CN113215156B - Method for efficiently creating fragrant corn by using CRISPR/Cas9 technology - Google Patents

Abstract

The invention discloses a method for efficiently creating fragrant corn by using a CRISPR/Cas9 technology. The invention designs targets for exon regions of corn ZmBADH2-1 gene and ZmBADH2-2 gene, constructs CRISPR/Cas9 gene editing vector, and obtains double-gene knockout mutant through genetic transformation. Experiments prove that: in 4 seeds of the T1 generation double-gene knockout mutant, the highest 2-AP content is 438.29 mug/kg^‑1The minimum content is 161.82 mug/kg^‑1And 2-AP is not detected in unedited Jing 724. The invention utilizes CRISPR/Cas9 technology to directionally and efficiently improve corn aroma character from molecular genetics level, efficiently creates corn backbone parent new germplasm with different aroma gradients, and provides a new breeding material for development of aroma corn varieties and improvement of corn taste quality.

Description

Method for efficiently creating fragrant corn by using CRISPR/Cas9 technology

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for efficiently creating fragrant corn by using a CRISPR/Cas9 technology.

Background

The fragrance is an important character for improving the quality of crops, is one of important contents for improving the quality, and the crop variety with the fragrance is highly favored by consumers. For example, the planting and breeding of fragrant rice has a long history and a good result, and fragrant rice is planted in all countries. The famous fragrant rice varieties comprise rice flower fragrance in northeast China, Basmati in India, jasmine fragrant rice in Thailand and the like. These varieties of scented rice have high economic value. The germplasm resources of the fragrant rice are extremely rich, and the fragrant rice breeding is greatly facilitated. Corn is one of the most important food grains in the world, and about one third of the population worldwide today has corn as the main food grain. With the development of corn breeding and matched processing industries, the edible quality of corn is continuously improved, and fresh corn and new corn food such as corn flakes, corn flour, corn grit, instant corn and the like are very popular in domestic and foreign markets. However, the cultivation of the aromatic corn varieties needs to be further enhanced, and the discovery and creation of novel high-quality aromatic corn germplasm resources are important ways.

Genome editing techniques mainly rely on artificial endonucleases (SSNs) and a series of functional modules to perform operations such as deletion, insertion and base substitution of bases or DNA fragments in a target genome region. After ZFN and TALEN, the CRISPR/Cas9 nuclease is used as a new generation gene editing technology, has the advantages of simplicity, high efficiency and the like, and is rapidly and successfully applied to animals and plants. If LE and the like knock out the corns Sh2 and Wx simultaneously by using CRISPR/Cas9 technology, the method is proved to be capable of rapidly breeding sweet waxy corn varieties; SHI and the like edit the promoter of a corn endogenous gene ARGOS8 by using a CRISPR/Cas9 technology, so that the expression quantity of the gene is improved, and the drought tolerance of corn is further improved; ZHANG and the like knock out the corn SD1 by using a gene editing technology, so that the adjustment of the height of the corn plant is successfully realized; SVITASHEV etc. through the fixed-point editing of the MS26 and MS45, the male sterile material of corn is rapidly bred. These successful gene editing breeding efforts fully demonstrate the high efficiency of CRISPR/Cas9 gene editing technology in targeted genetic improvement in maize.

Disclosure of Invention

The first object of the present invention is to provide a kit for knocking out ZmBADH2-1 gene and ZmBADH2-2 gene in maize genome.

The kit for knocking out ZmBADH2-1 gene and ZmBADH2-2 gene in corn genome provided by the invention comprises sgRNA or biological material related to the sgRNA, Cas9 nuclease or biological material related to the Cas9 nuclease;

the sgRNA is esgRNA of a target gene target sequence; the esgRNA structure of the target gene target sequence is as follows: an RNA-esgRNA backbone transcribed from the target gene sequence;

the target genes are ZmBADH2-1 gene and ZmBADH2-2 gene;

the target point sequence of the target gene is sequence 5;

the ZmBADH2-1 gene is a gene shown as b1) -b 4):

b1) a genomic DNA molecule shown in a sequence 1 or a cDNA molecule shown in a sequence 2;

b2) a cDNA molecule or a genomic DNA molecule having 75% or more than 75% identity to the nucleotide sequence defined in b 1);

b3) a cDNA molecule or a genomic DNA molecule derived from maize and having 75% or more identity to the nucleotide sequence defined in b 1);

b4) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with a nucleotide sequence defined in b1) or b2) or b 3);

the ZmBADH2-2 gene is a gene shown as the following c1) -c 4):

c1) a genomic DNA molecule shown in a sequence 3 or a cDNA molecule shown in a sequence 4;

c2) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in c 1);

c3) a cDNA molecule or a genomic DNA molecule derived from maize and having 75% or more identity to the nucleotide sequence defined in c 1);

c4) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with a nucleotide sequence defined under c1) or c2) or c 3).

In the kit, the Cas9 nucleases include Cas9 nuclease or variants thereof, Cas9 inactivating enzyme (dead Cas9, dCas9) or variants thereof, Cas9 nickase (Cas9 nickase, Cas9n) or variants thereof from different sources. The Cas9 nucleases or variants thereof from different sources include Cas9 (such as SaCas9, SaCas9-KKH and the like), Cas9-PAM variants (such as xCas9, NG Cas9, Cas9-VQR, Cas9-VRER and the like), Cas9 high fidelity enzyme variants (such as HypaCas9, eSPcas9(1.1), Cas9-HF1 and the like) and the like. In a particular embodiment of the invention, the Cas9 nuclease is specifically SpCas9 protein. The encoding gene sequence of the SpCas9 protein is shown as 2912-7012 of a sequence 6.

The esgRNA framework sequence is an RNA molecule obtained after replacing T in positions 599-684 of the sequence 6 with U.

Further, the kit also comprises a screening agent resistance gene or biological materials related to the screening agent resistance gene. In one embodiment of the present invention, the screening agent resistance gene is specifically Phosphomannose isomerase (PMI) gene. The PMI gene sequence is shown in the 9430-10608 position of the sequence 6.

Further, the biological material related to the sgrnas is an expression cassette, a recombinant vector, a recombinant microorganism, or a recombinant cell line encoding the sgrnas.

The biological material associated with the Cas9 nuclease is an expression cassette, recombinant vector, recombinant microorganism, or recombinant cell line encoding the Cas9 nuclease.

The biological material related to the screening agent resistance gene is an expression cassette, a recombinant vector, a recombinant microorganism or a recombinant cell line which encodes the screening agent resistance gene.

The second purpose of the invention is to provide an expression cassette, a recombinant vector, a recombinant microorganism or a recombinant cell line containing the gene coding for the reagent kit.

In one embodiment of the invention, the nucleotide sequence of the recombinant vector is sequence 6.

The third purpose of the invention is to provide a new application of the reagent kit or an expression cassette, a recombinant vector, a recombinant microorganism or a recombinant cell line containing the gene coding for the reagent kit.

The invention provides the application of the kit or an expression cassette, a recombinant vector, a recombinant microorganism or a recombinant cell line containing the gene coding the kit in any one of the following M1) -M10):

m1) to create a maize mutant with ZmBADH2-1 and ZmBADH2-2 double gene knockout;

m2) preparing a product for creating a corn mutant with ZmBADH2-1 and ZmBADH2-2 double gene knockout;

m3) breeding aromatic corn;

m4) preparing a product for cultivating fragrant corn;

m5) improving the 2-AP content in the corn kernels;

m6) preparing a product for improving the 2-AP content in the corn kernels;

m7) improving corn kernel aroma;

m8) preparing a product for improving the fragrance of corn kernels;

m9) breeding corn;

m10) preparing a product for corn breeding.

A fourth object of the present invention is to provide any one of the following methods N1) -N5):

n1) A method for creating maize mutants with double knockout of ZmBADH2-1 and ZmBADH2-2 comprising the steps of: introducing a coding gene of Cas9 nuclease, a DNA molecule of esgRNA for transcribing a target gene target sequence and a screening agent resistance gene into receptor corn, so that the Cas9 nuclease, the sgRNA and the screening agent resistance gene are expressed, and a corn mutant with double gene knockout of ZmBADH2-1 and ZmBADH2-2 is obtained;

n2) a method for growing aromatic corn comprising the steps of: introducing the encoding gene of the Cas9 nuclease, the DNA molecule of the esgRNA for transcribing the target gene target sequence and the screening agent resistance gene into receptor corn, so that the Cas9 nuclease, the sgRNA and the screening agent resistance gene are all expressed to obtain fragrant corn;

n3) A method for increasing the 2-AP content in corn kernels, comprising the steps of: introducing the encoding gene of the Cas9 nuclease, the DNA molecule of the esgRNA for transcribing the target gene target sequence and the screening agent resistance gene into a receptor corn, so that the Cas9 nuclease, the sgRNA and the screening agent resistance gene are all expressed, and the content of 2-AP in corn grains is improved;

n4) a method of enhancing the flavor of corn kernels comprising the steps of: the coding gene of Cas9 nuclease, the DNA molecule of esgRNA for transcribing a target gene target sequence and a screening agent resistance gene are introduced into receptor corn, so that the Cas9 nuclease, the sgRNA and the screening agent resistance gene are expressed, and the corn kernel fragrance is improved;

n5) A method of maize breeding comprising the steps of: obtaining the corn mutant with ZmBADH2-1 and ZmBADH2-2 double gene knockout according to the method of N1), and breeding by taking the corn mutant as a variety or as a parent material.

