, even
It is 2 days continuous, Brassica 2 et 4 genomic expression is induced using estrogen derivant, is sieved under dark condition with black light lamp after 2 weeks
The Arabidopsis Mutants for selecting no GFP expression, are transferred in cultivation soil, plant to solid.
5) 4) the middle Arabidopsis Mutants that obtain are planted to blooming, the ripe flower shears for exposing petal is gone, is left
Calyx, petal, stamen are all removed with tip tweezers, only leave with pistillate ovary, carefully handling by also immature flower
The ripe flower from wildtype Arabidopsis thaliana orchid moral Burger environmental (Ler) is buckled in complete ovary, allows Col-0 arabidopsis mutants
The ovum of body and the pollen of Ler are hybridized, and hybrid seed is obtained;All first generation seeds are planted, and collect second
For seed, structure filial generation group.
6) 5) the middle progeny population that obtains is planted, every plant of individually sampling, using full formula gold biotechnology
EasyPure Plant Genomic DNA Kit extraction genomic DNAs, reference Li Q, Shen WY, Zheng Q, Tan YF,
Gao J,Sheng JX,Wei YD,Kunst L,Zou JT.2017.Effects of eIFiso4G1mutation on
seed oil biosynthesis.Plant J,90(5):966-978, by the method for map based cloning and genome sequencing,
The position positioning of target gene is carried out, when detecting the gene for inserting the sequences of the T-DNA with herbicide resistance gene, then really
Fixed its replicates required host's gene for plant virus.
The method that 2. big flux screening potato virus X of embodiment replicates required host's gene.
Embodiment 1 is repeated, is with the difference of embodiment 1, the induction type viral infectivity clone described in the present embodiment
For potato virus X (Potato virus X, PVX) infectious clone with GFP labels:With the Ma Ling with GFP labels
Potato X viral infectivities clone is masterplate (PVX.GFP-2A-CP), sees SEQ ID NO:Shown in 12, the infectivity plasmid is recorded
In Cruz SS, Chapman S, Roberts AG, Roberts IM, Prior DAM, Oparka KJ.1996.Assembly
and movement of a plant virus carrying a green fluorescent protein
overcoat.Proc.Natl.Acad.Sci.USA,93:6286-6290. primers 9 and primer 10 expand 1-3953nt sequences,
It is denoted as sequence E (including estrogen-inducible promoter partial sequence, total length 3973nt), is expanded with primer 11 and primer 12
3933-3987nt sequences are denoted as sequence F (including T3A terminators partial sequence in polyA and pMDC7 carriers, total length
3109nt)。
Fluorescent marker gene is not added, can equally realize the performance of above-mentioned vector construction and function vector, mutant
Identification then by character analysis and is divided after Genetic Transformation in Higher Plants using corresponding inductive condition (under the induction of such as estrogen)
Son detection the methods of come carry out.
Primer 9:5 '-gttcatttcatttggagaggGAAAACTAAACCATACACCACCAACACAACC-3 ' (small letters
Part is estrogen-inducible promoter sequence);
Primer 10:GATAACGTGCCTAGGAAAATCTG
Primer 11:GATTTTCCTAGGCACGTTATC
Primer 12:(upper-case portion comes from 5 '-gacgaaagctgggaggcctgGGAAATTCGCGGTACCCACTAG-3 '
In PVX.GFP-2A-CP plasmids, lower-case portion comes from pMDC7)
With reference to Gibson Assembly Master Mix kit specifications, using homologous recombination method by sequence E,
Sequence F and sequence C are spliced into an induction type PVX infectious clone carrier, are named as XVE::PVX-GFP, as shown in Figure 2, with
1 difference of embodiment is that in the present embodiment in constructed induction type PVX infectious clone carriers, plant positive sense RNA virus is complete
Long cDNA is the full-length cDNA of potato virus X, sequence such as SEQ ID NO:Shown in 5.In the full-length cDNA of PVX-GFP
5671-6210nt, total 540nt, for the GFP fluorescent marker genes of insertion.
The plant of conversion is tobacco, the XVE described in step 2::PVX passes through agrobacterium mediation converted to tobacco
In (Nicotiana tobacum) cell, specific method is with reference to Zhao Li, Zhong Ming, Ma Hui, Li Haoge, Chen Lijing, stroke .2011.
The foundation of agriculture bacillus mediated tobacco efficient genetic trasformation system, Jiangsu's agriculture science .39 (3):67-68,74;In step 3) into
Row, when PVX replicates the big flux screening of indispensable gene, mutant library will use EMS revulsions;The method according to Shi Yuewei,
The brave .2009. gamma-rays of Ren Xueliang, Wang Yi, Sun Yanxia, Wu Xiao and the mutagenesis that EMS is single and combined processing is to tobacco seed vigor
Effect Guizhou Agricultural Sciences, 12:The method of 62-65, description carry out.The mutant library of structure is without herbicide screening, directly
Estrogen aqueous solution (15mg/L) induction expressing viral is sprayed, is sprayed once in the daily identical time, continuous 2 days, 2 Zhou Houyong
Black light lamp screens the tobacco mutant body of no GFP expression under dark condition, is transferred in cultivation soil, plants to solid.Hybridization
Tobacco used is three lives cigarette (Nicotiana tobacci cv.Samsun).Remaining method is with reference to embodiment 1.
By the method for map based cloning and genome sequencing, the position positioning of target gene is carried out, when detecting the base
Because with reference gene (sequence do not change before gene) nucleotide sequence compared to carrying and coded amino acid can be caused to change
Or the coding mutation that coded amino acid terminates in advance, it is determined that it replicates required host's gene for plant virus.
Using identical strategy and method, big flux screening plant virus of the present invention replicates required host's gene
Method is suitable for other potyvirus in addition to Brassica 2 et 4 (TuMV) and potato virus X (PVX)
With potexvirus virus.The potyvirus includes TuMV, marmor upsilon (Potato virus
Y, PVY;Genbank accession number:NC_001616.1), marmor solani (Potato virus A, PVA;Genbank is logged in
Number:NC_004039.1), plumpox virus (Plum pox virus, PPV;Genbank accession number:NC_001445.1), papaya
Ring spot virus (Papaya ring spot virus, PRSV;Genbank accession number:NC_001785.1), soybean mosaic virus
(Soybean mosaic virus, SMV;Genbank accession number:) and marmor erodens (Tobacco NC_002634.1
Etch virus, TEV;Genbank accession number:NC_001555.1);The potexvirus virus includes PVX, Ma Ling
Potato Ao Guba mosaic virus (Potato aucuba mosaic virus, PAMV;Genbank accession number:NC_003632.1),
Garcinia mangostana mosaic virus (Pepino mosaic virus, PepMV;Genbank accession number:NC_004067.1), Asiatic plantain floral leaf
Virus (Plantago asiatica mosaic virus, PlAMV;Genbank accession number:) and foxtail NC_003849.1
Mosaic virus (Foxtail mosaic virus, FoMV;Genbank accession number:NC_001483.1).
The genome cDNA overall length of above-mentioned virus is obtained by PCR amplification, with reference to step 1 institute in embodiment 1 and embodiment 2
The method stated is terminated using homologous recombination technique structure containing inducible promoter, plant positive sense RNA virus cDNA and T3A
The induction type viral infectivity expression vector of son.
With reference to apply 2 step 2 of example 1 and embodiment, the method described in 3 screens the plant virus and replicates required host's gene.
Present approach provides a kind of methods that big flux screening plant virus replicates required host's gene, using we
Method can be achieved at the same time is carried out at the same time screening to a large amount of (10,000 plants or more plants).Every plant of carry out machinery of mutant is connect originally relatively
The method of kind, can greatly improve screening efficiency.
Sequence table
<110>Northeast Agricultural University
<120>A kind of method that big flux screening plant virus replicates required host's gene
<130>
<160> 24
<170> PatentIn version 3.5
<210> 1
<211> 24
<212> DNA
<213>Agrobatcerium T-DNA left margin
<400> 1
gtttacacca caatatatcc tgcca 25
<210> 2
<211> 26
<212> DNA
<213>Agrobatcerium T-DNA right border sequence
<400> 2
gtttacccgc caatatatcc tgtcaa 26
<210> 3
<211> 6510
<212> DNA
<213>Escherichia coli and Agrobacterium replicate the sequence of required element
<400> 3
ccagccagcc aacagctccc cgaccggcag ctcggcacaa aatcaccact cgatacaggc 60
agcccatcag tccgggacgg cgtcagcggg agagccgttg taaggcggca gactttgctc 120
atgttaccga tgctattcgg aagaacggca actaagctgc cgggtttgaa acacggatga 180
tctcgcggag ggtagcatgt tgattgtaac gatgacagag cgttgctgcc tgtgatcaat 240
tcgggcacga acccagtgga cataagcctc gttcggttcg taagctgtaa tgcaagtagc 300
gtaactgccg tcacgcaact ggtccagaac cttgaccgaa cgcagcggtg gtaacggcgc 360
agtggcggtt ttcatggctt cttgttatga catgtttttt tggggtacag tctatgcctc 420
gggcatccaa gcagcaagcg cgttacgccg tgggtcgatg tttgatgtta tggagcagca 480
acgatgttac gcagcagggc agtcgcccta aaacaaagtt aaacatcatg ggggaagcgg 540
tgatcgccga agtatcgact caactatcag aggtagttgg cgtcatcgag cgccatctcg 600
aaccgacgtt gctggccgta catttgtacg gctccgcagt ggatggcggc ctgaagccac 660
acagtgatat tgatttgctg gttacggtga ccgtaaggct tgatgaaaca acgcggcgag 720
ctttgatcaa cgaccttttg gaaacttcgg cttcccctgg agagagcgag attctccgcg 780
ctgtagaagt caccattgtt gtgcacgacg acatcattcc gtggcgttat ccagctaagc 840
gcgaactgca atttggagaa tggcagcgca atgacattct tgcaggtatc ttcgagccag 900
ccacgatcga cattgatctg gctatcttgc tgacaaaagc aagagaacat agcgttgcct 960
tggtaggtcc agcggcggag gaactctttg atccggttcc tgaacaggat ctatttgagg 1020
cgctaaatga aaccttaacg ctatggaact cgccgcccga ctgggctggc gatgagcgaa 1080
atgtagtgct tacgttgtcc cgcatttggt acagcgcagt aaccggcaaa atcgcgccga 1140
aggatgtcgc tgccgactgg gcaatggagc gcctgccggc ccagtatcag cccgtcatac 1200
ttgaagctag acaggcttat cttggacaag aagaagatcg cttggcctcg cgcgcagatc 1260
agttggaaga atttgtccac tacgtgaaag gcgagatcac caaggtagtc ggcaaataat 1320
gtctagctag aaattcgttc aagccgacgc cgcttcgccg gcgttaactc aagcgattag 1380
atgcactaag cacataattg ctcacagcca aactatcagg tcaagtctgc ttttattatt 1440
tttaagcgtg cataataagc cctacacaaa ttgggagata tatcatgcat gaccaaaatc 1500
ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 1560
tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 1620
ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 1680
ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 1740
ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 1800
gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 1860
aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 1920
acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 1980
gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 2040
gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga 2100
cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 2160
aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct 2220
gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 2280
cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgcctg 2340
atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatatg gtgcactctc 2400
agtacaatct gctctgatgc cgcatagtta agccagtata cactccgcta tcgctacgtg 2460
actgggtcat ggctgcgccc cgacacccgc caacacccgc tgacgcgccc tgacgggctt 2520
gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc 2580
agaggttttc accgtcatca ccgaaacgcg cgaggcaggg tgccttgatg tgggcgccgg 2640
cggtcgagtg gcgacggcgc ggcttgtccg cgccctggta gattgcctgg ccgtaggcca 2700
gccatttttg agcggccagc ggccgcgata ggccgacgcg aagcggcggg gcgtagggag 2760
cgcagcgacc gaagggtagg cgctttttgc agctcttcgg ctgtgcgctg gccagacagt 2820
tatgcacagg ccaggcgggt tttaagagtt ttaataagtt ttaaagagtt ttaggcggaa 2880
aaatcgcctt ttttctcttt tatatcagtc acttacatgt gtgaccggtt cccaatgtac 2940
ggctttgggt tcccaatgta cgggttccgg ttcccaatgt acggctttgg gttcccaatg 3000
tacgtgctat ccacaggaaa gagacctttt cgaccttttt cccctgctag ggcaatttgc 3060
cctagcatct gctccgtaca ttaggaaccg gcggatgctt cgccctcgat caggttgcgg 3120
tagcgcatga ctaggatcgg gccagcctgc cccgcctcct ccttcaaatc gtactccggc 3180
aggtcatttg acccgatcag cttgcgcacg gtgaaacaga acttcttgaa ctctccggcg 3240
ctgccactgc gttcgtagat cgtcttgaac aaccatctgg cttctgcctt gcctgcggcg 3300
cggcgtgcca ggcggtagag aaaacggccg atgccgggat cgatcaaaaa gtaatcgggg 3360
tgaaccgtca gcacgtccgg gttcttgcct tctgtgatct cgcggtacat ccaatcagct 3420
agctcgatct cgatgtactc cggccgcccg gtttcgctct ttacgatctt gtagcggcta 3480
atcaaggctt caccctcgga taccgtcacc aggcggccgt tcttggcctt cttcgtacgc 3540
tgcatggcaa cgtgcgtggt gtttaaccga atgcaggttt ctaccaggtc gtctttctgc 3600
tttccgccat cggctcgccg gcagaacttg agtacgtccg caacgtgtgg acggaacacg 3660
cggccgggct tgtctccctt cccttcccgg tatcggttca tggattcggt tagatgggaa 3720
accgccatca gtaccaggtc gtaatcccac acactggcca tgccggccgg ccctgcggaa 3780
acctctacgt gcccgtctgg aagctcgtag cggatcacct cgccagctcg tcggtcacgc 3840
ttcgacagac ggaaaacggc cacgtccatg atgctgcgac tatcgcgggt gcccacgtca 3900
tagagcatcg gaacgaaaaa atctggttgc tcgtcgccct tgggcggctt cctaatcgac 3960
ggcgcaccgg ctgccggcgg ttgccgggat tctttgcgga ttcgatcagc ggccgcttgc 4020
cacgattcac cggggcgtgc ttctgcctcg atgcgttgcc gctgggcggc ctgcgcggcc 4080
ttcaacttct ccaccaggtc atcacccagc gccgcgccga tttgtaccgg gccggatggt 4140
ttgcgaccgt cacgccgatt cctcgggctt gggggttcca gtgccattgc agggccggca 4200
gacaacccag ccgcttacgc ctggccaacc gcccgttcct ccacacatgg ggcattccac 4260
ggcgtcggtg cctggttgtt cttgattttc catgccgcct cctttagccg ctaaaattca 4320
tctactcatt tattcatttg ctcatttact ctggtagctg cgcgatgtat tcagatagca 4380
gctcggtaat ggtcttgcct tggcgtaccg cgtacatctt cagcttggtg tgatcctccg 4440
ccggcaactg aaagttgacc cgcttcatgg ctggcgtgtc tgccaggctg gccaacgttg 4500
cagccttgct gctgcgtgcg ctcggacggc cggcacttag cgtgtttgtg cttttgctca 4560
ttttctcttt acctcattaa ctcaaatgag ttttgattta atttcagcgg ccagcgcctg 4620
gacctcgcgg gcagcgtcgc cctcgggttc tgattcaaga acggttgtgc cggcggcggc 4680
agtgcctggg tagctcacgc gctgcgtgat acgggactca agaatgggca gctcgtaccc 4740
ggccagcgcc tcggcaacct caccgccgat gcgcgtgcct ttgatcgccc gcgacacgac 4800
aaaggccgct tgtagccttc catccgtgac ctcaatgcgc tgcttaacca gctccaccag 4860
gtcggcggtg gcccatatgt cgtaagggct tggctgcacc ggaatcagca cgaagtcggc 4920
tgccttgatc gcggacacag ccaagtccgc cgcctggggc gctccgtcga tcactacgaa 4980
gtcgcgccgg ccgatggcct tcacgtcgcg gtcaatcgtc gggcggtcga tgccgacaac 5040
ggttagcggt tgatcttccc gcacggccgc ccaatcgcgg gcactgccct ggggatcgga 5100
atcgactaac agaacatcgg ccccggcgag ttgcagggcg cgggctagat gggttgcgat 5160
ggtcgtcttg cctgacccgc ctttctggtt aagtacagcg ataaccttca tgcgttcccc 5220
ttgcgtattt gtttatttac tcatcgcatc atatacgcag cgaccgcatg acgcaagctg 5280
ttttactcaa atacacatca cctttttaga cggcggcgct cggtttcttc agcggccaag 5340
ctggccggcc aggccgccag cttggcatca gacaaaccgg ccaggatttc atgcagccgc 5400
acggttgaga cgtgcgcggg cggctcgaac acgtacccgg ccgcgatcat ctccgcctcg 5460
atctcttcgg taatgaaaaa cggttcgtcc tggccgtcct ggtgcggttt catgcttgtt 5520
cctcttggcg ttcattctcg gcggccgcca gggcgtcggc ctcggtcaat gcgtcctcac 5580
ggaaggcacc gcgccgcctg gcctcggtgg gcgtcacttc ctcgctgcgc tcaagtgcgc 5640
ggtacagggt cgagcgatgc acgccaagca gtgcagccgc ctctttcacg gtgcggcctt 5700
cctggtcgat cagctcgcgg gcgtgcgcga tctgtgccgg ggtgagggta gggcgggggc 5760
caaacttcac gcctcgggcc ttggcggcct cgcgcccgct ccgggtgcgg tcgatgatta 5820
gggaacgctc gaactcggca atgccggcga acacggtcaa caccatgcgg ccggccggcg 5880
tggtggtgtc ggcccacggc tctgccaggc tacgcaggcc cgcgccggcc tcctggatgc 5940
gctcggcaat gtccagtagg tcgcgggtgc tgcgggccag gcggtctagc ctggtcactg 6000
tcacaacgtc gccagggcgt aggtggtcaa gcatcctggc cagctccggg cggtcgcgcc 6060
tggtgccggt gatcttctcg gaaaacagct tggtgcagcc ggccgcgtgc agttcggccc 6120
gttggttggt caagtcctgg tcgtcggtgc tgacgcgggc atagcccagc aggccagcgg 6180
cggcgctctt gttcatggcg taatgtctcc ggttctagtc gcaagtattc tactttatgc 6240
gactaaaaca cgcgacaaga aaacgccagg aaaagggcag ggcggcagcc tgtcgcgtaa 6300
cttaggactt gtgcgacatg tcgttttcag aagacggctg cactgaacgt cagaagccga 6360
ctgcactata gcagcggagg ggttggatca aagtactttg atcccgaggg gaaccctgtg 6420
gttggcatgc acatacaaat ggacgaacgg ataaaccttt tcacgccctt ttaaatatcc 6480
gttattctaa taaacgctct tttctcttag 6510
<210> 4
<211> 9834
<212> DNA
<213>The full-length cDNA of Brassica 2 et 4 TuMV(Without polyA tails)
<400> 4
aaaaaatata aaaactcaac ataacataca caaaacgatt aaagcaaaca caaatctttc 60
aaagcattca agcaatcaaa gattctcaaa tctttcatcg ttatcaaagc aatcaccaac 120
agcaaaccaa atggcagcag ttacattcgc atcagctatc accaacgcca tcaccagcaa 180
accagcactc accggaatgg tgcagtttgg gagtttccca ccaatgccat tgcgatccac 240
caccgtcacc acagtcgcca cttcagtggc gcaacctaaa ctgtacacag tgcagtttgg 300
aagccttgac ccagtagtcg tcaagagtgg agcagggtcc cttgctaagg caacacgcca 360
gcagcctaac gttgaaatag acgttagcct cagtgaagcc gcagctctgg aggttgcgaa 420
acctagatcg aatgccgtgt tgaggatgca cgaggaagca aacaaggaga gagcactctt 480
tttggactgg gaggctagtt tgaagagaag ctcgtatgga attgctgagg acgagaaggt 540
tgtaatgaca actcatggcg tcagcaagat agtgcccaga agttcaaggg caatgaagct 600
aaagcgcgca agggagaggc gtagagcgca gcaaccaatt atattaaagt gggagcccaa 660
attgagcggg atctcaatcg gaggagggct ctctgcgagc gtaatcgaag cagaagaggt 720
tcgcacaaag tggccgcttc ataagacacc gtcaatgaag aagaggacgg tgcacagaat 780
atgcaagatg aacgaccaag gagttgacat gttgacacga tccctggtta agattttcaa 840
gactaagagt gccaacattg aatacatcgg aaagaagtcg attaaggtcg atttcatcag 900
aaaagaacga acgaaattcg caagaatcca agtagcacac ttactcggga agagagcaca 960
gcgcgacttg ttaactggaa tggaagaaaa ccattttatt gacattctca gtaagtactc 1020
aggtaacaaa acaaccataa atcctggagt agtttgcgca ggttggagtg gcatagtcgt 1080
tggaaatgga attctaaccc agaaacgaag cagaagtcca tcagaggcct ttgtaattag 1140
aggtgagcac gaaggcaagt tgtacgatgc caggatcaaa gtcacgagga caatgagtca 1200
caagattgtg cactttagtg ccgcgggagc caacttctgg aaaggcttcg acagatgctt 1260
tctcgcatac cgtagtgaca atcgcgagca tacatgctat tcagggctag atgtcactga 1320
gtgcggcgag gtggcagcac tgatgtgttt ggctatgttc ccatgcggaa agataacctg 1380
ccctgactgt gtaacagata gtgagctatc ccaaggacaa gcaagcggac catctatgaa 1440
gcacaggttg acacagctac gcgatgtcat caagtcaagc tacccacgct tcaagcatgc 1500
agtgcagata ctagataggt atgagcaatc actgagcagt gcaaacgaga actaccaaga 1560
tttcgcagaa atccagagca taagcgatgg agttgaaaaa gctgcattcc cacacgtcaa 1620
caagctaaac gcaatattga tcaaaggggc cacagtaaca ggagaggaat tctcgcaggc 1680
tacgaagcac ttgctcgaga tagcacgata cctgaagaac agaaccgaga acattgagaa 1740
gggttcactg aagtcctttc gcaacaagat ttcccagaaa gcgcacatca acccaacact 1800
aatgtgtgac aaccagctcg atagaaatgg aaatttcata tggggtgaga gaggatacca 1860
tgcaaaacga ttcttcagca actactttga aataatcgat ccaaagaaag gctacaccca 1920
atacgagaca agagcggtac caaatgggtc acggaaactt gcaatcggca aactaatagt 1980
cccaacgaac ttcgaagttt taagggaaca gatgaaaggc gaaccggtag aaccataccc 2040
agtaacagtc gagtgtgtga gcaagttaca gggtgacttc gtccatgcat gttgttgtgt 2100
cacaacagaa tcaggcgacc cagtcttgtc tgagatcaaa atgccaacca aacaccatct 2160
agtgattggt aacagcggtg atccaaagta catagatctc cctgagatcg aggagaataa 2220
aatgtacata gcgaaagaag gttattgtta catcaatatc ttcctagcca tgttggtaaa 2280
tgtcaaggag tcgcaggcaa aggagttcac gaaagttgtt agggacaaac tagttggcga 2340
acttggcaag tggcccactc tgttagatgt agcaaccgct tgttatttcc tgaaagtatt 2400
ttacccagac gttgctaacg ccgaattgcc acgcatgcta gtggaccata agacaaagat 2460
aattcatgtc gttgattcat atgggtcact gtcaactgga tatcatgtcc ttaagacaaa 2520
cactgtggaa caactcatca aattcacgag atgtaatttg gagtcaagct tgaaacacta 2580
ccgcgttgga ggaacagaat gggaggacac tcatggatcc agcaacatag ataatccaca 2640
gtggtgcatc aagaggctca taaaaggagt ctacaaacca aagcaactga aagaagacat 2700
gttggcaaac cctttcttac cactatatgc tctactgtca ccaggtgtca tcctggcatt 2760
ttacaatagt ggctctctag agtacttgat gaaccattac atcagggtgg acagcaacgt 2820
cgccgttttg ttggtcgttt tgaaatctct agcgaagaag gtgtcaacta gtcagagtgt 2880