Further, the maize mutant is a BH02 mutant strain, a BH06 mutant strain, a BH11 mutant strain, or a BH13 mutant strain:

the difference between the genome DNA of the BH02 mutant strain and the genome DNA of the maize inbred line Jing 724 is only that in a ZmBADH2-1 gene (sequence 1), 1bp of base deletion is carried out on one chromosome, the deleted base is the 3681 st site of the sequence 1, 2bp of base deletion is carried out on the other chromosome, the deleted base is the 3680 st and 3681 st sites of the sequence 1, in a ZmBADH2-2 gene (sequence 3), 1bp of base deletion is carried out on one chromosome, the deleted base is the 3375 st site of the sequence 3, 1bp of base A insertion is carried out on the other chromosome, and the inserted position of the base A is between the 3374 th site and the 3375 th site of the sequence 3;

the difference between the genome DNA of the BH06 mutant strain and the genome DNA of the maize inbred line Jing 724 is only that in a ZmBADH2-1 gene (sequence 1), 15bp base deletion is carried out on one chromosome, the deleted base is the 3666 rd and 3680 th positions of the sequence 1, 4bp base deletion is carried out on the other chromosome, the deleted base is the 3682 th and 3685 th positions of the sequence 1, in a ZmBADH2-2 gene (sequence 3), 9bp base deletion is carried out on one chromosome, the deleted base is the 3367 rd and 3375 th positions of the sequence 3, and 19bp base deletion is carried out on the other chromosome, and the deleted bases are the 3354 th position and the 3360 nd and 3377 th positions of the sequence 3;

the difference between the genome DNA of the BH11 mutant strain and the genome DNA of the maize inbred line Jing 724 is only that in a ZmBADH2-1 gene (sequence 1), 1bp base deletion is carried out on one chromosome, the deleted base is 3673 th in the sequence 1, 5bp base deletion is carried out on the other chromosome, the deleted base is 3677 rd and 3681 th in the sequence 1, in a ZmBADH2-2 gene (sequence 3), 5bp base deletion is carried out on one chromosome, the deleted base is 3371 nd and 3375 th in the sequence 3, and 2bp base deletion is carried out on the other chromosome, and the deleted bases are 3371 nd and 3375 th in the sequence 3;

the difference between the genome DNA of the BH13 mutant strain and the genome DNA of the maize inbred line Jing 724 is only that in a ZmBADH2-1 gene (sequence 1), 19bp base deletion is carried out on one chromosome, the deleted base is the 3663 rd and 3681 th positions of the sequence 1, 11bp base deletion is carried out on the other chromosome, the deleted base is the 3674 th and 3684 th positions of the sequence 1, in a ZmBADH2-2 gene (sequence 3), 3bp base deletion is carried out on one chromosome, the deleted base is the 3375 th and 3377 th positions of the sequence 3, 2bp base CT insertion is carried out on the other chromosome, and the inserted position of the base CT is between the 3376 th position and the 3377 th position of the sequence 3.

The fragrant corns are corns with different fragrance gradients. In one embodiment of the invention, the corn with different flavor gradients has a 2-AP content of 438.29 μ g-kg^-1、404.63μg·kg^-1、348.65μg·kg^-1And 161.82. mu.g/kg^-1The corn of (1).

It is a fifth object of the present invention to provide a nucleic acid molecule.

The nucleic acid molecule provided by the invention is any one of the following P1) -P4):

p1) the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, wherein the nucleic acid molecule A is a sequence 7 and/or a sequence 8, and the nucleic acid molecule B is a sequence 9 and/or a sequence 10;

p2) the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, wherein the nucleic acid molecule A is sequence 11 and/or sequence 12, and the nucleic acid molecule B is sequence 13 and/or sequence 14;

p3) said nucleic acid molecule comprises nucleic acid molecule a and nucleic acid molecule b, said nucleic acid molecule a is sequence 15 and/or sequence 16, said nucleic acid molecule b is sequence 17 and/or sequence 18;

p4) the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, wherein the nucleic acid molecule A is a sequence 19 and/or a sequence 20, and the nucleic acid molecule B is a sequence 21 and/or a sequence 22.

The nucleic acid molecule may be a single-stranded DNA molecule or a double-stranded DNA molecule. When the nucleic acid molecule is a single-stranded DNA molecule, in the P1), the nucleic acid molecule A is a sequence 7 or a sequence 8, and the nucleic acid molecule B is a sequence 9 or a sequence 10; in the P2), the nucleic acid molecule A is a sequence 11 or a sequence 12, and the nucleic acid molecule B is a sequence 13 or a sequence 14; in P3), the nucleic acid molecule A is sequence 15 or sequence 16, and the nucleic acid molecule B is sequence 17 or sequence 18; the P4), the nucleic acid molecule A is sequence 19 or sequence 20, and the nucleic acid molecule B is sequence 21 or sequence 22.

When the nucleic acid molecule is a double-stranded DNA molecule, the nucleic acid molecule A is shown as a sequence 7 and a sequence 8, and the nucleic acid molecule B is shown as a sequence 9 and a sequence 10 in the P1); the P2), the nucleic acid molecule A is shown as a sequence 11 and a sequence 12, and the nucleic acid molecule B is shown as a sequence 13 and a sequence 14; the P3), the nucleic acid molecule A is sequence 15 and sequence 16, and the nucleic acid molecule B is sequence 17 and sequence 18; the P4), the nucleic acid molecule A is shown as a sequence 19 and a sequence 20, and the nucleic acid molecule B is shown as a sequence 21 and a sequence 22.

Further, in P1), the nucleic acid molecule includes a nucleic acid molecule a and a nucleic acid molecule B, the nucleic acid molecule a is sequence a and/or sequence B, the nucleic acid molecule B is sequence C and/or sequence D; the sequence A is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 7 and keeping other sequences unchanged; the sequence B is obtained by replacing the 3665-3684 th site of the sequence 1 with a sequence 8 and keeping other sequences unchanged; the sequence C is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 9 and keeping other sequences unchanged; the sequence D is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 10 and keeping other sequences unchanged;

the P2), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence E and/or a sequence F, and the nucleic acid molecule B is a sequence G and/or a sequence H; the sequence E is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 11 and keeping other sequences unchanged; the sequence F is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 12 and keeping other sequences unchanged; the sequence G is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 13 and keeping other sequences unchanged; the sequence H is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 14 and keeping other sequences unchanged;

the P3), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence I and/or a sequence J, and the nucleic acid molecule B is a sequence K and/or a sequence L; the sequence I is obtained by replacing 3665-3684 th site of the sequence 1 with the sequence 15 and keeping other sequences unchanged; the sequence J is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 16 and keeping other sequences unchanged; the sequence K is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 17 and keeping other sequences unchanged; the sequence L is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 18 and keeping other sequences unchanged;

the P4), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence M and/or a sequence N, and the nucleic acid molecule B is a sequence O and/or a sequence P; the sequence M is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 19 and keeping other sequences unchanged; the sequence N is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 20 and keeping other sequences unchanged; the sequence O is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 21 and keeping other sequences unchanged; the sequence P is obtained by replacing 3359-3378 of the sequence 3 with the sequence 22 and keeping other sequences unchanged.

Further, in P1), the nucleic acid molecules include a nucleic acid molecule a and a nucleic acid molecule b, wherein the nucleic acid molecule a is sequence a and/or sequence b, and the nucleic acid molecule b is sequence c and/or sequence d; the sequence a is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 7 and keeping other sequences unchanged; the sequence b is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 8 and keeping other sequences unchanged; the sequence c is obtained by replacing the 447-466 position of the sequence 4 with the sequence 9 and keeping other sequences unchanged; the sequence d is obtained by replacing the 447-466 position of the sequence 4 with the sequence 10 and keeping other sequences unchanged;

the P2), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence e and/or a sequence f, and the nucleic acid molecule B is a sequence g and/or a sequence h; the sequence e is obtained by replacing the position 444-463 of the sequence 2 with the sequence 11 and keeping other sequences unchanged; the sequence f is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 12 and keeping other sequences unchanged; the sequence g is obtained by replacing the 447-466 position of the sequence 4 with the sequence 13 and keeping other sequences unchanged; the sequence h is obtained by replacing the 447-466 locus of the sequence 4 with the sequence 14 and keeping other sequences unchanged;

the P3), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence i and/or a sequence j, and the nucleic acid molecule B is a sequence k and/or a sequence l; the sequence i is obtained by replacing the position 444-463 of the sequence 2 with the sequence 15 and keeping other sequences unchanged; the sequence j is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 16 and keeping other sequences unchanged; the sequence k is obtained by replacing the 447-466 position of the sequence 4 with the sequence 17 and keeping other sequences unchanged; the sequence l is obtained by replacing the 447-466 locus of the sequence 4 with the sequence 18 and keeping other sequences unchanged;

the P4), the nucleic acid molecule comprises a nucleic acid molecule A and a nucleic acid molecule B, the nucleic acid molecule A is a sequence m and/or a sequence n, and the nucleic acid molecule B is a sequence o and/or a sequence P; the sequence m is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 19 and keeping other sequences unchanged; the sequence n is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 20 and keeping other sequences unchanged; the sequence o is obtained by replacing the 447-466 position of the sequence 4 with the sequence 21 and keeping other sequences unchanged; the sequence p is obtained by replacing the 447-466 th site of the sequence 4 with the sequence 22 and keeping the other sequences unchanged.

It is a final object of the present invention to provide a method for growing flavored corn.

The method for cultivating the fragrant corn provided by the invention comprises the following steps: planting at least one seed of corn, said corn comprising said nucleic acid molecule, and allowing said seed to grow into a plant.

In any one of the above kits or uses or methods, the maize variety is Jing 724.

The invention has the following beneficial effects:

1) the sgRNA target sequences designed aiming at target genes ZmBADH2-1 and ZmBADH2-2 in corn have good specificity and high knockout efficiency, and the specific expression is that the target genes ZmBADH2-1 and ZmBADH2-2 can be knocked out simultaneously, and the co-knockout efficiency can reach 100%.

2) The method can obtain new corn germplasm with different fragrance gradients, can meet different requirements of different consumer groups on corn taste, and generates great economic additional value.

3) Jing 724 has many advantages such as high combining ability, high resistance and high yield, and has been used as female parent to breed a plurality of excellent corn varieties such as Jingke 968, MC738 and MC 948. Especially, the Beijing department 968 has the annual popularization area exceeding 2000 ten thousand mu, and is the domestic first three famous dominant large variety. The novel fragrant Jing 724 germplasm created by the method has important application value.

Based on the principle of CRISPR/Cas9 gene editing technology, specific targets are designed at exons of target candidate genes ZmBADH2-1 and ZmBADH2-2, and a CRISPR/Cas9 gene editing vector is constructed. And then using a corn backbone parent Jing 724 as a receptor, and screening by Phosphomannose isomerase (PMI) resistance to obtain a positive transgenic strain by utilizing an agrobacterium-mediated genetic transformation method. Most preferablyThe mutation type of the later transgenic line in the target gene is determined by sequencing, and the content of the main fragrant substance 2-AP of the fragrant rice in seeds of the T1 generation of the gene editing line is detected by using a Gas chromatography-mass spectrometry (GC-MS) instrument so as to determine the change of the content of the 2-AP of Jing 724 before and after gene editing. The results show that: designing targets for exon regions of the two genes, constructing a CRISPR/Cas9 gene editing vector, and obtaining 28 transgenic strains through genetic transformation. Sequencing analysis results show that target areas of ZmBADH2-1 and ZmBADH2-2 in 10 strains of materials are mutated, the mutation types are different numbers of base deletion, substitution and insertion, and the double-gene co-knockout efficiency reaches 100%. The average 2-AP content in the grains of 4 randomly selected T1 generation gene editing strains is 438.29 mug/kg^-1、404.63μg·kg^-1、348.65μg·kg^-1And 161.82. mu.g/kg^-1While 2-AP was not detected in unedited Jing 724. The invention simultaneously carries out site-directed knockout on the ZmBADH2-1 gene and the ZmBADH2-2 gene of the corn by using the CRISPR/Cas9 technology, directionally and efficiently improves the aroma character of the corn from the aspect of molecular genetics, efficiently creates a new germplasm of backbone parents of the corn with different aroma gradients, and provides a new breeding material for the development of aroma type corn varieties and the promotion of the taste quality of the corn.

Drawings

FIG. 1 is a schematic diagram showing the structures of ZmBADH2-1 and ZmBADH2-2 genes.

FIG. 2 is a schematic diagram of the knockout vector structure.

FIG. 3 shows the base and protein mutations of ZmBADH2-1 and ZmBADH2-2 knockout maize mutant material. A is the base mutation status of the maize mutant material with ZmBADH2-1 and ZmBADH2-2 gene knockout (wild type ZmBADH2-1 gene (94-130 th site) and ZmBADH2-2 gene (99-136 th site) in FIG. 3A are respectively for the 4 th exon of ZmBADH2-1 gene and ZmBADH2-2 gene); b is the mutation condition of the ZmBADH2-1 and ZmBADH2-2 proteins caused by base mutation.

FIG. 4 shows Zmbadh1/Zmbadh2 double mutant T1 generation seeds.

FIG. 5 shows the chromatogram and the content of 2-AP in the seeds of the gene editing strain (n is 3, mean. + -. standard deviation). A is a 2-AP chromatogram in grains of a gene editing strain; and B is the content of 2-AP in the grains of the gene editing strain (n is 3, and the average value is +/-standard deviation).

FIG. 6 is the chromatogram of 2-AP of rice flower fragrance seeds and the mass spectrum of 2-AP in seeds of rice flower fragrance seed and BH02 gene editing line T1. A is a chromatogram of the rice flower fragrance seeds 2-AP; b and C are 2-AP mass spectrograms in the seeds of the rice floral fragrance and the BH02 gene editing line T1.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Beijing 724, an inbred corn line, described in examples below, is described in "WANG X, SHI Z, ZHANG R, SUN X, WANG J, WANG S, ZHANG Y, ZHAO Y, SU A, LI C, WANG R, ZHANG Y, WANG S, WANG Y, SONG W, ZHAO J.Stalk architecture, cell wall composition, and QTL undercording high stand flexibility for improved flexibility resistance in mail. BMC Plant Biology,2020.20(1): 515", publicly available from the Applicant (Beijing Nongline academy of sciences), which is used only for repetition of experiments related to the present invention and is not useful for other applications.

The primers used in the following examples are shown in Table 1.

TABLE 1

Example 1 preparation of maize mutant Material with double Gene knockout of ZmBADH2-1 and ZmBADH2-2 and determination of aroma substance 2-AP content thereof

Preparation of ZmBADH2-1 and ZmBADH2-2 double-gene knockout corn mutant material

1. Target gene

The invention uses ZmBADH2-1 gene and ZmBADH2-2 gene in corn as target genes, and uses CRISPR/Cas9 system to knock out ZmBADH2-1 gene and ZmBADH2-2 gene in corn, so as to obtain corn mutant with double gene knock-out of ZmBADH2-1 and ZmBADH 2-2.

Wherein, the ZmBADH2-1 gene is positioned on the No. 4 chromosome of the maize genome, consists of 15 exons and encodes 505 amino acids; the genome sequence of the ZmBADH2-1 gene is shown as sequence 1 in a sequence table, and the CDS sequence is shown as sequence 2 in the sequence table.

The ZmBADH2-2 gene is located on chromosome 1 of maize genome, and likewise has 15 exons, and the translated protein contains 506 amino acids. The genome sequence of the ZmBADH2-2 gene is shown as a sequence 3 in a sequence table, and the CDS sequence is shown as a sequence 4 in the sequence table.

The schematic structure of ZmBADH2-1 gene and ZmBADH2-2 gene is shown in FIG. 1.

2. Target design

According to the principle of CRISPR/Cas9 technology, the coding region sequences of genes ZmBADH2-1 and ZmBADH2-2 in Jing 724 are combined to design a sgRNA Target sequence Target1 with better 20bp specificity: TCTCCGAAGAGAGCCTATTG (SEQ ID NO: 5), which is located at positions 3359-3378 of SEQ ID NO: 3. Target1 is located on the 4 th exon of both ZmBADH2-1 and ZmBADH2-2 (FIG. 1), and the CRISPR/Cas9 vector containing the sgRNA can introduce mutations in both genes simultaneously.

3. CRISPR/Cas9 vector construction

The nucleotide sequence of the CRISPR/Cas9 vector containing Target1 is shown as a sequence 6 in a sequence table. Wherein, the 101-495 position of the sequence 6 is a nucleotide sequence of ZmU6 promoter, the 502-578 position is a nucleotide sequence of tRNA, the 579-598 position is a Target sequence Target1, the 599-684 position is an esgRNA framework sequence, the 685-975 position is a OsU3 terminator sequence, the 982-2695 position is an OsUbq3 promoter sequence, the 2912-7012 position is an SpCas9 sequence, the 7169-7423 position is a Nos terminator sequence, the 7452-9423 position is a ZmUbi promoter sequence, the 9430-10608 position is a PMI sequence, and the 10615-10868 position is a Nos terminator sequence.

A schematic diagram of the CRISPR/Cas9 vector structure is shown in figure 2.