gttagcccag cttcaaatca ttgaacgaag tctaccagaa ctcatcgaag caaaggctaa 2940
tgttaatggg ccagatgacg cagccactcg cgcgtgtaac agattcatgg gcatgcttct 3000
gcatatggca gaaccaaact gggagcttgc ggatggtgga tacacaattc tgagggatca 3060
tagcatctcc attttggaaa aaagttatct acaaatcttg gacgaagcat ggaacgagtt 3120
aagttggtcg gagcgctgtg ctataagata ctactcgtca aagcaagcaa tctttacaca 3180
gaaagatttg ccaatgaaaa gcgaagccga tttaggcggc agatacagcg tgtcagtcat 3240
gtcatcttac gaacggagta agcaatgtat gaaaagcgtg cactctagta taggtaatag 3300
attacgtagt agtatgtctt ggactagtag caaggtgtcg aatagtgtgt gtaggactat 3360
taactattta gtaccagatg tgttcaagtt tatgaatgta ctcgtttgta tcagcttact 3420
aatcaagatg actgccgagg cgaatcacat cgtcaccacg caaagaaggc tcaaactaga 3480
tgtcgaggag acagagcgca ggaaaataga atgggagctt gcattccacc atgccattct 3540
gacgcagagt gcaggtcaac acccaacgat agacgagttc agagcgtaca tcgccgacaa 3600
ggcaccacat ctaagtgagc atatcgagcc tgaagaaaag gcggtggttc atcaagcgaa 3660
gagacaatcc gagcaagaac tcgagcgtat aatagcattt gttgcattgg tgctcatgat 3720
gttcgatgca gaacgaagcg actgtgtcac aaagattctc aacaagctta agggactagt 3780
cgccactgtg gaacctacag tctaccatca gactctcaat gatatagagg atgacttgag 3840
tgagaggaac ctcttcgtcg attttgagct tagcagcgat ggagatatgc tccaacagct 3900
tccagccgaa aagacatttg cctcatggtg gagtcatcaa ctaagcagag gattcacaat 3960
cccacactac aggacagaag ggaagttcat gactttcacc agagcaactg ccacggaagt 4020
cgcgggtaaa atagcacacg agagtgacaa agacatatta ctaatgggag cagtaggatc 4080
aggtaagtca actggcttgc catatcatct ctccagaaaa gggaacgtat tactccttga 4140
gccgactcgg ccacttgcag aaaacgtaca caagcagttg tcgcaggcac cgttccatca 4200
gaacacaact cttaggatgc gcggactaac agcattcggg tcggcaccaa tctcagtgat 4260
gaccagtggt tttgcactca attactttgc aaacaacaga atgcgaattg aagaatttga 4320
ctttgtcata tttgatgaat gtcacgttca tgacgccaat gcaatggcga tgagatgttt 4380
gctacatgag tgtgactatt ctggcaaaat tatcaaagtt tcagccacac caccaggtcg 4440
agaagttgag ttctccactc aataccccgt gtcgataagc acagaagaca cactatcgtt 4500
tcaggatttt gtgaacgcac agggtagtgg aagcaattgt gatgtgattt caaaaggaga 4560
caatatcctc gtgtatgtag caagctacaa tgaggtagac gcgctttcaa aacttctaat 4620
tgaaagagac ttcaaagtca cgaaggttga tggaagaacg atgaaagttg gaaacatcga 4680
gatcaccaca agtggaacac ctagtaagaa gcacttcata gttgcaacca acatcataga 4740
gaacggtgtt actctagaca tcgatgtggt tgctgatttt ggaacgaagg tactcccata 4800
tcttgataca gacagcagaa tgctgagcac aactaagaca agcatcaatt atggggaacg 4860
tatccaaagg ctaggaagag tcggaaggca caagccaggt cacgctctgc gaataggtca 4920
cacagagaag gggttgagcg aagttccaag ttgtattgca acagaagcag ctttaaagtg 4980
cttcacttat gggcttccag tgatcaccaa caacgtctcg acaagtattc ttggtaatgt 5040
aacggtaaag caggcacgaa caatgtctgt atttgagata acaccgttct acacaagcca 5100
agtggtgaga tatgatggct ccatgcatcc acaggtgcac gcactcttaa agagattcaa 5160
actcagagac tctgagattg ttttgaataa attagccata cctcaccgag gagtgaacgc 5220
ttggctcaca gctagtgagt atgcacgact tggcgcgaat gttgaagata ggcgtgacgt 5280
tcgaattcct tttatgtgtc gcgacatccc agaaaaactt catctagaca tgtgggatgt 5340
gattgttaaa ttcaaaggtg atgcaggttt tggtcggctt tcaagcgcca gtgcgagcaa 5400
ggtagcttat actctacaga cggacgtcaa ctccatacag cgaacagtca ctatcataga 5460
tacactaatc gctgaggaga gaaggaagca ggaatacttc aagacggtaa cctccaactg 5520
tgtctcttct tcgaacttct cactgcagag cataacaaat gcgataaaat ctcgtatgat 5580
gaaagatcac acgtgcgaga acatatcagt gcttgaagga gcgaagtcac agttactcga 5640
gtttagaaac ctgaatgctg atcactcatt tgctacaaaa accgatggaa tatctcggca 5700
tttcatgagt gagtatggag ctcttgaggc agttcaccat caaaacacca gcgacatgag 5760
caaattcctc aagcttaagg gcaaatggaa taaaacgcta atcacgcgag atgtgctggt 5820
actttgtgga gttcttggag gtggattgtg gatggttatt cagcacctgc ggtcaaagat 5880
gtccgaaccc gtaacccatg aagcgaaagg taagaggcaa aggcagaaac taaaatttcg 5940
caatgcccga gacaacaaaa tgggtagaga agtgtacgga gatgatgata ccatagagca 6000
tttcttcggt gatgcctaca caaagaaagg gaagagcaag ggtaggacac gtggtatcgg 6060
acacaaaaac aggaagttca tcaacatgta tgggtttgat cctgaagatt tctctgcagt 6120
tcgtttcgtg gatccactca caggagcgac gttggacgac aacccgctca cagacatcac 6180
ccttgtgcaa gagcacttcg gcaacataag aatggactta ctcggggagg atgagctgga 6240
ctcaaatgaa atacgtgtga ataagactat tcaagcctac tacatgaaca ataaaacagg 6300
caaggctttg aaggtggatc tgacaccaca catacctctc aaggtgtgtg atcttcacgc 6360
aaccattgct ggattcccag agcgagaaaa cgagctgagg cagactggaa aggctcagcc 6420
catcaacata gacgaagtgc caagagctaa caacgaactc gtcccagtgg accacgagag 6480
taactccatg ttcagagggt tgcgtgacta caacccaata tcaaacaaca tttgtcatct 6540
cacaaatgtt tcagatggag catcaaactc gttatatgga gtcggtttcg gaccactcat 6600
attaacgaac cgacacctct ttgagcggaa taacggtgaa ctcgtaataa aatcacgaca 6660
tggtgagttc gtgattaaaa acacaactca gctacacttg ctaccgattc cagacagaga 6720
tcttctgcta atccggttac caaaggacgt cccacccttt ccacagaaat tgggtttcag 6780
gcaacctgag aaaggtgaac gaatttgcat ggtggggtcc aatttccaaa ccaagagcat 6840
aacgagtata gtctctgaga ctagtacaat aatgccagtg gagaacagtc agttttggaa 6900
acactggatt agcactaaag acggccaatg cggaagtcca atggtgagca cgaaagacgg 6960
gaaaatactc ggattacaca gcctagcgaa cttccagaac tccatcaatt actttgctgc 7020
tttcccagat gattttgccg agaagtatct tcataccatt gaagcacacg agtgggtcaa 7080
gcactggaag tataacacta gcgccatcag ttggggctct ttgaatatac aagcatcgca 7140
accgtccggc ttgttcaaag taagcaagct aatctcagac ctcgacagca cggcagtcta 7200
cgcacaaacc cagcagaatc ggtggatgtt cgagcagctc aacgggaacc taaaagcgat 7260
agcacactgc cctagccagc ttgtgacaaa gcacacagtt aaaggaaaat gtcagatgtt 7320
tgacttgtat ctcaagttgc atgatgaagc acgagagtat ttccaaccga tgctgggcca 7380
gtatcaaaag agcaaactca atcgagaagc atatgcaaag gatcttctga aatatgcaac 7440
gccaatcgaa gcaggaaaca tcgactgtga tctgtttgaa aagacagttg aaatagtcgt 7500
atcagatctg cgaggttatg gtttcgaaac atgcaattat gtcactgatg agaatgacat 7560
attcgaagct cttaacatga aatccgcagt tggagcgttg tataaaggaa agaagaagga 7620
ttacttcgct gagttcacac ccgagatgaa agaagaaata ctgaaacaaa gttgtgaacg 7680
gctcttccta ggaaagatgg gagtgtggaa cggctcgctg aaggcagagt tgcgaccact 7740
agaaaaagtg gaagcaaaca aaacacggac gtttactgcc gcaccactag acacactgtt 7800
gggtggaaaa gtttgcgtgg atgatttcaa caaccagttc tatgatcaca accttagagc 7860
tccttggagc gttggcatga caaagtttta ttgtggttgg gatcgcttgt tggagtcgtt 7920
gccagatggt tgggtgtatt gcgatgctga tggctcacag ttcgacagct cgctatcgcc 7980
atacttgatc aacgcagtac tcaacatccg cttaggattc atggaagagt gggacatagg 8040
ggaggtaatg ctgagaaatt tgtacaccga aatcgtgtat acccctattt ctacaccaga 8100
tggtacactc gtcaagaagt tcaaaggaaa caatagcgga cagccatcga ctgttgtgga 8160
caacacgctc atggtcatat tggcagtcaa ctattcactc aagaaaagcg gaattccaag 8220
tgagttgcgc gacagcatca tcagattctt cgtcaacgga gatgatttac tgctaagcgt 8280
acacccagag tatgagtata ttcttgacac tatggcagac aactttcgtg aactgggcct 8340
gaagtatact ttcgactcaa gaaccaggga aaaaggagac ctctggttta tgtcgcacca 8400
ggggcacaaa agagagggaa tctggattcc caagctcgag ccagagcgaa tagtatcgat 8460
tctagaatgg gatcggtcga aagagccatg ccatcgacta gaggcaatct gcgcagcgat 8520
gattgagtcg tggggatacg acaagttaac tcacgagata cgcaagttct acgcgtggat 8580
gattgaacaa gctccattta gctccctagc acaagaaggg aaagctcctt acatagcgga 8640
aacagcgctg aggaagctct accttgataa ggaaccagct caagaggatc tcacccatta 8700
tttgcaagca atctttgagg attatgaaga tggtgctgag gcttgtgttt atcaccaggc 8760
aggtgaaacg cttgatgcag gtttgacaga cgagcaaaag caggcagaga aggagaagaa 8820
ggagagagag aaggcagaaa aggaacgaga gaggcaaaag cagttggcac tcaagaaagg 8880
caaggatgtt gcacaagaag agggaaaacg cgacaaggaa gtaaacgctg gaacctctgg 8940
aactttcagt gtacccagac tcaagagtct gacaagcaag atgcgcgtgc caagatacga 9000
gaaaagagtg gctctaaacc tcgatcatct aatcctatac acgccggagc agacggatct 9060
atccaacaca cgttcaacgc gaaagcagtt tgacacatgg tttgaaggtg taatggctga 9120
ttacgaactg acggaggaca aaatgcaaat cattctcaat ggtttaatgg tctggtgcat 9180
tgagaacgga accttcccga acataaacgg aatgtgggtg atgatggacg gcgacgatca 9240
ggtggaattc ccgatcaaac cgctcattga ccacgccaaa cccacattta ggcagataat 9300
ggcccatttc agtgacgtag ctgaagcgta cattgaaaag cgtaaccaag accgaccata 9360
catgccacga tatggtcttc agcgcaattt aaccgacatg agcttagctc gatacgcatt 9420
tgatttctat gaaatgactt ctaggactcc aatacgtgcg agagaggcac acatccagat 9480
gaaagcagca gcactgcgtg gcgcaaataa taatttgttc ggcttggatg gaaacgttgg 9540
tacaacggta gagaacacgg agaggcatac gaccgaggac gttaatcgga acatgcataa 9600
cttactgggc gttcaggggt tgtgaagttg tatgctggta gactataagt atttaagttt 9660
actcgttagt attctcgctt atgggaaata tgtaagtttg ttaaagcagc cagtgtgact 9720
ttgtcatgtg tgttgttgtt actttctgta ttttcgccga acattttatt ggtgttagcg 9780
catgtagtga ggatcgtcct cgattgcctt aacatttgat aggatgcaag ggac 9834
<210> 5
<211> 6443
<212> DNA
<213>The full-length cDNA of potato virus X(Without polyA tails)
<400> 5
gaaaactaaa ccatacacca ccaacacaac caaacccacc acgcccaatt gttacacacc 60
cgcttgaaaa agaaagttta acaaatggcc aaggtgcgcg aggtttacca atcttttaca 120
gactccacca caaaaactct catccaagat gaggcttata gaaacattcg ccccatcatg 180
gaaaaacaca aactagctaa cccttacgct caaacggttg aagcggctaa tgatctagag 240
gggttcggca tagccaccaa tccctatagc attgaattgc atacacatgc agccgctaag 300
accatagaga ataaacttct agaggtgctt ggttccatcc taccacaaga acctgttaca 360
tttatgtttc ttaaacccag aaagctaaac tacatgagaa gaaacccgcg gatcaaggac 420
attttccaaa atgttgccat tgaaccaaga gacgtagcca ggtaccccaa ggaaacaata 480
attgacaaac tcacagagat cacaacggaa acagcataca ttagtgacac tctgcacttc 540
ttggatccga gctacatagt ggagacattc caaaactgcc caaaattgca aacattgtat 600
gcgaccttag ttctccccgt tgaggcagcc tttaaaatgg aaagcactca cccgaacata 660
tacagcctca aatacttcgg agatggtttc cagtatatac caggcaacca tggtggcggg 720
gcataccatc atgaattcgc tcatctacaa tggctcaaag tgggaaagat caagtggagg 780
gaccccaagg atagctttct cggacatctc aattacacga ctgagcaggt tgagatgcac 840
acagtgacag tacagttgca ggaatcgttc gcggcaaacc acttgtactg catcaggaga 900
ggagacttgc tcacaccgga ggtgcgcact ttcggccaac ctgacaggta cgtgattcca 960
ccacagatct tcctcccaaa agttcacaac tgcaagaagc cgattctcaa gaaaactatg 1020
atgcagctct tcttgtatgt taggacagtc aaggtcgcaa aaaattgtga catttttgcc 1080
aaagtcagac aattaattaa atcatctgac ttggacaaat actctgctgt ggaactggtt 1140