4. Obtaining transgenic positive plants

And (3) transforming an agrobacterium strain EAH105 by using the constructed CRISPR/Cas9 vector, and identifying a positive transformation clone by using a PMI gene specific primer PMI-F/PMI-R. The positive agrobacterium strain is used for transforming callus of Jing 724 maize inbred line (the specific transformation step is referred to a method in the literature of ISHIDA Y, HIEIY, KOMARI T. Agrobacterium-mediated transformation of Nature Protocals,2007.2(7): 1614-21.), and the regenerated tissue obtained by PMI screening is used for culturing maize seedlings, namely T0 generation plants. Extracting genome DNA of T0 generation plants, and performing PCR amplification by using PMI specific primer PMI-F/PMI-R to obtain 1.2Kb target segment, namely T0 generation transgenic positive plants.

The results show that: agrobacterium containing the CRISPR/Cas9 vector was transformed into Jing 724 callus to obtain 28 strains of positive T0 plants.

5. Target gene target point sequence mutation type analysis of T0 generation positive plant

In order to detect the mutation condition of a target site, primer pairs are respectively designed on both sides of the target sites of genes ZmBADH2-1 and ZmBADH2-2, and PCR amplification is carried out on the T0 generation transgenic positive plant genome DNA. The ZmBADH2-1 target amplification primer is BH2-1-F/BH 2-1-R; the ZmBADH2-2 target amplification primer is BH2-2-F/BH 2-2-R. The PCR product was subjected to 1% agarose gel electrophoresis, gel tapping recovery, and Sanger sequencing. And (3) obtaining a T0 mutant plant by a plant with a sequencing peak image having double peaks at positions near the target point. Analyzing a sequencing peak map ab1 file by using a R language tool TIDE, and obtaining the mutation type (the number of inserted/deleted basic groups) of a mutant plant target point; and further using a DSDecodeM online tool and an R language tool sangerseqR in CRISPR-GE to analyze and obtain the specific mutant genotype of the mutant plant target.

The results of post-amplification sequencing of the upstream and downstream regions of the target of genes ZmBADH2-1 and ZmBADH2-2 show that: in 28 positive plants of T0 generations obtained in step 4, 10 positive plants of T0 generations have mutation of ZmBADH2-1 gene and ZmBADH2-2 gene, and the double-gene co-knockout efficiency (ZmBADH 2-1 gene and ZmBADH2-2 gene target sequence of mutated T0 positive plants/target sequence of mutated T0 positive plants) reaches 100%.

Further analysis on the sequencing results shows that the target regions of ZmBADH2-1 and ZmBADH2-2 in 10 positive T0 plants generate bi-allelic or multi-allelic mutations, the mutation types comprise base deletion, base insertion and base substitution (figure 3-A), and all the mutations result in the changes of premature termination or amino acid deletion of protein sequences of ZmBADH2-1 and ZmBADH2-2 (figure 3-B).

The specific mutation conditions of BH02, BH06, BH11 and BH13 mutant strains are as follows:

sequencing identification shows that: compared with the genome DNA of a maize inbred line Jing 724, the BH02 mutant strain only has the difference that in the gene ZmBADH2-1 (sequence 1), one chromosome has 1bp base deletion (the deletion base is the 3681 st site of the sequence 1), the other chromosome has 2bp base deletion (the deletion base is the 3680 rd and 3681 st sites of the sequence 1), in the gene ZmBADH2-2 (sequence 3), one chromosome has 1bp base deletion (the deletion base is the 3375 rd site of the sequence 3), and the other chromosome has 1bp base A insertion (the insertion site of the base A is between the 3374 th site and the 3375 th site of the sequence 3).

For the BH02 mutant line, in the ZmBADH2-1 gene, one chromosome contains sequence 7 or sequence A or sequence a, and the other chromosome contains sequence 8 or sequence B or sequence B, in the ZmBADH2-2 gene, one chromosome contains sequence 9 or sequence C or sequence C, and the other chromosome contains sequence 10 or sequence D or sequence D. The sequence A is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 7 and keeping other sequences unchanged; the sequence B is obtained by replacing the 3665-3684 th site of the sequence 1 with a sequence 8 and keeping other sequences unchanged; the sequence C is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 9 and keeping other sequences unchanged; the sequence D is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 10 and keeping other sequences unchanged; the sequence a is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 7 and keeping other sequences unchanged; the sequence b is obtained by replacing the position 444-463 of the sequence 2 with the sequence 8 and keeping other sequences unchanged; the sequence c is obtained by replacing the 447-466 position of the sequence 4 with the sequence 9 and keeping other sequences unchanged; the sequence d is obtained by replacing the 447-466 position of the sequence 4 with the sequence 10 and keeping the other sequences unchanged.

Sequencing identification shows that: compared with the genome DNA of the inbred line Jing 724 of maize, the BH06 mutant strain only has the difference that in the gene ZmBADH2-1 (sequence 1), 15bp base deletion (the deletion base is 3666-19 bit of the sequence 1) occurs on one chromosome, 4bp base deletion (the deletion base is 3682-85 bit of the sequence 1) occurs on the other chromosome, and in the gene ZmBADH2-2 (sequence 3), 9bp base deletion (the deletion base is 3367-3375 bit of the sequence 3) occurs on one chromosome, and 19bp base deletion (the deletion bases are 3354-3354 bit and 3360-3377 bit of the sequence 3) occurs on the other chromosome.

For the BH06 mutant line, in the ZmBADH2-1 gene, one chromosome contains the sequence 11 or the sequence E or the sequence E, and the other chromosome contains the sequence 12 or the sequence F or the sequence F, in the ZmBADH2-2 gene, one chromosome contains the sequence 13 or the sequence G or the sequence G, and the other chromosome contains the sequence 14 or the sequence H or the sequence H. The sequence E is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 11 and keeping other sequences unchanged; the sequence F is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 12 and keeping other sequences unchanged; the sequence G is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 13 and keeping other sequences unchanged; the sequence H is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 14 and keeping other sequences unchanged; the sequence e is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 11 and keeping other sequences unchanged; the sequence f is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 12 and keeping other sequences unchanged; the sequence g is obtained by replacing the 447-466 position of the sequence 4 with the sequence 13 and keeping other sequences unchanged; the sequence h is obtained by replacing the 447-466 position of the sequence 4 with the sequence 14 and keeping the other sequences unchanged.

Sequencing identification shows that: compared with the genomic DNA of the maize inbred line Jing 724, the BH11 mutant line only has the difference that in the ZmBADH2-1 gene (sequence 1), 1bp base deletion occurs on one chromosome (the deleted base is the 3673 th position of the sequence 1), 5bp base deletion occurs on the other chromosome (the deleted base is the 3677 th and 3681 th positions of the sequence 1), and in the ZmBADH2-2 gene (sequence 3), 5bp base deletion occurs on one chromosome (the deleted base is the 3371 nd and 3375 th positions of the sequence 3), and 2bp base deletion occurs on the other chromosome (the deleted base is the 3371 nd and 3375 th positions of the sequence 3).

For the BH011 mutant line, one chromosome contains the sequence 15 or the sequence I or the sequence I and the other chromosome contains the sequence 16 or the sequence J or the sequence J in the ZmBADH2-1 gene, and one chromosome contains the sequence 17 or the sequence K or the sequence K and the other chromosome contains the sequence 18 or the sequence L or the sequence L in the ZmBADH2-2 gene. The sequence I is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 15 and keeping other sequences unchanged; the sequence J is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 16 and keeping other sequences unchanged; the sequence K is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 17 and keeping other sequences unchanged; the sequence L is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 18 and keeping other sequences unchanged; the sequence i is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 15 and keeping other sequences unchanged; the sequence j is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 16 and keeping other sequences unchanged; the sequence k is obtained by replacing the 447-466 position of the sequence 4 with the sequence 17 and keeping other sequences unchanged; the sequence l is obtained by replacing the 447-466 position of the sequence 4 with the sequence 18 and keeping the other sequences unchanged.

Sequencing identification shows that: compared with the genomic DNA of the maize inbred line Jing 724, the BH13 mutant strain only has the difference that in the ZmBADH2-1 gene (sequence 1), 19bp base deletion (the deleted base is the 3663 rd and 3681 st positions of the sequence 1) occurs in one chromosome, 11bp base deletion (the deleted base is the 3674 th and 3684 st positions of the sequence 1) occurs in the other chromosome, and in the ZmBADH2-2 gene (sequence 3), 3bp base deletion (the deleted base is the 3375 rd and 3377 st positions of the sequence 3) occurs in one chromosome and 2bp CT insertion (the inserted position of the base is between the 3376 st position and the 3377 st position of the sequence 3) occurs in the other chromosome.

For the BH013 mutant line, one chromosome contained sequence 19 or sequence M or sequence M and the other chromosome contained sequence 20 or sequence N or sequence N in the ZmBADH2-1 gene, and one chromosome contained sequence 21 or sequence O or sequence O and the other chromosome contained sequence 22 or sequence P or sequence P in the ZmBADH2-2 gene. The sequence M is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 19 and keeping other sequences unchanged; the sequence N is obtained by replacing the 3665-3684 th site of the sequence 1 with the sequence 20 and keeping other sequences unchanged; the sequence O is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 21 and keeping other sequences unchanged; the sequence P is obtained by replacing 3359-3378 bit of the sequence 3 with the sequence 22 and keeping other sequences unchanged; the sequence m is obtained by replacing the position 444-463 of the sequence 2 with the sequence 19 and keeping other sequences unchanged; the sequence n is obtained by replacing the 444-463 th position of the sequence 2 with the sequence 20 and keeping other sequences unchanged; the sequence o is obtained by replacing the 447-466 position of the sequence 4 with the sequence 21 and keeping other sequences unchanged; the sequence p is obtained by replacing the 447-466 th site of the sequence 4 with the sequence 22 and keeping the other sequences unchanged.