tacttagtaa gctacatgga gttccttgcc gatttacaag ctaccacctg cttctcagac 1200
acactttctg gtggcttgct aacaaagacc cttgcaccgg tgagggcttg gatacaagag 1260
aaaaagatgc agctgtttgg tcttgaggac tacgcgaagt tagtcaaagc agttgatttc 1320
cacccggtgg atttttcttt caaagtggaa acttgggact tcagattcca ccccttgcaa 1380
gcgtggaaag ccttccgacc aagggaagtg tcggatgtag aggaaatgga aagtttgttc 1440
tcagatgggg acttgcttga ttgcttcaca agaatgccag cttatgcggt aaacgcagag 1500
gaagatttag ctgcaatcag gaaaacgccc gagatggatg tcggtcaaga agttaaagaa 1560
cctgcaggag acagaaatca atactcaaac cctgcagaaa ctttcctcaa caagctccac 1620
aggaaacaca gtagggaggt gaaacaccag gccgcaaaga aagctaaacg cctagctgaa 1680
atccaggagt caatgagagc tgaaggtgat gccgaaccaa atgaaataag cgggggcatg 1740
ggggcaatac ccagcaacgc cgaacttcct ggcacgaatg atgccagaca agaactcaca 1800
ctcccaacca ctaaacctgt ccctgcaagg tgggaagatg cttcattcac agattctagt 1860
gtggaagagg agcaggttaa accccttgga aaagaaaccg ttgaaacagc gacgcaacaa 1920
gtcatcgaag gacttccttg gaaacactgg attcctcaat taaatgctgt tggattcaag 1980
gcgctggaaa ttcagaggga taggagtgga acaatgatca tgcccatcac agaaatggtc 2040
tccgggctgg aaaaagagga cttccctgaa ggaactccaa aagagttggc acgagaattg 2100
ttcgctatga acagaagccc tgccaccatc cctttggacc tgcttagagc cagagactac 2160
ggcagtgatg taaagaacaa gagaattggt gccatcacaa agacacaggc aacgagttgg 2220
ggcgaatact tgacaggaaa gatagaaagc ttgactgaga ggaaagttgc gacttgtgtc 2280
attcatggag ctggaggttc tggaaaaagt catgccatcc agaaggcatt gagagaaatt 2340
ggcaagggct cggacatcac tgtagtcctg ccgaccaatg aactgcggct agattggagt 2400
aagaaagtgc ctaacactga gccctatatg ttcaagacct atgaaaaggc gttaattggg 2460
ggaacaggca gcatagtcat ctttgacgat tactcaaaac ttcctcccgg ttacatagaa 2520
gccttagtct gtttctactc taaaatcaag ctaatcattc taacaggaga tagcagacaa 2580
agcgtctacc atgaaactgc tgaggacgcc tccatcaggc atttgggacc agcaacagag 2640
tacttctcaa aatactgccg atactatctc aatgccacac accgcaacaa gaaagatctt 2700
gcgaacatgc ttggtgtcta cagtgagaga acgggagtca ccgaaatcag catgagcgcc 2760
gagttcttag aaggaatccc aactttggta ccctcggatg agaagagaaa gctgtacatg 2820
ggcaccggga ggaatgacac gttcacatac gctggatgcc aggggctaac taagccgaag 2880
gtacaaatag tgttggacca caacacccaa gtgtgtagcg cgaatgtgat gtacacggca 2940
ctttctagag ccaccgatag gattcacttc gtgaacacaa gtgcaaattc ctcggccttc 3000
tgggaaaagt tggacagcac cccttacctc aagactttcc tatcagtggt gagagaacaa 3060
gcactcaggg agtacgagcc ggcagaggca gagccaattc aagagcctga gccccagaca 3120
cacatgtgtg tcgagaatga ggagtccgtg ctagaagagt acaaagagga actcttggaa 3180
aagtttgaca gagagatcca ctctgaatcc catggtcatt caaactgtgt ccaaactgaa 3240
gacacaacca ttcagttgtt ttcgcatcaa caagcaaaag atgagaccct cctctgggcg 3300
actatagatg cgcggctcaa gaccagcaat caagagacaa acttccgaga attcctgagc 3360
aagaaggaca ttggggacgt tctgttttta aactaccaaa aagctatggg tttacccaaa 3420
gagcgtattc ctttttccca agaggtctgg gaagcttgtg cccacgaagt acaaagcaag 3480
tacctcagca agtcaaagtg caacttgatc aatgggactg tgagacagag cccagacttc 3540
gatgaaaata agattatggt attcctcaag tcgcagtggg tcacaaaggt ggaaaaacta 3600
ggtctaccca agattaagcc aggtcaaacc atagcagcct tttaccagca gactgtgatg 3660
ctttttggaa ctatggctag gtacatgcga tggttcagac aggctttcca gccaaaagaa 3720
gtcttcataa actgtgagac cacgccagat gacatgtctg catgggcctt gaacaactgg 3780
aatttcagca gacctagctt ggctaatgac tacacagctt tcgaccagtc tcaggatgga 3840
gccatgttgc aatttgaggt gctcaaagcc aaacaccact gcataccaga ggaaatcatt 3900
caggcataca tagatattaa gactaatgca cagattttcc taggcacgtt atcaattatg 3960
cgcctgactg gtgaaggtcc cacttttgat gcaaacactg agtgcaacat agcttacacc 4020
catacaaagt ttgacatccc agccggaact gctcaagttt atgcaggaga cgactccgca 4080
ctggactgtg ttccagaagt gaagcatagt ttccacaggc ttgaggacaa attactccta 4140
aagtcaaagc ctgtaatcac gcagcaaaag aagggcagtt ggcctgagtt ttgtggttgg 4200
ctgatcacac caaaaggggt gatgaaagac ccaattaagc tccatgttag cttaaaattg 4260
gctgaagcta agggtgaact caagaaatgt caagattcct atgaaattga tctgagttat 4320
gcctatgacc acaaggactc tctgcatgac ttgttcgatg agaaacagtg tcaggcacac 4380
acactcactt gcagaacact aatcaagtca gggagaggca ctgtctcact ttcccgcctc 4440
agaaactttc tttaaccgtt aagttacctt agagatttga ataagatgga tattctcatc 4500
agtagtttga aaagtttagg ttattctagg acttccaaat ctttagattc aggacctttg 4560
gtagtacatg cagtagccgg agccggtaag tccacagccc taaggaagtt gatcctcaga 4620
cacccaacat tcaccgtgca tacactcggt gtccctgaca aggtgagtat cagaactaga 4680
ggcatacaga agccaggacc tattcctgag ggcaacttcg caatcctcga tgagtatact 4740
ttggacaaca ccacaaggaa ctcataccag gcactttttg ctgaccctta tcaggcaccg 4800
gagtttagcc tagagcccca cttctacttg gaaacatcat ttcgagttcc gaggaaagtg 4860
gcagatttga tagctggctg tggcttcgat ttcgagacca actcaccgga agaagggcac 4920
ttagagatca ctggcatatt caaagggccc ctactcggaa aggtgatagc cattgatgag 4980
gagtctgaga caacactgtc caggcatggt gttgagtttg ttaagccctg ccaagtgacg 5040
ggacttgagt tcaaagtagt cactattgtg tctgccgcac caatagagga aattggccag 5100
tccacagctt tctacaacgc tatcaccagg tcaaagggat tgacatatgt ccgcgcaggg 5160
ccataggctg accgctccgg tcaattctga aaaagtgtac atagtattag gtctatcatt 5220
tgctttagtt tcaattacct ttctgctttc tagaaatagc ttaccccacg tcggtgacaa 5280
cattcacagc ttgccacacg gaggagctta cagagacggc accaaagcaa tcttgtacaa 5340
ctccccaaat ctagggtcac gagtgagtct acacaacgga aagaacgcag catttgctgc 5400
cgttttgcta ctgactttgc tgatctatgg aagtaaatac atatctcaac gcaatcatac 5460
ttgtgcttgt ggtaacaatc atagcagtca ttagcacttc cttagtgagg actgaacctt 5520
gtgtcatcaa gattactggg gaatcaatca cagtgttggc ttgcaaacta gatgcagaaa 5580
ccataagggc cattgccgat ctcaagccac tctccgttga acggttaagt ttccattgat 5640
actcgaaaga ggtcagcacc agctagcatg cccgcgagca caacacagcc catagggtca 5700
actacctcaa ctaccacaaa aactgcaggc gcaactcctg ccacagcttc aggcctgttc 5760
actatcccgg atggggattt ctttagtaca gcccgtgcca tagtagccag caatgctgtc 5820
gcaacaaatg aggacctcag caagattgag gctatttgga aggacatgaa ggtgcccaca 5880
gacactatgg cacaggctgc ttgggactta gtcagacact gtgctgatgt aggatcatcc 5940
gctcaaacag aaatgataga tacaggtccc tattccaacg gcatcagcag agctagactg 6000
gcagcagcaa ttaaagaggt gtgcacactt aggcaatttt gcatgaagta tgccccagtg 6060
gtatggaact ggatgttaac taacaacagt ccacctgcta actggcaagc acaaggtttc 6120
aagcctgagc acaaattcgc tgcattcgac ttcttcaatg gagtcaccaa cccagctgcc 6180
atcatgccca aagaggggct catccggcca ccgtctgaag ctgaaatgaa tgctgcccaa 6240
actgctgcct ttgtgaagat tacaaaggcc agggcacaat ccaacgactt tgccagccta 6300
gatgcagctg tcactcgagg tcgtatcact ggaacaacaa ccgctgaggc tgttgtcact 6360
ctaccaccac cataactacg tctacataac cgacgcctac cccagtttca tagtattttc 6420
tggtttgatt gtatgaataa tat 6443
<210> 6
<211> 2477
<212> DNA
<213>Estrogen-inducible promoter XVE
<400> 6
tagtttaaac tgaaggcggg aaacgacaat ctgatccaag ctcaagctaa gcttgcatgc 60
ctgcaggata tcgtggatcc aagcttgcca cgtgccgcca cgtgccgcca cgtgccgcca 120
cgtgcctcta gaggatccat ctccactgac gtaagggatg acgcacaatc ccactatcct 180
tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagaggac acgctgggat 240
ccccaattcc gggcggaatg aaagcgttaa cggccaggca acaagaggtg tttgatctca 300
tccgtgatca catcagccag acaggtatgc cgccgacgcg tgcggaaatc gcgcagcgtt 360
tggggttccg ttccccaaac gcggctgaag aacatctgaa ggcgctggca cgcaaaggcg 420
ttattgaaat tgtttccggc gcatcacgcg ggattcgtct gttgcaggaa gaggaagaag 480
ggttgccgct ggtaggtcgt gtggctgccg gtgaaccgtc gagcgccccc ccgaccgatg 540
tcagcctggg ggacgagctc cacttagacg gcgaggacgt ggcgatggcg catgccgacg 600
cgctagacga tttcgatctg gacatgttgg gggacgggga ttccccgggt ccgggattta 660
ccccccacga ctccgccccc tacggcgctc tggatatggc cgacttcgag tttgagcaga 720
tgtttaccga tgcccttgga attgacgagt acggtgggga tccgtctgct ggagacatga 780
gagctgccaa cctttggcca agcccgctca tgatcaaacg ctctaagaag aacagcctgg 840
ccttgtccct gacggccgac cagatggtca gtgccttgtt ggatgctgag ccccccatac 900
tctattccga gtatgatcct accagaccct tcagtgaagc ttcgatgatg ggcttactga 960
ccaacctggc agacagggag ctggttcaca tgatcaactg ggcgaagagg gtgccaggct 1020
ttgtggattt gaccctccat gatcaggtcc accttctaga atgtgcctgg ctagagatcc 1080
tgatgattgg tctcgtctgg cgctccatgg agcacccagt gaagctactg tttgctccta 1140
acttgctctt ggacaggaac cagggaaaat gtgtagaggg catggtggag atcttcgaca 1200
tgctgctggc tacatcatct cggttccgca tgatgaatct gcagggagag gagtttgtgt 1260
gcctcaaatc tattattttg cttaattctg gagtgtacac atttctgtcc agcaccctga 1320
agtctctgga agagaaggac catatccacc gagtcctgga caagatcaca gacactttga 1380
tccacctgat ggccaaggca ggcctgaccc tgcagcagca gcaccagcgg ctggcccagc 1440
tcctcctcat cctctcccac atcaggcaca tgagtaacaa aggcatggag catctgtaca 1500
gcatgaagtg caagaacgtg gtgcccctct atgacctgct gctggagatg ctggacgccc 1560
accgcctaca tgcgcccact agccgtggag gggcatccgt ggaggagacg gaccaaagcc 1620
acttggccac tgcgggctct acttcatcgc attccttgca aaagtattac atcacggggg 1680
aggcagaggg tttccctgcc acagtctgag agctccctgg cgaattccca gagatgttag 1740
ctgaaatcat cactaatcag ataccaaaat attcaaatgg aaatatcaaa aagcttctgt 1800
ttcatcaaaa atgactcgac ctaactgagt aagctagctt gttcgagtat tatggcattg 1860
ggaaaactgt ttttcttgta ccatttgttg tgcttgtaat ttactgtgtt ttttattcgg 1920
ttttcgctat cgaactgtga aatggaaatg gatggagaag agttaatgaa tgatatggtc 1980
cttttgttca ttctcaaatt aatattattt gttttttctc ttatttgttg tgtgttgaat 2040
ttgaaattat aagagatatg caaacatttt gttttgagta aaaatgtgtc aaatcgtggc 2100
ctctaatgac cgaagttaat atgaggagta aaacatccca aacagcttgg gctgcaggtc 2160
gaggctaaaa aactaatcgc attatcatcc cctcgacgta ctgtacatat aaccactggt 2220
tttatataca gcagtactgt acatataacc actggtttta tatacagcag tcgacgtact 2280
gtacatataa ccactggttt tatatacagc agtactgtac atataaccac tggttttata 2340
tacagcagtc gaggtaagat tagatatgga tatgtatatg gatatgtata tggtggtaat 2400
gccatgtaat atgctcgact ctaggatctt cgcaagaccc ttcctctata taaggaagtt 2460
catttcattt ggagagg 2477
<210> 7
<211> 1637
<212> DNA
<213>Hygromycin gene
<400> 7
aggcgggaaa cgacaatctg atcatgagcg gagaattaag ggagtcacgt tatgaccccc 60
gccgatgacg cgggacaagc cgttttacgt ttggaactga cagaaccgca acgattgaag 120
gagccactca gccgcgggtt tctggagttt aatgagctaa gcacatacgt cagaaaccat 180
tattgcgcgt tcaaaagtcg cctaaggtca ctatcagcta gcaaatattt cttgtcaaaa 240
atgctccact gacgttccat aaattcccct cggtatccaa ttagagtctc atattcactc 300