All T0 transgenic positive plants were selfed to obtain T1 generation seeds.

Secondly, measuring the content of the aromatic substance 2-AP of the mutant material

Respectively taking 3g of wild type control Jing 724 mature seeds and gene editing mutant mature seeds (T1 generation seeds of BH02, BH06, BH11 and BH13 obtained in the step one), respectively taking 2g of rice variety Nipponbare and rice flower fragrance seeds, grinding the seeds into powder, and then determining the content of the fragrance substance 2-acetyl-1-pyrroline (2-AP). Procedure for determination of 2-AP content of fragrance substance reference is made to the method in "SHAN Q, ZHANG Y, CHEN K, ZHANG K, GAO C.creation of fragranced edge by target knock-out of the OsBADH2 gene using TALEN technology. plant Biotechnology Journal,2015.13(6):791-800 ]. With 2,4, 6-trimethylpyridine as an internal standard, 3 biological replicates per material. The determination experiment is completed by a metabonomics platform of the institute of genetics and development of Chinese academy of sciences. The detection results were analyzed using R language, multiple comparisons were performed using LSD, and p-value correction was performed using Bonferroni method.

The results show that: the 4 ZmBADH2-1/-2 co-knockout mutants of T1 generation seeds all showed obvious smell discernable fragrance, suggesting that T0 generation target gene mutation is stably inherited to T1 generation seeds and gene function is lost. In addition, from T1 seed generations, no adverse effect of simultaneous mutations in ZmBADH2-1 and ZmBADH2-2 on maize seed traits was observed (FIG. 4).

The content of 2-AP in T1 generation seeds of four gene editing strains of BH02, BH06, BH11 and BH13 is further detected. The 2-AP content measurement result shows that 2-AP is not detected in the Jing 724 control, and the 2-AP content in the seeds of 4 gene editing strains BH02, BH06, BH11 and BH13 is higher than that of the Jing 724 wild type control variety (P724 wild type variety)<0.01). Wherein the highest 2-AP content in BH06 is 438.29 mug/kg^-1(ii) a BH02 and BH11 times, 404.63 mug kg^-1And 348.65. mu.g/kg^-1(ii) a The 2-AP content in BH13 is lowest, 161.82 mug/kg^-1(FIG. 5). The target points of the 4 editing lines T1 generation plants are subjected to PCR amplification and then sequenced, and the result shows that the gene mutation generated by the T0 generation is stably inherited to the T1 generation, so that in T1 generation seeds obtained by T0 generation selfing, two genes are supposed to generate functional deletion or weakening, the 2-AP content in the seeds is increased, and the fragrance is generated.

To determine whether the same composition of 2-AP in oryza sativa was present in the seeds of maize mutant line T1, the oryza sativa seed was selected as a control. As can be seen from FIG. 6-A, 2-AP in the rice flower fragrance seeds can be effectively separated, and the retention time is about 8.3 min. The 2-AP mass spectrum shows that the molecular ion peak m/z 111, the characteristic fragment peaks m/ z 68 and 83 and the like are consistent with the existing research results (figure 6-B). In line BH02, mass spectrum results obtained at the same time are consistent with the mass spectrum of 2-AP in rice fragrance (FIGS. 6-B and 6-C), which indicates that 2-AP with the same composition as that of rice exists in corn ZmBADH2 double-gene knockout mutant grains.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> agriculture, forestry, and scientific colleges in Beijing

<120> method for efficiently creating fragrant corn by using CRISPR/Cas9 technology

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 12838

<212> DNA

<213> Artificial Sequence

<400> 1

cggtcggttc atcgtcagag acggcgggcg actctgctct cccgatgaag aggacgtcgg 60

ggtagaacgg tactgctgtc gcggtgattt tctttccgtt ctcctttgag gccggaggaa 120

cgggaagaac gacttgcctc tccctggtct ccttctttct cacgacccgt gtccattctt 180

tcgtcgggga agtggacagc ggagtcttcc gggtcagcga gcttccagct ccagcctccc 240

cggagacgat ctttttccga agagccggag gtagcgtctt tccagcattt tcggagtttg 300

ttggaggaga cttctgttcc ggcagatctg cgaggcggtg tagaattcct tcttcatccg 360

ctacggacga gattgtcccg aagcagaata cagatccggg acgcacggcg atcttgctgt 420

ggaaggtgac ggccattgag ctagcttgga tcgtcgacac accccctacc tggcgcgcca 480

gctgtcggtg ttttgggtcc gaccgcacac ccggggttgc ccctcaaagt gtttttagga 540

gtaggacggt gtcaacgact gtaacaaaat ggttcgtgcc gattgcacga gggacaatgg 600

acaagatttg caggttcggg ccgcttagaa gtgcgtaaca ccctacgtcc tggtgagtat 660

atgagcgtgg ttacaagagg gttctctgat agagggcgca gagagtttta cgtgggtggc 720

tatgtccaac agggtcgatc gttctgaagg ggtgccccct aggccttata tactcgaccg 780

tggggcagta catgtggata tgatagctac aagtagctga aagatagtaa acctctcgag 840

tttatcccta cgtaaccctt gccgacttat cctcgcatgg ctctgttgca tgggggcttc 900

agcgcgggaa agtcgggtct ctgttgcgat ttactcgctc gacgttgtgg gccgtctggg 960

tttgctccaa tctagtctta cgtcttctcc gcttcgttga ttgtctttcc ccaggcccac 1020

gaaagaacga ccttacgatt tattgggcct ttgggccttt cgtgaggtat tttatctctt 1080

tagtggaccc gggggatatc tatcccccac agctgcagca ttgttttgat gtaaaaaaag 1140

aggttagtat tacaggctcc ttccttgaac actaaatcct ataagtactt cgatgcccta 1200

tatgtcattc ctccaattgc agtcagtaca tagtttacct cctttattat aatatataaa 1260

tttaacaatg cattttatag cttctttctc cgatatttag aagctcaaaa aaagtgttca 1320

actgtgtagg aacagtgaga tcaatgattc aatgcctgca cctagatatg acatgtggtg 1380

attttgttga ctgtacttta aactcaagtt ttgaacaact cattaaactc aaattgtgaa 1440

caactcattg taacacataa ctgttgtctt ttctacaatg ttcactatta tcttgtgtat 1500

ggtttctatt atgctcctag aaccttcatt gcagcagtcg agtttttttt gcatgtgtat 1560

atatatgtcc gaacctcgtg gtgcaaaaaa acatgaaaaa tgttgaaaaa caggtattat 1620

gctggtaaag gcttatgtgg ttgcagacat gttcaactaa tatccttttt tcacatattt 1680

gccaatgatc tgattattgt ttttaaactt tctttaccat gaagattact aattgtatat 1740

tgttataatt taagtttagt tatatccctt cttcgtataa aagtatccta caataaaaaa 1800

ttgtgcgcgc tctggcgcgc gccaaccacc agtatatata taaagtgaag gggtaaatag 1860

cgttagtcag aaaaagacaa cattgtattg gtcacaacat tatataacat gttttgtaac 1920

gatagcgtta gtgcagaaaa aggtacgcat ctgaaacgga cgtgccagca aaaaccgcca 1980

cgtgctgaac cgcctgccgc accgcactag cgtccgcaac agcaggagac gtcctcgctt 2040

tccacctgca cagagcgcca gggccgtagc gtgccgatcg ctcgatccca ccaactgagg 2100

ccactgtcta gttgccgact ctcctcgcag gccgcaatct cgcagacacg caccgtcgcg 2160

gtatccgtat cgccagagtc ctcacggatg gcctcgccag cgatggtccc gctgcggcag 2220

ctcttcgtcg acggcgagtg gcgcccgccc gcgcagggcc gccgcctccc cgtcgtcaac 2280

cccaccaccg aggctcacat cggtgagtaa gctcccccga tcactgtcgc cttctattat 2340

tatactctac tagcttttta cttggcctgg cgctgatgcg ctgggtttcg cgtgcgcgcg 2400

caggcgagat ccctgcgggc acagcggagg acgtggacgc cgcggtggcg gcggcgcggg 2460

cggcgctcaa gaggaaccgt ggccgcgact gggcgcgcgc cccgggggcc gtccgggcca 2520

agtacctccg cgctatcgcc gccaaggtac gctggtcctc tttgctctag cctaattggg 2580

ccagaaacca ctcctgtgct gtgcctctgc ttccaatggt tggtacctac tagcccctaa 2640

gctagtaagt tattcagagt ggattgaatg tgtgacaact aagtaggggg tgtttgggag 2700

tgaagttttt tcaaagtttt agaagaatac tgcagtattc tcaaaaacta tagtattata 2760

taccaaaagg tgtttggcaa gccagctaaa atctctgttt tcaaaactaa agtattacaa 2820

atactgcagc tcttttgaag tattctaaac ttatgtttat acctcagttt tctctgtaaa 2880

acgcagcgcg cacatctctc ccacgtgcaa aaaaaatact ttgcttccaa acacctctat 2940

gtattcaata ctgtggtatt ctaaaactgt agtattttaa actgtggtat tgtcatgact 3000

aaaatatact gtagtatttt aaaaaccgtg gtttccaaaa actttgttcc caaacaggcc 3060

cgtacttgtg aaatatacgt tggtttccgt acactccatt actgtttctg cgttacatga 3120

gcagaggcac agaaagtaca aattaaactc ctccaattgt aaaccaatct attcagggga 3180

aatccttatg ttctgctttt ggtgtgaaca aactattgca cttcccatca atacagggtg 3240

tgttagcttt attatcaact ccaatttcaa aacacctcaa aagatctttc tctttaaact 3300

tcaattgaga aagtcttgta acatttggct gggccatcaa agttttgttc aaatatattc 3360

acatatgtca cattttgtgt ataagaatgt cttcttattc aggtgattga gaggaaacct 3420

gagctggcta agctagaggc acttgattgt gggaagcctt atgatgaagc agcatgggac 3480

atggtatgtg acaccttatg gaagtgcaat ttattttcac tagcttgcaa ttacaatctg 3540

tttggtattc catttatcag gatgatgttg ctgggtgctt tgagtacttt gcggatcagg 3600

cagaagcctt ggataaaagg caaaattccc cagtttctct tccaatggaa acttttaaat 3660

gtcatctccg aagagagcct attggggtag ttgggctgat aactccttgg tattttcatt 3720

tccccctcac ttagctgtta cttgtattta tgaccaaaac tcacaggcga gtgccttatt 3780

cagtaataca acttcatttc tcatagatct cagggttgta taaatgtata gcgaataaac 3840

tgcatattct ctaaccacac acagtctttt aaacctaatt tcgataactt tcctcatcac 3900

cattctgaaa tatttccagt attcagattt gtacttccta tccagtgttg aatctcacct 3960

atatatccaa gttaatgtca attttttttt gcttgtgtca atgtttggcc aatatcaagt 4020

attctttcta tgttgatatg acagtgagct ttgtcctagt ataagtgtac gcttcttttc 4080

tagaaactca ctattgtgtt actatctttg ttcacataat tgttgtgcgg gccatttcag 4140

actattatgt ctatatataa gatgctgttg actaagtaac ttatttactt atatttatgt 4200

tttcttcata tgttcttgtt ttacttattc tgattctgac tctaaagcat tatactttgt 4260

acttgtattt gtgttgcagg aactatcctc tactgatggc tacatggaag atagcccctg 4320

cattggctgc tggttgtaca gctgtgctga agccatctga actggcttct gtgtaagtat 4380

tagcatgtta tatcatgttc atgctacaag caacagcatt ttatgtgcct acgttttgaa 4440

ttaccaggac ttgcttagag cttgctgata tctgtaaaga agtcggtctc ccttctggtg 4500

tcttgaacat tgtgacagga ttaggtcctg atgctggcgc tcctttgtca gcacacccag 4560

atgttgacaa ggtaaactat tctgcatata atgacataat catgcatgag cactcctcat 4620

agcatgggtt ttctgtttat ttaggtcgct tttactggga gttttgaaac tggcaagaaa 4680

attatggcat cggcagctcc tatggtcaag gttcgtctgt gaattatgtt ttatttatag 4740

taatgtgctg tgccgtgttg ttttgctctc ttctagttga taaattatca gaaagtatga 4800

tttgagtgcc ctattttaag aggaaattct gttgcattcc ttaacattgc atttttcttg 4860

acagcctgtt acactggaac ttggtggaaa aagtcctata gtagtatttg atgatgttga 4920

cattgacaaa ggtacgttta tattctaagg attacaaaat tcctgaagtt cattggtatt 4980

tgtggattgt tgcaatttgc agagaattta actgatgaga atgctaaatg cctaaaccct 5040

tcaaagccct tcatcggttt ctgggatttt catagaaata ctcagctgag cctgatcagg 5100

ctactacaat aagaattatt ttggtttgaa aattgattgt taggatttgt aaaatacagt 5160

ccataaagtt gtggggaaaa cccacatgct tgctatagtt tggacttttg accacagcac 5220

cagacttttt attagctgca ttttgcacaa aatttagaga tgcagcatgc cagttgaata 5280

aaaagatgaa acagaaagta tttgatgcat tatgtatatg ttacatgatt tgatttcatc 5340

atagaccttg agaaatatag ggctgaactt cctgtttggg tggagagccc ctgtgttggt 5400

tccccttcaa taagggtgtt gttttctggt tggtgatgta aactgtgttt cttaatggat 5460

ccatccagaa ttcttatttg gaatgtgcga ggtctcaatt ctcgtgctcg tcaagattct 5520

gttagagaat tagctctgtc cgttaaggct gaggtggtat gtttgcagga aactaagatg 5580

caatctattg ctagtagcac cttaatttct gttttgggcg ctgaattttc tgaatatgtc 5640

ttcttgcctt cgattggagc cagtggagga attctggtgg cctggaaaaa tcatttgaga 5700

ttcacaggtg cgagcagaat tgataatcac agtgtctcca ttcagttcca taagcaagaa 5760

ggaggtacct ggtggttaac ctgtgtttat ggtccccaag gggatgatga gaagatctct 5820