tcaatccaaa taatctgcac cggatcccct agaatgaaaa agcctgaact caccgcgacg 360
tctgtcgaga agtttctgat cgaaaagttc gacagcgtct ccgacctgat gcagctctcg 420
gagggcgaag aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctgcgg 480
gtaaatagct gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg 540
gccgcgctcc cgattccgga agtgcttgac attggggaat tcagcgagag cctgacctat 600
tgcatctccc gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac cgaactgccc 660
gctgttctgc agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag 720
acgagcgggt tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat 780
ttcatatgcg cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc 840
gtcagtgcgt ccgtcgcgca ggctctcgat gagctgatgc tttgggccga ggactgcccc 900
gaagtccggc acctcgtgca cgcggatttc ggctccaaca atgtcctgac ggacaatggc 960
cgcataacag cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc 1020
gccaacatct tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc 1080
gagcggaggc atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt 1140
ggtcttgacc aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg 1200
cagggtcgat gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg tacacaaatc 1260
gcccgcagaa gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga 1320
aaccgacgcc ccagcactcg tccgagggca aaggaatagc gatcgttcaa acatttggca 1380
ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 1440
gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 1500
ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 1560
gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcggggaat 1620
tgatcccccc tcgacag 1637
<210> 8
<211> 2143
<212> DNA
<213>Inducible promoter XVE-1
<400> 8
tagtttaaac tgaaggcggg aaacgacaat ctgatccaag ctcaagctaa gcttgcatgc 60
ctgcaggata tcgtggatcc aagcttgcca cgtgccgcca cgtgccgcca cgtgccgcca 120
cgtgcctcta gaggatccat ctccactgac gtaagggatg acgcacaatc ccactatcct 180
tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagaggac acgctgggat 240
ccccaattcc gggcggaatg aaagcgttaa cggccaggca acaagaggtg tttgatctca 300
tccgtgatca catcagccag acaggtatgc cgccgacgcg tgcggaaatc gcgcagcgtt 360
tggggttccg ttccccaaac gcggctgaag aacatctgaa ggcgctggca cgcaaaggcg 420
ttattgaaat tgtttccggc gcatcacgcg ggattcgtct gttgcaggaa gaggaagaag 480
ggttgccgct ggtaggtcgt gtggctgccg gtgaaccgtc gagcgccccc ccgaccgatg 540
tcagcctggg ggacgagctc cacttagacg gcgaggacgt ggcgatggcg catgccgacg 600
cgctagacga tttcgatctg gacatgttgg gggacgggga ttccccgggt ccgggattta 660
ccccccacga ctccgccccc tacggcgctc tggatatggc cgacttcgag tttgagcaga 720
tgtttaccga tgcccttgga attgacgagt acggtgggga tccgtctgct ggagacatga 780
gagctgccaa cctttggcca agcccgctca tgatcaaacg ctctaagaag aacagcctgg 840
ccttgtccct gacggccgac cagatggtca gtgccttgtt ggatgctgag ccccccatac 900
tctattccga gtatgatcct accagaccct tcagtgaagc ttcgatgatg ggcttactga 960
ccaacctggc agacagggag ctggttcaca tgatcaactg ggcgaagagg gtgccaggct 1020
ttgtggattt gaccctccat gatcaggtcc accttctaga atgtgcctgg ctagagatcc 1080
tgatgattgg tctcgtctgg cgctccatgg agcacccagt gaagctactg tttgctccta 1140
acttgctctt ggacaggaac cagggaaaat gtgtagaggg catggtggag atcttcgaca 1200
tgctgctggc tacatcatct cggttccgca tgatgaatct gcagggagag gagtttgtgt 1260
gcctcaaatc tattattttg cttaattctg gagtgtacac atttctgtcc agcaccctga 1320
agtctctgga agagaaggac catatccacc gagtcctgga caagatcaca gacactttga 1380
tccacctgat ggccaaggca ggcctgaccc tgcagcagca gcaccagcgg ctggcccagc 1440
tcctcctcat cctctcccac atcaggcaca tgagtaacaa aggcatggag catctgtaca 1500
gcatgaagtg caagaacgtg gtgcccctct atgacctgct gctggagatg ctggacgccc 1560
accgcctaca tgcgcccact agccgtggag gggcatccgt ggaggagacg gaccaaagcc 1620
acttggccac tgcgggctct acttcatcgc attccttgca aaagtattac atcacggggg 1680
aggcagaggg tttccctgcc acagtctgag agctccctgg cgaattccca gagatgttag 1740
ctgaaatcat cactaatcag ataccaaaat attcaaatgg aaatatcaaa aagcttctgt 1800
ttcatcaaaa atgactcgac ctaactgagt aagctagctt gttcgagtat tatggcattg 1860
ggaaaactgt ttttcttgta ccatttgttg tgcttgtaat ttactgtgtt ttttattcgg 1920
ttttcgctat cgaactgtga aatggaaatg gatggagaag agttaatgaa tgatatggtc 1980
cttttgttca ttctcaaatt aatattattt gttttttctc ttatttgttg tgtgttgaat 2040
ttgaaattat aagagatatg caaacatttt gttttgagta aaaatgtgtc aaatcgtggc 2100
ctctaatgac cgaagttaat atgaggagta aaacatccca aac 2143
<210> 9
<211> 334
<212> DNA
<213>Estrogen-inducible promoter XVE-2
<400> 9
agcttgggct gcaggtcgag gctaaaaaac taatcgcatt atcatcccct cgacgtactg 60
tacatataac cactggtttt atatacagca gtactgtaca tataaccact ggttttatat 120
acagcagtcg acgtactgta catataacca ctggttttat atacagcagt actgtacata 180
taaccactgg ttttatatac agcagtcgag gtaagattag atatggatat gtatatggat 240
atgtatatgg tggtaatgcc atgtaatatg ctcgactcta ggatcttcgc aagacccttc 300
ctctatataa ggaagttcat ttcatttgga gagg 334
<210> 10
<211> 480
<212> DNA
<213>T3A terminators
<400> 10
caggcctccc agctttcgtc cgtatcatcg gtttcgacaa cgttcgtcaa gttcaatgca 60
tcagtttcat tgcccacaca ccagaatcct actaagtttg agtattatgg cattggaaaa 120
gctgttttct tctatcattt gttctgcttg taatttactg tgttctttca gtttttgttt 180
tcggacatca aaatgcaaat ggatggataa gagttaataa atgatatggt ccttttgttc 240
attctcaaat tattattatc tgttgttttt actttaatgg gttgaattta agtaagaaag 300
gaactaacag tgtgatatta aggtgcaatg ttagacatat aaaacagtct ttcacctctc 360
tttggttatg tcttgaattg gtttgtttct tcacttatct gtgtaatcaa gtttactatg 420
agtctatgat caagtaatta tgcaatcaag ttaagtacag tataggcttt ttgtgtcgag 480
<210> 11
<211> 10578
<212> DNA
<213>TuMV-GFP sequences(1229-1972 nt are GFP genes)
<400> 11
aaaaaatata aaaactcaac ataacataca caaaacgatt aaagcaaaca caaatctttc 60
aaagcattca agcaatcaaa gattctcaaa tctttcatcg ttatcaaagc aatcaccaac 120
agcaaaccaa atggcagcag ttacattcgc atcagctatc accaacgcca tcaccagcaa 180
accagcactc accggaatgg tgcagtttgg gagtttccca ccaatgccat tgcgatccac 240
caccgtcacc acagtcgcca cttcagtggc gcaacctaaa ctgtacacag tgcagtttgg 300
aagccttgac ccagtagtcg tcaagagtgg agcagggtcc cttgctaagg caacacgcca 360
gcagcctaac gttgaaatag acgttagcct cagtgaagcc gcagctctgg aggttgcgaa 420
acctagatcg aatgccgtgt tgaggatgca cgaggaagca aacaaggaga gagcactctt 480
tttggactgg gaggctagtt tgaagagaag ctcgtatgga attgctgagg acgagaaggt 540
tgtaatgaca actcatggcg tcagcaagat agtgcccaga agttcaaggg caatgaagct 600
aaagcgcgca agggagaggc gtagagcgca gcaaccaatt atattaaagt gggagcccaa 660
attgagcggg atctcaatcg gaggagggct ctctgcgagc gtaatcgaag cagaagaggt 720
tcgcacaaag tggccgcttc ataagacacc gtcaatgaag aagaggacgg tgcacagaat 780
atgcaagatg aacgaccaag gagttgacat gttgacacga tccctggtta agattttcaa 840
gactaagagt gccaacattg aatacatcgg aaagaagtcg attaaggtcg atttcatcag 900
aaaagaacga acgaaattcg caagaatcca agtagcacac ttactcggga agagagcaca 960
gcgcgacttg ttaactggaa tggaagaaaa ccattttatt gacattctca gtaagtactc 1020
aggtaacaaa acaaccataa atcctggagt agtttgcgca ggttggagtg gcatagtcgt 1080
tggaaatgga attctaaccc agaaacgaag cagaagtcca tcagaggcct ttgtaattag 1140
aggtgagcac gaaggcaagt tgtacgatgc caggatcaaa gtcacgagga caatgagtca 1200
caagattgtg cactttagtg ccgcgggaat gagtaaagga gaagaacttt tcactggagt 1260
tgtcccaatt cttgttgaat tagatggtga tgttaatggg cacaaatttt ctgtcagtgg 1320
agagggtgaa ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg 1380
aaaactacct gttccatggc caacacttgt cactactttc tcttatggtg ttcaatgctt 1440
ttcaagatac ccagatcata tgaagcggca cgacttcttc aagagcgcca tgcctgaggg 1500
atacgtgcag gagaggacca tcttcttcaa ggacgacggg aactacaaga cacgtgctga 1560
agtcaagttt gagggagaca ccctcgtcaa caggatcgag cttaagggaa tcgatttcaa 1620
ggaggacgga aacatcctcg gccacaagtt ggaatacaac tacaactccc acaacgtata 1680
catcatggcc gacaagcaaa agaacggcat caaagccaac ttcaagaccc gccacaacat 1740
cgaagacggc ggcgtgcaac tcgctgatca ttatcaacaa aatactccaa ttggcgatgg 1800
ccctgtcctt ttaccagaca accattacct gtccacacaa tctgcccttt cgaaagatcc 1860
caacgaaaag agagaccaca tggtccttct tgagtttgta acagctgctg ggattacaca 1920
tggcatggat gaactataca aagcttgtgt ctatcaccag gcagccgcgg gagccaactt 1980
ctggaaaggc ttcgacagat gctttctcgc ataccgtagt gacaatcgcg agcatacatg 2040
ctattcaggg ctagatgtca ctgagtgcgg cgaggtggca gcactgatgt gtttggctat 2100
gttcccatgc ggaaagataa cctgccctga ctgtgtaaca gatagtgagc tatcccaagg 2160
acaagcaagc ggaccatcta tgaagcacag gttgacacag ctacgcgatg tcatcaagtc 2220
aagctaccca cgcttcaagc atgcagtgca gatactagat aggtatgagc aatcactgag 2280
cagtgcaaac gagaactacc aagatttcgc agaaatccag agcataagcg atggagttga 2340
aaaagctgca ttcccacacg tcaacaagct aaacgcaata ttgatcaaag gggccacagt 2400
aacaggagag gaattctcgc aggctacgaa gcacttgctc gagatagcac gatacctgaa 2460
gaacagaacc gagaacattg agaagggttc actgaagtcc tttcgcaaca agatttccca 2520
gaaagcgcac atcaacccaa cactaatgtg tgacaaccag ctcgatagaa atggaaattt 2580
catatggggt gagagaggat accatgcaaa acgattcttc agcaactact ttgaaataat 2640
cgatccaaag aaaggctaca cccaatacga gacaagagcg gtaccaaatg ggtcacggaa 2700
acttgcaatc ggcaaactaa tagtcccaac gaacttcgaa gttttaaggg aacagatgaa 2760
aggcgaaccg gtagaaccat acccagtaac agtcgagtgt gtgagcaagt tacagggtga 2820
cttcgtccat gcatgttgtt gtgtcacaac agaatcaggc gacccagtct tgtctgagat 2880
caaaatgcca accaaacacc atctagtgat tggtaacagc ggtgatccaa agtacataga 2940
tctccctgag atcgaggaga ataaaatgta catagcgaaa gaaggttatt gttacatcaa 3000
tatcttccta gccatgttgg taaatgtcaa ggagtcgcag gcaaaggagt tcacgaaagt 3060
tgttagggac aaactagttg gcgaacttgg caagtggccc actctgttag atgtagcaac 3120
cgcttgttat ttcctgaaag tattttaccc agacgttgct aacgccgaat tgccacgcat 3180
gctagtggac cataagacaa agataattca tgtcgttgat tcatatgggt cactgtcaac 3240
tggatatcat gtccttaaga caaacactgt ggaacaactc atcaaattca cgagatgtaa 3300
tttggagtca agcttgaaac actaccgcgt tggaggaaca gaatgggagg acactcatgg 3360
atccagcaac atagataatc cacagtggtg catcaagagg ctcataaaag gagtctacaa 3420
accaaagcaa ctgaaagaag acatgttggc aaaccctttc ttaccactat atgctctact 3480
gtcaccaggt gtcatcctgg cattttacaa tagtggctct ctagagtact tgatgaacca 3540
ttacatcagg gtggacagca acgtcgccgt tttgttggtc gttttgaaat ctctagcgaa 3600
gaaggtgtca actagtcaga gtgtgttagc ccagcttcaa atcattgaac gaagtctacc 3660
agaactcatc gaagcaaagg ctaatgttaa tgggccagat gacgcagcca ctcgcgcgtg 3720
taacagattc atgggcatgc ttctgcatat ggcagaacca aactgggagc ttgcggatgg 3780
tggatacaca attctgaggg atcatagcat ctccattttg gaaaaaagtt atctacaaat 3840
cttggacgaa gcatggaacg agttaagttg gtcggagcgc tgtgctataa gatactactc 3900
gtcaaagcaa gcaatcttta cacagaaaga tttgccaatg aaaagcgaag ccgatttagg 3960
cggcagatac agcgtgtcag tcatgtcatc ttacgaacgg agtaagcaat gtatgaaaag 4020
cgtgcactct agtataggta atagattacg tagtagtatg tcttggacta gtagcaaggt 4080
gtcgaatagt gtgtgtagga ctattaacta tttagtacca gatgtgttca agtttatgaa 4140
tgtactcgtt tgtatcagct tactaatcaa gatgactgcc gaggcgaatc acatcgtcac 4200
cacgcaaaga aggctcaaac tagatgtcga ggagacagag cgcaggaaaa tagaatggga 4260
gcttgcattc caccatgcca ttctgacgca gagtgcaggt caacacccaa cgatagacga 4320
gttcagagcg tacatcgccg acaaggcacc acatctaagt gagcatatcg agcctgaaga 4380
aaaggcggtg gttcatcaag cgaagagaca atccgagcaa gaactcgagc gtataatagc 4440
atttgttgca ttggtgctca tgatgttcga tgcagaacga agcgactgtg tcacaaagat 4500
tctcaacaag cttaagggac tagtcgccac tgtggaacct acagtctacc atcagactct 4560
caatgatata gaggatgact tgagtgagag gaacctcttc gtcgattttg agcttagcag 4620
cgatggagat atgctccaac agcttccagc cgaaaagaca tttgcctcat ggtggagtca 4680
tcaactaagc agaggattca caatcccaca ctacaggaca gaagggaagt tcatgacttt 4740
caccagagca actgccacgg aagtcgcggg taaaatagca cacgagagtg acaaagacat 4800
attactaatg ggagcagtag gatcaggtaa gtcaactggc ttgccatatc atctctccag 4860
aaaagggaac gtattactcc ttgagccgac tcggccactt gcagaaaacg tacacaagca 4920
gttgtcgcag gcaccgttcc atcagaacac aactcttagg atgcgcggac taacagcatt 4980
cgggtcggca ccaatctcag tgatgaccag tggttttgca ctcaattact ttgcaaacaa 5040
cagaatgcga attgaagaat ttgactttgt catatttgat gaatgtcacg ttcatgacgc 5100
caatgcaatg gcgatgagat gtttgctaca tgagtgtgac tattctggca aaattatcaa 5160
agtttcagcc acaccaccag gtcgagaagt tgagttctcc actcaatacc ccgtgtcgat 5220
aagcacagaa gacacactat cgtttcagga ttttgtgaac gcacagggta gtggaagcaa 5280
ttgtgatgtg atttcaaaag gagacaatat cctcgtgtat gtagcaagct acaatgaggt 5340
agacgcgctt tcaaaacttc taattgaaag agacttcaaa gtcacgaagg ttgatggaag 5400
aacgatgaaa gttggaaaca tcgagatcac cacaagtgga acacctagta agaagcactt 5460
catagttgca accaacatca tagagaacgg tgttactcta gacatcgatg tggttgctga 5520
ttttggaacg aaggtactcc catatcttga tacagacagc agaatgctga gcacaactaa 5580
gacaagcatc aattatgggg aacgtatcca aaggctagga agagtcggaa ggcacaagcc 5640
aggtcacgct ctgcgaatag gtcacacaga gaaggggttg agcgaagttc caagttgtat 5700
tgcaacagaa gcagctttaa agtgcttcac ttatgggctt ccagtgatca ccaacaacgt 5760
ctcgacaagt attcttggta atgtaacggt aaagcaggca cgaacaatgt ctgtatttga 5820
gataacaccg ttctacacaa gccaagtggt gagatatgat ggctccatgc atccacaggt 5880
gcacgcactc ttaaagagat tcaaactcag agactctgag attgttttga ataaattagc 5940
catacctcac cgaggagtga acgcttggct cacagctagt gagtatgcac gacttggcgc 6000
gaatgttgaa gataggcgtg acgttcgaat tccttttatg tgtcgcgaca tcccagaaaa 6060
acttcatcta gacatgtggg atgtgattgt taaattcaaa ggtgatgcag gttttggtcg 6120
gctttcaagc gccagtgcga gcaaggtagc ttatactcta cagacggacg tcaactccat 6180
acagcgaaca gtcactatca tagatacact aatcgctgag gagagaagga agcaggaata 6240
cttcaagacg gtaacctcca actgtgtctc ttcttcgaac ttctcactgc agagcataac 6300
aaatgcgata aaatctcgta tgatgaaaga tcacacgtgc gagaacatat cagtgcttga 6360
aggagcgaag tcacagttac tcgagtttag aaacctgaat gctgatcact catttgctac 6420
aaaaaccgat ggaatatctc ggcatttcat gagtgagtat ggagctcttg aggcagttca 6480
ccatcaaaac accagcgaca tgagcaaatt cctcaagctt aagggcaaat ggaataaaac 6540
gctaatcacg cgagatgtgc tggtactttg tggagttctt ggaggtggat tgtggatggt 6600
tattcagcac ctgcggtcaa agatgtccga acccgtaacc catgaagcga aaggtaagag 6660
gcaaaggcag aaactaaaat ttcgcaatgc ccgagacaac aaaatgggta gagaagtgta 6720
cggagatgat gataccatag agcatttctt cggtgatgcc tacacaaaga aagggaagag 6780
caagggtagg acacgtggta tcggacacaa aaacaggaag ttcatcaaca tgtatgggtt 6840
tgatcctgaa gatttctctg cagttcgttt cgtggatcca ctcacaggag cgacgttgga 6900
cgacaacccg ctcacagaca tcacccttgt gcaagagcac ttcggcaaca taagaatgga 6960
cttactcggg gaggatgagc tggactcaaa tgaaatacgt gtgaataaga ctattcaagc 7020
ctactacatg aacaataaaa caggcaaggc tttgaaggtg gatctgacac cacacatacc 7080
tctcaaggtg tgtgatcttc acgcaaccat tgctggattc ccagagcgag aaaacgagct 7140
gaggcagact ggaaaggctc agcccatcaa catagacgaa gtgccaagag ctaacaacga 7200
actcgtccca gtggaccacg agagtaactc catgttcaga gggttgcgtg actacaaccc 7260
aatatcaaac aacatttgtc atctcacaaa tgtttcagat ggagcatcaa actcgttata 7320
tggagtcggt ttcggaccac tcatattaac gaaccgacac ctctttgagc ggaataacgg 7380
tgaactcgta ataaaatcac gacatggtga gttcgtgatt aaaaacacaa ctcagctaca 7440
cttgctaccg attccagaca gagatcttct gctaatccgg ttaccaaagg acgtcccacc 7500
ctttccacag aaattgggtt tcaggcaacc tgagaaaggt gaacgaattt gcatggtggg 7560
gtccaatttc caaaccaaga gcataacgag tatagtctct gagactagta caataatgcc 7620
agtggagaac agtcagtttt ggaaacactg gattagcact aaagacggcc aatgcggaag 7680
tccaatggtg agcacgaaag acgggaaaat actcggatta cacagcctag cgaacttcca 7740
gaactccatc aattactttg ctgctttccc agatgatttt gccgagaagt atcttcatac 7800
cattgaagca cacgagtggg tcaagcactg gaagtataac actagcgcca tcagttgggg 7860
ctctttgaat atacaagcat cgcaaccgtc cggcttgttc aaagtaagca agctaatctc 7920
agacctcgac agcacggcag tctacgcaca aacccagcag aatcggtgga tgttcgagca 7980
gctcaacggg aacctaaaag cgatagcaca ctgccctagc cagcttgtga caaagcacac 8040
agttaaagga aaatgtcaga tgtttgactt gtatctcaag ttgcatgatg aagcacgaga 8100
gtatttccaa ccgatgctgg gccagtatca aaagagcaaa ctcaatcgag aagcatatgc 8160
aaaggatctt ctgaaatatg caacgccaat cgaagcagga aacatcgact gtgatctgtt 8220
tgaaaagaca gttgaaatag tcgtatcaga tctgcgaggt tatggtttcg aaacatgcaa 8280
ttatgtcact gatgagaatg acatattcga agctcttaac atgaaatccg cagttggagc 8340
gttgtataaa ggaaagaaga aggattactt cgctgagttc acacccgaga tgaaagaaga 8400
aatactgaaa caaagttgtg aacggctctt cctaggaaag atgggagtgt ggaacggctc 8460
gctgaaggca gagttgcgac cactagaaaa agtggaagca aacaaaacac ggacgtttac 8520
tgccgcacca ctagacacac tgttgggtgg aaaagtttgc gtggatgatt tcaacaacca 8580
gttctatgat cacaacctta gagctccttg gagcgttggc atgacaaagt tttattgtgg 8640
ttgggatcgc ttgttggagt cgttgccaga tggttgggtg tattgcgatg ctgatggctc 8700
acagttcgac agctcgctat cgccatactt gatcaacgca gtactcaaca tccgcttagg 8760
attcatggaa gagtgggaca taggggaggt aatgctgaga aatttgtaca ccgaaatcgt 8820
gtatacccct atttctacac cagatggtac actcgtcaag aagttcaaag gaaacaatag 8880
cggacagcca tcgactgttg tggacaacac gctcatggtc atattggcag tcaactattc 8940
actcaagaaa agcggaattc caagtgagtt gcgcgacagc atcatcagat tcttcgtcaa 9000
cggagatgat ttactgctaa gcgtacaccc agagtatgag tatattcttg acactatggc 9060
agacaacttt cgtgaactgg gcctgaagta tactttcgac tcaagaacca gggaaaaagg 9120
agacctctgg tttatgtcgc accaggggca caaaagagag ggaatctgga ttcccaagct 9180
cgagccagag cgaatagtat cgattctaga atgggatcgg tcgaaagagc catgccatcg 9240
actagaggca atctgcgcag cgatgattga gtcgtgggga tacgacaagt taactcacga 9300
gatacgcaag ttctacgcgt ggatgattga acaagctcca tttagctccc tagcacaaga 9360
agggaaagct ccttacatag cggaaacagc gctgaggaag ctctaccttg ataaggaacc 9420
agctcaagag gatctcaccc attatttgca agcaatcttt gaggattatg aagatggtgc 9480
tgaggcttgt gtttatcacc aggcaggtga aacgcttgat gcaggtttga cagacgagca 9540
aaagcaggca gagaaggaga agaaggagag agagaaggca gaaaaggaac gagagaggca 9600
aaagcagttg gcactcaaga aaggcaagga tgttgcacaa gaagagggaa aacgcgacaa 9660
ggaagtaaac gctggaacct ctggaacttt cagtgtaccc agactcaaga gtctgacaag 9720
caagatgcgc gtgccaagat acgagaaaag agtggctcta aacctcgatc atctaatcct 9780
atacacgccg gagcagacgg atctatccaa cacacgttca acgcgaaagc agtttgacac 9840
atggtttgaa ggtgtaatgg ctgattacga actgacggag gacaaaatgc aaatcattct 9900
caatggttta atggtctggt gcattgagaa cggaaccttc ccgaacataa acggaatgtg 9960
ggtgatgatg gacggcgacg atcaggtgga attcccgatc aaaccgctca ttgaccacgc 10020
caaacccaca tttaggcaga taatggccca tttcagtgac gtagctgaag cgtacattga 10080
aaagcgtaac caagaccgac catacatgcc acgatatggt cttcagcgca atttaaccga 10140
catgagctta gctcgatacg catttgattt ctatgaaatg acttctagga ctccaatacg 10200
tgcgagagag gcacacatcc agatgaaagc agcagcactg cgtggcgcaa ataataattt 10260
gttcggcttg gatggaaacg ttggtacaac ggtagagaac acggagaggc atacgaccga 10320
ggacgttaat cggaacatgc ataacttact gggcgttcag gggttgtgaa gttgtatgct 10380
ggtagactat aagtatttaa gtttactcgt tagtattctc gcttatggga aatatgtaag 10440
tttgttaaag cagccagtgt gactttgtca tgtgtgttgt tgttactttc tgtattttcg 10500
ccgaacattt tattggtgtt agcgcatgta gtgaggatcg tcctcgattg ccttaacatt 10560
tgataggatg caagggac 10578
<210> 12
<211> 6987
<212> DNA
<213>PVX-GFP (5671-6210 nt are GFP genes)
<400> 12
gaaaactaaa ccatacacca ccaacacaac caaacccacc acgcccaatt gttacacacc 60
cgcttgaaaa agaaagttta acaaatggcc aaggtgcgcg aggtttacca atcttttaca 120
gactccacca caaaaactct catccaagat gaggcttata gaaacattcg ccccatcatg 180
gaaaaacaca aactagctaa cccttacgct caaacggttg aagcggctaa tgatctagag 240
gggttcggca tagccaccaa tccctatagc attgaattgc atacacatgc agccgctaag 300
accatagaga ataaacttct agaggtgctt ggttccatcc taccacaaga acctgttaca 360
tttatgtttc ttaaacccag aaagctaaac tacatgagaa gaaacccgcg gatcaaggac 420
attttccaaa atgttgccat tgaaccaaga gacgtagcca ggtaccccaa ggaaacaata 480
attgacaaac tcacagagat cacaacggaa acagcataca ttagtgacac tctgcacttc 540
ttggatccga gctacatagt ggagacattc caaaactgcc caaaattgca aacattgtat 600
gcgaccttag ttctccccgt tgaggcagcc tttaaaatgg aaagcactca cccgaacata 660
tacagcctca aatacttcgg agatggtttc cagtatatac caggcaacca tggtggcggg 720
gcataccatc atgaattcgc tcatctacaa tggctcaaag tgggaaagat caagtggagg 780
gaccccaagg atagctttct cggacatctc aattacacga ctgagcaggt tgagatgcac 840
acagtgacag tacagttgca ggaatcgttc gcggcaaacc acttgtactg catcaggaga 900
ggagacttgc tcacaccgga ggtgcgcact ttcggccaac ctgacaggta cgtgattcca 960
ccacagatct tcctcccaaa agttcacaac tgcaagaagc cgattctcaa gaaaactatg 1020
atgcagctct tcttgtatgt taggacagtc aaggtcgcaa aaaattgtga catttttgcc 1080
aaagtcagac aattaattaa atcatctgac ttggacaaat actctgctgt ggaactggtt 1140
tacttagtaa gctacatgga gttccttgcc gatttacaag ctaccacctg cttctcagac 1200