tttctgcagg agctaagaaa tgtaagagag ggctgcaatg gtccttgggt tgttgctggg 5880

gacttcaact taatctacaa agcctctgac aagaacaaca acaatttcag cagagctatg 5940

atgggaaggt ttaggcgatt tatcaatgat ctcgacctta aagaaattcc tctccatggt 6000

cggcgtttta cttggtcaaa tcaacaaatg gagcccgttc tggtcagatt ggacagagtc 6060

ctttgctcag ttgactggga gtttcttttc cctgatgtgc tgctgcagag ttctgcttcc 6120

caagactctg atcattgccc attaattctg ggtcttcgag ataatatatc agggagtcga 6180

cgttttcatt ttgaggcttt ttggcctaaa ttggagggat ttcatgatac tgtacgcgat 6240

gcctgggact cagttggtac aacgaactgt cctttcctca ctctccacta taaactgaag 6300

aagacagcca ggaggttgca agcttggagt gataggcagg ttggtcacat tagatctcaa 6360

ctggctttgg caaaagaaat ttctcataag ctggaaattg ctcaggatga aagggtgttg 6420

actccggatg aattttggct gaaaggcaag cttaaaaaac attctttgct tttatcctcc 6480

ctgaagcgta ctatggctag gatgagatca aggattttgt ggctcaagga tggtgatgcc 6540

aacacgaaat tcttccacct gcatgccaaa caccgtaaga gaaagaattt tattgctacg 6600

ttggttgatg gggatgatat ccttactagc catagggaca aggctgcagc agtggatggt 6660

ttcttttcaa acttaattgg ttcatgctgg gacagagagc aagcagtgga tctggaggcc 6720

cttggccttt ctcagcatga tttggctgcg cttgaggctc cctgttcgga aagggaacta 6780

tgggatacca ttaagctttt accttctgat aaagcgccgg ggccggatgg atttactgga 6840

tgtttttata agtcctgctg gaccgttatc aaatctgata tcatggctgc tactcatgct 6900

gtctggaata ataactttgt taattttgac aagttgaatt ctgcttacat taccttgatc 6960

ccaaaaaaag agggggctga gcatgtgaag gattttaggc caataagcct tgtgcacagt 7020

ttcggcaagc tgattacaaa gattcttgcc aacaggctgg ctagcaagct taacaggctg 7080

atttctccaa atcagagtgc cttcatcaag gggcggttta ttcaagataa cttcatgctg 7140

gtgcagcaga cttccagatt ccttcatcgc cagaagaagg ccagtttgct tctcaaattg 7200

gacatcacca aggccttcga ttcggtctcg tggccttttc ttattgaggt attggcgcag 7260

cttgggtttg gacagctttg gagggatatt atctgtggtc tgttggcctc ttcatctact 7320

caggtcctcc ttaatggttt tttggggaga aggatttttc acagaagagg tcttcggcaa 7380

ggcgaccctc tttccccaat gctttttatc ttggtaatgg acattttggc cctgctattt 7440

actagggccg aggaagcagg tttattgcag cgcctgtcgg acagggttaa tctccaccgg 7500

atctctatgt atgctgatga tgttgtcata tttttgaggc cctcggctgc tgacatttcc 7560

actacattaa atatcttgga tttgtttgga aaggcgtctg ggctccgcaa caatgagcag 7620

aaatctaatg tttttcccat ccagtgccct acggatgacc ttgtgctggt ccagaattta 7680

ttgccttttg agaggtctga attcccttgc aaatatcttg gaattccact ctcccttcat 7740

aagctgacca gagaacagat tcaatctatc atagacaggg tggccgaccg tcttccgagt 7800

tggaaagctg atcttatgac tagagccggt aggaagatta tggttcagca tgtgctctcc 7860

agtatgatca tatatttggc tatggccatt gattttcctc aatgggcttt ggaggcaatt 7920

gataaaatta gaaagggttt tctttggaaa ggccgcaagg aagtcagagg agggcattgt 7980

ctggttgctt ggggaagggt gtgcagaccc ctccatttgg gagggctggg tatttctagt 8040

ttaaaggaac tttgctgggc ccttcgtatg agatggttat ggcttcataa aactgatcct 8100

ggaaaacctt gggctaatct ccctatccaa gttccaaaaa aggcagaagc tttcttctcc 8160

actgttttgg tctctaaggt tggaaatgga gcacacactc tgttttggac agataaatgg 8220

atcttggggc agaatgtgtg tagtctggcg cctaggttat tcgccatcat tcctaaaagg 8280

attgcaaata aaagaactgt gcttgaagct cttgccaaca gaaaatggat atctgatata 8340

aagggtgctc tgtctgtggg agttctagtg gattatctga atctttggga gcttctttca 8400

gaaatagtgt tgcagcctga agtggaggat aagcacattt ttagtattgc agcagatggt 8460

aaatactcgg ctaagtcggc ttatgagggc ctctttgctg ggtcaacgtc ctttggtctc 8520

tatcacctga tttggaaaac ctgggcacct ccaaagtgtc ggttctttct ttggctggtt 8580

gctaacaaaa gatgctggac cgctgacagg cttgcgaaga gaggcttaga tcatccagct 8640

aggtgcctct tttgtgacca ggaagctgaa actattgatc acatcctcgt ctcctgtgtg 8700

ttcacaagag tattctggtt ttctcttctt aaaccgtttg ggtttcagag actggctccc 8760

cagcctgggc attcttcttt tatggcttgg tgggagcaga tttctgggtt ggcttctggt 8820

atccgtggta aaggtcttaa ttctcttgtg gccttaggag cttggataac ctggaagcat 8880

cgtaatagtt gtgttttcga tggttgtact cctagtttag atctgtccat taatttagcc 8940

agggaggaga ggcagtcttg ggagatggct ggggctaagg gtctttcata ccttgctgcc 9000

ctaattcctg gagactaggg agttgtttag tttgatggat tttttcagtt tgctgtgttt 9060

ctggccccca tgaggaggcc ttgtaatttg tccagatctc tttgatctgg atttatctct 9120

tcttcttaat atattgaggc gcagttctcc tgcgttttcc aaaaaaaaat aagttttagt 9180

tcccagaaag ggaactttta caaattcact gaccaactta ctttagttat gctgatactt 9240

tgctcattgt ggaattatgg attatgctat acttccatca ttgatcattc cttctaaata 9300

taaaacagct gtcgagtgga ctctgtttgg gtgcttttgg accaatggtc agatttgcag 9360

cgcgacatct cgtcttctta tccatgtaag tttcatatgt cattgccagt agcagttggg 9420

atacttttca cacataatag ctgtcaacca taatatattt ccttgagtgg tgttgcttta 9480

gctttacccc gccgtgccgt taacttctga ttcgagaagg ctaccatttc aaaatcgctg 9540

tactgaatat atagcagtat actatgaggt ttacacctat attgaacaat atatgtgccc 9600

cattgcctaa ggttcacact cttcaatttg ttgtgaactg tgcactttgg tttggtgtat 9660

atttagaagt atatattctc aatgacttga ttgtttttac tccctctgat accaaatgca 9720

agtagtttag gacatagtcc tgatctccaa tgtgacactg tttgaccgac ttgaacaaaa 9780

aacaacctaa caattgggat tggaaggaat aggttaacaa tggctattta ctgctatata 9840

ttactctttc aaatcagatc tcaattatga atcagttatg ttatgtactt atgttattgt 9900

tgtcagtaac acagtaacca agttctgcct ccaatgaaac cgttgcagac aaaaattgct 9960

aaaaaattta atgagaggat ggttgcatgg gccaaaaata ttaaggtttc ggatccactt 10020

gaagagggtt gcaggcttgg gccagttgtt agtgaaggac aggtactaca tgtcaacttt 10080

gtctaaatgt aaattcacca tgccaatgct atgatttgta gcttctttct tatttgacaa 10140

tttggtactt ctgatatagt agctgtaaac tttgtctaaa tgtaaattca ccatgcgaat 10200

gctataattt gtagcttctt tctgatttga caatttggta cttctgattt agtagttgta 10260

cactcttgtt tttgctagtt tgtttctaca ggatgtagct tcctctgatt ttgagaggat 10320

ctgtgttcag atgcactgac caacaccacc tttagattta ctttgttata ttttagtatg 10380

tttttacagc aagagctatg gtatggatta atgtttatgg tcatactgga ttatgagaaa 10440

atgacaccct aatcaccacc atattggtaa ccatacacat agtttcagat taccttgttt 10500

catctatagt tgttcatagg agccttatat atatttttgt gttctcagta tgagaagatt 10560

aagaagttca tatcgaatgc caaaagccaa ggtgctacta ttctgactgg aggtgttaga 10620

cctgcggtaa ggcctgcatt tggatttaca aagatccaca tgctaaaagc atgctataga 10680

gagatagaac taatgtttca tgttttacag catcttgaga aggggttctt tattgaacca 10740

actattatta ctgatatcac cacatcaatg gaaatctgga gggaggaagt ctttggtcca 10800

gtcctgtgcg ttaaagaatt tagcactgaa gatgaagcca tcgaacttgc caacgataca 10860

cagtgagctg attcttttta gcgcagtttc gatgtctttt ttgcaggctt cacaggtcat 10920

gtgtagtcca tagcttatga atttatgcca gtatccttct tttgaatttt tgataggtat 10980

ggtttggctg gtgctgtaat ttctggtgat cgggagcgct gccagaggtt atctgaggta 11040

cgtataagtg aagaggtcca cagtatttgg ttggcaaatt gactgcatca gactgatact 11100

cagagtgcac ttttttttgt gtgtgtgtgt gtatgtgggg tggggggggg gataaggggt 11160

caccattata gctctgtgct tctgtccatg ctatcactcg tttgaagggt tcaatttggt 11220

acttttgata ccataccact caattcgatt ttcgtgttgc aacatggaat tcgtggtgca 11280

cttgctctca gaactggttt tgggtatttc tactacacat ctctaatgaa acttgcgcaa 11340

caggagattg acgctggatg catctgggta aactgctcgc aaccctgctt ctgccaagct 11400

ccctggggcg ggaacaagcg cagtgaattt ggacgtgagc ttggagaagg gtgggtaaca 11460

tggaacgaca acatttctaa cagatattgc tatgggatat gaatgacact ggctgtttat 11520

ctgtaggggc attgataact acctgagcgt caagcaagtc acggagtaca tctctgatga 11580

gccgtgggga tggtaccaat ccccctccaa gctgtaaact ggcaagacga aaatttgtct 11640

gtttcggtag aataaatata tctcgatgct atacagaacg aacccgtgta tcacattgaa 11700