acactttctg gtggcttgct aacaaagacc cttgcaccgg tgagggcttg gatacaagag 1260
aaaaagatgc agctgtttgg tcttgaggac tacgcgaagt tagtcaaagc agttgatttc 1320
cacccggtgg atttttcttt caaagtggaa acttgggact tcagattcca ccccttgcaa 1380
gcgtggaaag ccttccgacc aagggaagtg tcggatgtag aggaaatgga aagtttgttc 1440
tcagatgggg acttgcttga ttgcttcaca agaatgccag cttatgcggt aaacgcagag 1500
gaagatttag ctgcaatcag gaaaacgccc gagatggatg tcggtcaaga agttaaagaa 1560
cctgcaggag acagaaatca atactcaaac cctgcagaaa ctttcctcaa caagctccac 1620
aggaaacaca gtagggaggt gaaacaccag gccgcaaaga aagctaaacg cctagctgaa 1680
atccaggagt caatgagagc tgaaggtgat gccgaaccaa atgaaataag cgggggcatg 1740
ggggcaatac ccagcaacgc cgaacttcct ggcacgaatg atgccagaca agaactcaca 1800
ctcccaacca ctaaacctgt ccctgcaagg tgggaagatg cttcattcac agattctagt 1860
gtggaagagg agcaggttaa accccttgga aaagaaaccg ttgaaacagc gacgcaacaa 1920
gtcatcgaag gacttccttg gaaacactgg attcctcaat taaatgctgt tggattcaag 1980
gcgctggaaa ttcagaggga taggagtgga acaatgatca tgcccatcac agaaatggtc 2040
tccgggctgg aaaaagagga cttccctgaa ggaactccaa aagagttggc acgagaattg 2100
ttcgctatga acagaagccc tgccaccatc cctttggacc tgcttagagc cagagactac 2160
ggcagtgatg taaagaacaa gagaattggt gccatcacaa agacacaggc aacgagttgg 2220
ggcgaatact tgacaggaaa gatagaaagc ttgactgaga ggaaagttgc gacttgtgtc 2280
attcatggag ctggaggttc tggaaaaagt catgccatcc agaaggcatt gagagaaatt 2340
ggcaagggct cggacatcac tgtagtcctg ccgaccaatg aactgcggct agattggagt 2400
aagaaagtgc ctaacactga gccctatatg ttcaagacct atgaaaaggc gttaattggg 2460
ggaacaggca gcatagtcat ctttgacgat tactcaaaac ttcctcccgg ttacatagaa 2520
gccttagtct gtttctactc taaaatcaag ctaatcattc taacaggaga tagcagacaa 2580
agcgtctacc atgaaactgc tgaggacgcc tccatcaggc atttgggacc agcaacagag 2640
tacttctcaa aatactgccg atactatctc aatgccacac accgcaacaa gaaagatctt 2700
gcgaacatgc ttggtgtcta cagtgagaga acgggagtca ccgaaatcag catgagcgcc 2760
gagttcttag aaggaatccc aactttggta ccctcggatg agaagagaaa gctgtacatg 2820
ggcaccggga ggaatgacac gttcacatac gctggatgcc aggggctaac taagccgaag 2880
gtacaaatag tgttggacca caacacccaa gtgtgtagcg cgaatgtgat gtacacggca 2940
ctttctagag ccaccgatag gattcacttc gtgaacacaa gtgcaaattc ctcggccttc 3000
tgggaaaagt tggacagcac cccttacctc aagactttcc tatcagtggt gagagaacaa 3060
gcactcaggg agtacgagcc ggcagaggca gagccaattc aagagcctga gccccagaca 3120
cacatgtgtg tcgagaatga ggagtccgtg ctagaagagt acaaagagga actcttggaa 3180
aagtttgaca gagagatcca ctctgaatcc catggtcatt caaactgtgt ccaaactgaa 3240
gacacaacca ttcagttgtt ttcgcatcaa caagcaaaag atgagaccct cctctgggcg 3300
actatagatg cgcggctcaa gaccagcaat caagagacaa acttccgaga attcctgagc 3360
aagaaggaca ttggggacgt tctgttttta aactaccaaa aagctatggg tttacccaaa 3420
gagcgtattc ctttttccca agaggtctgg gaagcttgtg cccacgaagt acaaagcaag 3480
tacctcagca agtcaaagtg caacttgatc aatgggactg tgagacagag cccagacttc 3540
gatgaaaata agattatggt attcctcaag tcgcagtggg tcacaaaggt ggaaaaacta 3600
ggtctaccca agattaagcc aggtcaaacc atagcagcct tttaccagca gactgtgatg 3660
ctttttggaa ctatggctag gtacatgcga tggttcagac aggctttcca gccaaaagaa 3720
gtcttcataa actgtgagac cacgccagat gacatgtctg catgggcctt gaacaactgg 3780
aatttcagca gacctagctt ggctaatgac tacacagctt tcgaccagtc tcaggatgga 3840
gccatgttgc aatttgaggt gctcaaagcc aaacaccact gcataccaga ggaaatcatt 3900
caggcataca tagatattaa gactaatgca cagattttcc taggcacgtt atcaattatg 3960
cgcctgactg gtgaaggtcc cacttttgat gcaaacactg agtgcaacat agcttacacc 4020
catacaaagt ttgacatccc agccggaact gctcaagttt atgcaggaga cgactccgca 4080
ctggactgtg ttccagaagt gaagcatagt ttccacaggc ttgaggacaa attactccta 4140
aagtcaaagc ctgtaatcac gcagcaaaag aagggcagtt ggcctgagtt ttgtggttgg 4200
ctgatcacac caaaaggggt gatgaaagac ccaattaagc tccatgttag cttaaaattg 4260
gctgaagcta agggtgaact caagaaatgt caagattcct atgaaattga tctgagttat 4320
gcctatgacc acaaggactc tctgcatgac ttgttcgatg agaaacagtg tcaggcacac 4380
acactcactt gcagaacact aatcaagtca gggagaggca ctgtctcact ttcccgcctc 4440
agaaactttc tttaaccgtt aagttacctt agagatttga ataagatgga tattctcatc 4500
agtagtttga aaagtttagg ttattctagg acttccaaat ctttagattc aggacctttg 4560
gtagtacatg cagtagccgg agccggtaag tccacagccc taaggaagtt gatcctcaga 4620
cacccaacat tcaccgtgca tacactcggt gtccctgaca aggtgagtat cagaactaga 4680
ggcatacaga agccaggacc tattcctgag ggcaacttcg caatcctcga tgagtatact 4740
ttggacaaca ccacaaggaa ctcataccag gcactttttg ctgaccctta tcaggcaccg 4800
gagtttagcc tagagcccca cttctacttg gaaacatcat ttcgagttcc gaggaaagtg 4860
gcagatttga tagctggctg tggcttcgat ttcgagacca actcaccgga agaagggcac 4920
ttagagatca ctggcatatt caaagggccc ctactcggaa aggtgatagc cattgatgag 4980
gagtctgaga caacactgtc caggcatggt gttgagtttg ttaagccctg ccaagtgacg 5040
ggacttgagt tcaaagtagt cactattgtg tctgccgcac caatagagga aattggccag 5100
tccacagctt tctacaacgc tatcaccagg tcaaagggat tgacatatgt ccgcgcaggg 5160
ccataggctg accgctccgg tcaattctga aaaagtgtac atagtattag gtctatcatt 5220
tgctttagtt tcaattacct ttctgctttc tagaaatagc ttaccccacg tcggtgacaa 5280
cattcacagc ttgccacacg gaggagctta cagagacggc accaaagcaa tcttgtacaa 5340
ctccccaaat ctagggtcac gagtgagtct acacaacgga aagaacgcag catttgctgc 5400
cgttttgcta ctgactttgc tgatctatgg aagtaaatac atatctcaac gcaatcatac 5460
ttgtgcttgt ggtaacaatc atagcagtca ttagcacttc cttagtgagg actgaacctt 5520
gtgtcatcaa gattactggg gaatcaatca cagtgttggc ttgcaaacta gatgcagaaa 5580
ccataagggc cattgccgat ctcaagccac tctccgttga acggttaagt ttccattgat 5640
actcgaaaga ggtcagcacc agctagcatg aaacggcatg actttttcaa gagtgccatg 5700
cccgaaggtt atgtacagga aagaactata tttttcaagg atgacgggaa ctacaagaca 5760
cgtgctgaag tcaagtttga aggtgatacc cttgttaata gaatcgagtt aaaaggtatt 5820
gattttaaag aagatggaaa cattcttgga cacaaattgg aatacaacta taactcacac 5880
aatgtataca tcatggcaga caaacaaaag aatggaatca aagttaactt caaaattaga 5940
cacaacattg aagatggaag cgttcaacta gcagaccatt atcaacaaaa tactccaatt 6000
ggcgatggcc ctgtcctttt accagacaac cattacctgt ccacacaatc tgccctttcg 6060
aaagatccca acgaaaagag agaccacatg gtccttcttg agtttgtaac agctgctggg 6120
attacacatg gcatggatga actatacaaa tccggatcta gaaattttga ccttcttaag 6180
cttgcgggag acgtcgagtc caaccctggg cccgcgagca caacacagcc catagggtca 6240
actacctcaa ctaccacaaa aactgcaggc gcaactcctg ccacagcttc aggcctgttc 6300
actatcccgg atggggattt ctttagtaca gcccgtgcca tagtagccag caatgctgtc 6360
gcaacaaatg aggacctcag caagattgag gctatttgga aggacatgaa ggtgcccaca 6420
gacactatgg cacaggctgc ttgggactta gtcagacact gtgctgatgt aggatcatcc 6480
gctcaaacag aaatgataga tacaggtccc tattccaacg gcatcagcag agctagactg 6540
gcagcagcaa ttaaagaggt gtgcacactt aggcaatttt gcatgaagta tgccccagtg 6600
gtatggaact ggatgttaac taacaacagt ccacctgcta actggcaagc acaaggtttc 6660
aagcctgagc acaaattcgc tgcattcgac ttcttcaatg gagtcaccaa cccagctgcc 6720
atcatgccca aagaggggct catccggcca ccgtctgaag ctgaaatgaa tgctgcccaa 6780
actgctgcct ttgtgaagat tacaaaggcc agggcacaat ccaacgactt tgccagccta 6840
gatgcagctg tcactcgagg tcgtatcact ggaacaacaa ccgctgaggc tgttgtcact 6900
ctaccaccac cataactacg tctacataac cgacgcctac cccagtttca tagtattttc 6960
tggtttgatt gtatgaataa tataaat 6987
<210> 13
<211> 45
<212> DNA
<213>Primer 1
<400> 13
gttcatttca tttggagagg aaaaaatata aaaactcaac ataac 45
<210> 14
<211> 24
<212> DNA
<213>Primer 2
<400> 14
ttgatggtga actgcctcaa gagc 24
<210> 15
<211> 24
<212> DNA
<213>Primer 3
<400> 15
gctcttgagg cagttcacca tcaa 24
<210> 16
<211> 41
<212> DNA
<213>Primer 4
<400> 16
gacgaaagct gggaggcctg gtcgactcta gggggatccg a 41
<210> 17
<211> 23
<212> DNA
<213>Primer 5
<400> 17
cctctccaaa tgaaatgaac ttc 23
<210> 18
<211> 26
<212> DNA
<213>Primer 6
<400> 18
caggcctccc agctttcgtc cgtatc 26
<210> 19
<211> 22
<212> DNA
<213>Primer 7
<400> 19
ggctttcaag cgccagtgcg ag 22
<210> 20
<211> 22
<212> DNA
<213>Primer 8
<400> 20
gaagtgctct tgcacaaggg tg 22
<210> 21
<211> 51
<212> DNA
<213>Primer 9
<400> 21
gttcatttca tttggagagg gaaaactaaa ccatacacca ccaacacaac c 51
<210> 22
<211> 23
<212> DNA
<213>Primer 10
<400> 22
gataacgtgc ctaggaaaat ctg 23
<210> 23
<211> 21
<212> DNA
<213>Primer 11
<400> 23
gattttccta ggcacgttat c 21
<210> 24
<211> 42
<212> DNA
<213>Primer 12
<400> 24
gacgaaagct gggaggcctg ggaaattcgc ggtacccact ag 42
Claims (10)
1. a kind of method that big flux screening plant virus replicates required host's gene, which is characterized in that include the following steps:
1) structure of induction type viral infectivity clone:The expression vector includes agrobatcerium T-DNA left margin sequence, Agrobacterium
T-DNA right border sequences, inducible promoter, plant positive sense RNA virus full-length cDNA, eukaryotic transcription terminator, Escherichia coli
Required element and resistance screening gene are replicated with Agrobacterium, wherein plant positive sense RNA virus full-length cDNA is located at induction type startup
Between son and eukaryotic transcription terminator sequence, agrobatcerium T-DNA right border sequence is located at inducible promoter upstream, Agrobacterium T-
DNA left margin sequences are located at eukaryotic transcription terminator downstream;The induction type viral infectivity Cloning Transformation Escherichia coli place of acquisition
In main bacterium, positive transformant is obtained;
2) genetic transformation of induction type viral infectivity clone:The positive transformant that step 1) is obtained imports Agrobacterium, then
Induction type viral infectivity clone is transferred in plant, genetically modified plants are obtained;
3) plant virus replicates the big flux screening of indispensable gene:Mutant library is built with genetically modified plants, after mutant germination,
Virus infection is induced using derivant, carries out the screening of mutant, the mutant plant that virus cannot be induced is obtained, in conjunction with figure
The method of position clone and genome sequencing determines that the plant virus of screening replicates indispensable gene.
2. the method that a kind of big flux screening plant virus according to claim 1 replicates required host's gene, feature
It is, the host strain of the Escherichia coli is Escherichia coli Trans10, and the Agrobacterium is Agrobacterium GV3101.
3. the method that a kind of big flux screening plant virus according to claim 1 replicates required host's gene, feature
It is, the agrobatcerium T-DNA left margin sequence such as SEQ ID NO:Shown in 1;The agrobatcerium T-DNA right border sequence is such as
SEQ ID NO:Shown in 2;The Escherichia coli and Agrobacterium replicate the sequence such as SEQ ID NO of required element:Shown in 3.
4. the method that a kind of big flux screening plant virus according to claim 1 replicates required host's gene, feature
It is, step 1) the plant positive sense RNA virus is potyvirus or potexvirus virus;The horse
It includes Brassica 2 et 4, marmor upsilon, marmor solani, plumpox virus, papaya ring spot that bell potato Y virus, which belongs to virus,
Poison, soybean mosaic virus and marmor erodens;The potexvirus virus includes potato virus X, potato Austria
Cuba's mosaic virus, garcinia mangostana mosaic virus, plantago mosaic virus and foxtail mosaic virus.
5. the method that a kind of big flux screening plant virus according to claim 4 replicates required host's gene, feature
It is, step 1) the plant positive sense RNA virus full-length cDNA is the full-length cDNA of Brassica 2 et 4, sequence such as SEQ ID
NO:Shown in 4.
6. the method that a kind of big flux screening plant virus according to claim 4 replicates required host's gene, feature
It is, step 1) the plant positive sense RNA virus full-length cDNA is the full-length cDNA of potato virus X, sequence such as SEQ ID
NO:Shown in 5.
7. the method that a kind of big flux screening plant virus according to claim 1 replicates required host's gene, feature
It is, the inducible promoter described in step 1) is estrogen-inducible promoter XVE, sequence such as SEQ ID NO:Shown in 6.
8. the method that a kind of big flux screening plant virus according to claim 7 replicates required host's gene, feature
It is, step 1) the resistance screening gene is hygromycin gene, sequence such as SEQ ID NO:Shown in 7, the hygromycin gene,
Its upstream is estrogen-inducible promoter XVE-1, sequence such as SEQ ID NO:It is downstream estrogen-inducible shown in 8
Promoter XVE-2, sequence such as SEQ ID NO:Shown in 9.
9. the method that a kind of big flux screening plant virus according to claim 8 replicates required host's gene, feature
It is, the plant positive sense RNA virus full-length cDNA described in step 1), the promoter of upstream is estrogen-inducible promoter
XVE-2。
10. the method that a kind of big flux screening plant virus according to claim 1 replicates required host's gene, feature
It is, step 1) the eukaryotic transcription terminator is T3A terminators, sequence such as SEQ ID NO:Shown in 10.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810631815.8A CN108753815A (en) | 2018-06-19 | 2018-06-19 | A kind of method that big flux screening plant virus replicates required host's gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810631815.8A CN108753815A (en) | 2018-06-19 | 2018-06-19 | A kind of method that big flux screening plant virus replicates required host's gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108753815A true CN108753815A (en) | 2018-11-06 |
Family
ID=63978870
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810631815.8A Pending CN108753815A (en) | 2018-06-19 | 2018-06-19 | A kind of method that big flux screening plant virus replicates required host's gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108753815A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109234221A (en) * | 2018-11-19 | 2019-01-18 | 东北农业大学 | A kind of potato virus X attenuated vaccine and the preparation method and application thereof |
CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d plant RNA virus resistant vector and construction method and application thereof |
CN113355352A (en) * | 2021-05-20 | 2021-09-07 | 福建农林大学 | Method for modifying virus expression vector based on TuMV-phe virus gene of radix pseudostellariae |
CN114891827A (en) * | 2022-04-22 | 2022-08-12 | 中国农业科学院植物保护研究所 | Application of Nicotiana benthamiana MTA gene in regulation and control of plant virus resistance and transgenic plant cultivation method |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1712530A (en) * | 2004-06-24 | 2005-12-28 | 中国科学院微生物研究所 | Method for removing selective labelled gene in genetic plant |
WO2010099462A2 (en) * | 2009-02-26 | 2010-09-02 | Baylor University | Highly efficient suppressor-dependent protein expression in plants with a viral vector |
CN104388463A (en) * | 2014-10-30 | 2015-03-04 | 中国农业大学 | Cucumber mosaic virus induced gene silencing system and application thereof |
CN105572089A (en) * | 2016-01-15 | 2016-05-11 | 西南大学 | Method for rapidly screening plant virus inhibitor |
CN107475289A (en) * | 2017-09-05 | 2017-12-15 | 中国农业科学院植物保护研究所 | Apple necrosis mosaic virus full length infectious cDNA and its construction method |
CN107828816A (en) * | 2017-10-20 | 2018-03-23 | 云南省烟草农业科学研究院 | One primary yeast Agrobacterium shuttle vector and construction method and application |
-
2018
- 2018-06-19 CN CN201810631815.8A patent/CN108753815A/en active Pending
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1712530A (en) * | 2004-06-24 | 2005-12-28 | 中国科学院微生物研究所 | Method for removing selective labelled gene in genetic plant |
WO2010099462A2 (en) * | 2009-02-26 | 2010-09-02 | Baylor University | Highly efficient suppressor-dependent protein expression in plants with a viral vector |
CN104388463A (en) * | 2014-10-30 | 2015-03-04 | 中国农业大学 | Cucumber mosaic virus induced gene silencing system and application thereof |
CN105572089A (en) * | 2016-01-15 | 2016-05-11 | 西南大学 | Method for rapidly screening plant virus inhibitor |
CN107475289A (en) * | 2017-09-05 | 2017-12-15 | 中国农业科学院植物保护研究所 | Apple necrosis mosaic virus full length infectious cDNA and its construction method |
CN107828816A (en) * | 2017-10-20 | 2018-03-23 | 云南省烟草农业科学研究院 | One primary yeast Agrobacterium shuttle vector and construction method and application |
Non-Patent Citations (8)
Title |
---|
D. C. TUO等: "Two agroinfection-compatible fluorescent protein-tagged infectious cDNA clones of papaya leaf distortion mosaic virus facilitate the tracking of virus infection", 《ACTA VIROLOGICA》 * |
SUNG UN HUH等: "Arabidopsis Pumilio protein APUM5 suppresses Cucumber mosaic virus infection via direct binding of viral RNAs", 《PNAS》 * |
XIAO-YAN ZHANG等: "Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation", 《VIRUS RESEARCH》 * |
ZUO,J.等: "Plant expression vector pER8, complete plasmid sequence,Zuo,J.等,GenBank DataBase,Accession No. AF309825.2", 《GENBANK DATABASE》 * |
曹墨菊主编: "《植物生物技术概论》", 30 October 2014 * |
胡晓龙等: "转基因拟南芥中雌激素诱导的转录激活系统诱导条件的优化", 《安徽农业科学》 * |
邱艳红等: "黄瓜花叶病毒RNA1侵染性cDNA克隆构建及病毒致病因子的分析", 《植物检疫》 * |
马建岗编著: "《基因工程学原理 第3版》", 28 February 2013 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109234221A (en) * | 2018-11-19 | 2019-01-18 | 东北农业大学 | A kind of potato virus X attenuated vaccine and the preparation method and application thereof |
CN109234221B (en) * | 2018-11-19 | 2021-12-21 | 东北农业大学 | Potato X virus attenuated vaccine and preparation method and application thereof |
CN111549054A (en) * | 2020-05-22 | 2020-08-18 | 中国农业科学院植物保护研究所 | CRISPR/RfxCas13d plant RNA virus resistant vector and construction method and application thereof |
CN113355352A (en) * | 2021-05-20 | 2021-09-07 | 福建农林大学 | Method for modifying virus expression vector based on TuMV-phe virus gene of radix pseudostellariae |
CN114891827A (en) * | 2022-04-22 | 2022-08-12 | 中国农业科学院植物保护研究所 | Application of Nicotiana benthamiana MTA gene in regulation and control of plant virus resistance and transgenic plant cultivation method |
CN114891827B (en) * | 2022-04-22 | 2023-08-01 | 中国农业科学院植物保护研究所 | Application of Nicotiana benthamiana MTA gene in regulation and control of plant virus resistance and transgenic plant cultivation method |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101405394B (en) | D-amino acid selection for soybean | |
CN108753815A (en) | A kind of method that big flux screening plant virus replicates required host's gene | |
Grayburn et al. | Transformation of sunflower (Helianthus annuus L.) following wounding with glass beads | |
CN111139260B (en) | Method for improving whiteness of wheat flour by using gene editing | |
CN111630175B (en) | Method for improving gene editing efficiency based on homologous recombination in plant body | |
CN112725348B (en) | Gene and method for improving single-base editing efficiency of rice and application of gene | |
CN108026150A (en) | Stem rust of wheat resistant gene and application method | |
EP0803572A2 (en) | Cpc gene for regulating initiation of root hair formation for arabidopsis (thaliana), and transgenic (arabidopsis) plant overexpressing the cpc gene | |
CN113801891B (en) | Construction method and application of beet BvCENH3 gene haploid induction line | |
MXPA01006457A (en) | Transgenic plants and methods for production thereof. | |
CN109811004B (en) | Application of expression vector in producing brown yellow fiber by specifically expressing GhPSY2 gene in secondary wall development stage of cotton | |
CN109266647A (en) | Rice-stem borer is caused harm inducible promoter and its application | |
CN114045302A (en) | Single-base editing vector and construction and application thereof | |
CN105566468B (en) | Plant fertility GAP-associated protein GAP and its application | |
CA1337280C (en) | Production of proteins in plants | |
CN110172477B (en) | Optimized chemical induced deletion expression vector for obtaining selectable marker-free transgenic plant and application thereof | |
CN110616220A (en) | Method for improving hardness of wheat grains | |
CN111424044B (en) | Wheat TaDCL4 gene and application thereof in pollen fertility | |
CN111534522B (en) | Wheat TaRDR6 gene and application thereof in male sterility | |
CN111269934B (en) | Method for improving phosphorus utilization rate of wheat by using gene editing | |
CN111575312B (en) | Method for inducing abortion of wheat pollen | |
CN111269935B (en) | Wheat TaDA2 gene Cas9 vector and application thereof | |
US6525245B1 (en) | Method for identifying components involved in signal transduction pathways in higher plants | |
CN113215156B (en) | Method for efficiently creating fragrant corn by using CRISPR/Cas9 technology | |
CN111850031B (en) | Application of protein GmFULc in regulation and control of plant yield |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181106 |