tgacatggtg aaaaaggcac atctgcagga taaaggcgag agttgagttg aaaccaaaaa 11760

ttttggaact gtgccattat aagaggtgga ttttgtcaat gggccttgtc tagacttcat 11820

tatcagcaaa gacagatttg cccctatctt atctggacag aatcccggca cggggtccgt 11880

catgagccca agacaagagc acggccgttt attgtcggcg cacggccgtt tattgcggca 11940

tatttagcct gatgctaggt actataggta tggatagcct atcaaactga accgagcccg 12000

tccccgtcga acctgtttgt ggcccaacct tagttatgat atagtccatt atatataaat 12060

atgaccgact cgatctctca atttaaagct attttctagt tctaaggggc ccaacgaaga 12120

agattggaga gactataatt ttaggatatg ggacgggctt gaactggtac gatctaataa 12180

aggcatgacg tggtttagag tcggactgta tcactgtttt ttacacttcg aactggcatg 12240

gtataaccca aaactttttt gaattttctt tgtctgaact cgtttagctt gaagcatgat 12300

gtgctaggtc tggtttgact caattccaag cattagtcac attaacgaag aagattggag 12360

ggactataat tttctttgta ttcaaaaatg aatatcaaga aagttttagc ccctccattc 12420

ctgttttccc aaacatgtcc ataacatatt aagttacgta aaataaactc taacttaatt 12480

agaacacaac ttcaacaata tccagttggg attgaacaaa aagttgtcat gcttccgacc 12540

gtgtcagttg gttggccgcc aagccagtgc aaccgttacg ttccaaactt ccaactcaaa 12600

ggcgtcaatc tcgtggtcat gctctcgtgc aagtgcagca aagcacgggt caccggatcc 12660

tttccagctc tcggccgcgg gccgcccgct tgaaatagag cccaggccac ctgccgccgg 12720

tggcccgtgc actgcacccg ggagtaccgc tctacgcctc taccgcgccg gcgcgccttg 12780

ctccgcccta ggcaagcaac acgcacgccg gtcgctggcg tggcggcggc acttaaaa 12838

<210> 2

<211> 1518

<212> DNA

<213> Artificial Sequence

<400> 2

atggcctcgc cagcgatggt cccgctgcgg cagctcttcg tcgacggcga gtggcgcccg 60

cccgcgcagg gccgccgcct ccccgtcgtc aaccccacca ccgaggctca catcggcgag 120

atccctgcgg gcacagcgga ggacgtggac gccgcggtgg cggcggcgcg ggcggcgctc 180

aagaggaacc gtggccgcga ctgggcgcgc gccccggggg ccgtccgggc caagtacctc 240

cgcgctatcg ccgccaaggt gattgagagg aaacctgagc tggctaagct agaggcactt 300

gattgtggga agccttatga tgaagcagca tgggacatgg atgatgttgc tgggtgcttt 360

gagtactttg cggatcaggc agaagccttg gataaaaggc aaaattcccc agtttctctt 420

ccaatggaaa cttttaaatg tcatctccga agagagccta ttggggtagt tgggctgata 480

actccttgga actatcctct actgatggct acatggaaga tagcccctgc attggctgct 540

ggttgtacag ctgtgctgaa gccatctgaa ctggcttctg tgacttgctt agagcttgct 600

gatatctgta aagaagtcgg tctcccttct ggtgtcttga acattgtgac aggattaggt 660

cctgatgctg gcgctccttt gtcagcacac ccagatgttg acaaggtcgc ttttactggg 720

agttttgaaa ctggcaagaa aattatggca tcggcagctc ctatggtcaa gcctgttaca 780

ctggaacttg gtggaaaaag tcctatagta gtatttgatg atgttgacat tgacaaagct 840

gtcgagtgga ctctgtttgg gtgcttttgg accaatggtc agatttgcag cgcgacatct 900

cgtcttctta tccatacaaa aattgctaaa aaatttaatg agaggatggt tgcatgggcc 960

aaaaatatta aggtttcgga tccacttgaa gagggttgca ggcttgggcc agttgttagt 1020

gaaggacagt atgagaagat taagaagttc atatcgaatg ccaaaagcca aggtgctact 1080

attctgactg gaggtgttag acctgcgcat cttgagaagg ggttctttat tgaaccaact 1140

attattactg atatcaccac atcaatggaa atctggaggg aggaagtctt tggtccagtc 1200

ctgtgcgtta aagaatttag cactgaagat gaagccatcg aacttgccaa cgatacacag 1260

tatggtttgg ctggtgctgt aatttctggt gatcgggagc gctgccagag gttatctgag 1320

gagattgacg ctggatgcat ctgggtaaac tgctcgcaac cctgcttctg ccaagctccc 1380

tggggcggga acaagcgcag tgaatttgga cgtgagcttg gagaaggggg cattgataac 1440

tacctgagcg tcaagcaagt cacggagtac atctctgatg agccgtgggg atggtaccaa 1500

tccccctcca agctgtaa 1518

<210> 3

<211> 8827

<212> DNA

<213> Artificial Sequence

<400> 3

gagatggctg aataaaaaaa tatgttagtt cgtattgagt tcgagataga gtaatatgat 60

ggcaggaaat tgtactgtat aatatagaat cttgttatat ataatgaaat atttttttag 120

agtatagatg tagagtaata tgagtacgga tagcctaaca gttttacgta gggtgttgac 180

cgaccacctc tgaaaatgtt tcaaaatatc gcatgcaatt tatttgaagt gcattgttat 240

atattattat atactctctc tactcttttt attcaaaaat aaactagcgg acgacaatat 300

ttaagaataa agtatactat gtacctagct acagaatatc atcatactct ccaaccaagc 360

cttgttatat atagagagag tatactttgt agcttgctac ataatatcat atttagtagc 420

caggcgcatg aagccacctg aatatcaacc gcaccacctg aatatcatta gttttggctc 480

tataaagccg gatgttgcaa gcagcatggt tacaagttca atttaatttg tacattgcgg 540

aaactaatta aaatggagca ccaagcatca ccgattcttg gtccttcttc ggcacagtct 600

agctttccaa agggaagctt ccaatttgca tgccgataga gtcgcgtaaa acagctttag 660

ttccatccga tgtctgttta caaaggtgag aaattcaaac ataactgatt tcaattgaaa 720

agttgtcaac tataatgttg tatttcttta ccatatctac aactttagtt tttgtcattt 780

ctacacctga ggtcattaga aaattttata ttctaaattg agaaattcag atatatcttt 840

ttaaataaaa atttcaaaag aaaaatctgt cgactataaa gctgtatact agagatctac 900

aactttaatt tgtcatctct tcatccgaga tcattatttt ttttaatttc aatagtattt 960

taatcttaga ctatccgcag cggttccctc taaatttctc ccctatatca cttttttgcg 1020

tcacatcgtt aacatttcat cctctacatt attttctccc gcaacggttt tccctaaatt 1080

ccccccatac cccacttcaa tataaaatac cattttctat acctattcat catcatttat 1140

ctatttttct ctcaactaac aatactagcg agcacgaaaa tcaatgcaaa ggggctgaca 1200

cagtgatcct cttgatgtgg cgtgcgcgct tgtgcagcaa ggggcaaagg agagagtagc 1260

gttaagcgct gcggcctaag agtacactaa acatctacat ggatagagga gaggatggct 1320

gatggccggc gctccagcta gtcttattta ggacccgcaa atggcttggg atgcaaaaag 1380

gtcatcgatt aattataaag ttgtaaacct catagagatc tacaactttg atcattgtca 1440

tttttttgtt catccgagtt tattaggaca attcaacaga attgaatttt aaaatacaga 1500

cattttgaat agaactttgg ggaccataaa taaatgggtc gaaatgaaaa caagcacagc 1560

tgggatctta ctacaactat aatataaatc cgtcctcatc tgacttaggg tgtgtttggt 1620

ttgacttttg gctttggctt ttgcccccca aaagccaaaa gccaaccaaa gggctggatc 1680

taggaagcag ctttttctaa aagccgactt tctcgtagtg caaatctgaa agcacctctg 1740

aacctgcttt tagtggcttt tcggatggaa ctgtgaaaac atatatcgaa gaatttttaa 1800

cgacttttag tggtttccac caaatggttt ttagcttttt aacagcttac agcctacagc 1860

agctttttcc acagctcaca gcccacaaca acttttttca cagccacagc ccaaccaaac 1920

agactcttac tatcctgacc atggtttatc tgtgtagtat ttccgttaag cctgaatgga 1980

gtcgcggaca gcgtgccgat aaagcgttcc agttatatct gtatctgtat agcctacact 2040

acacagggcc gcagcttgcc gatccctagc gacgaagtcc actgccgagt tgccgactca 2100

ccgactcccc tcgcaagtcg caatctccac tctccagagt ccaaactcca ctcctcaccg 2160

atgatggcct cgcaagcgat ggtaccgctg cggcagctct ttgtcgacgg cgagtggcgc 2220

ccgcccgcgc agggccgccg cctccccgtc gtcaacccta ccactgaggc tcacatcggt 2280

gagtgaccgc cccccgatcg caatcatccc tgttttcttc tattatactt gttgcttggc 2340

ctggcgctga tgcgctaggt ctcgcgtgca cgcgcaggcg agatcccggc gggcacggcg 2400

gaggacgtgg acgccgcggt ggcggcggcg cgcgcggcgc tcaagaggaa ccgcggccgc 2460

gattgggcgc gcgcgccggg ggccgttcgg gccaagtacc tccgcgccat cgccgccaag 2520

gtacgctggt cctctttgct ctagctaatt taattgggtc aaaaacgact ccagtgctgt 2580

gcttctgctt ccaagcattg gtatctactc cctccgcccc aatataaatg tacatctcgc 2640

ttaggaatac taccataatt cggatgtgaa ttcagtgtga gacaactcag tcgcggcatc 2700

tattttttgt gctttgatgg gtatgattgg tgactggatc tgtacttggg gatgctagga 2760

gtgaacttct cagcaccttt gctatatgcg ttttccttac acttcaacac tgttactgtt 2820

ttacatgcac agaggcacag aaagtacaaa ttaagttcct tctattcagg agaagtcctt 2880

atgttccgct tttgttgtga acaagctatt gctttctgcc aatacagggt gttttgacct 2940

ctagtatcaa ctccaaattc aaaacacctt aaaagatctt tctctttaaa cttccatttg 3000

taaagtcttg taacatttgg ttgggtcatc aaagttttgt tgaaatatat ttacacatgt 3060

cacattttgc atgtaaaaat gtcttcttat tcaggtaatt gagaggaaac aagagctagc 3120

taagctagag gcacttgatt gcgggaagcc ttatgatgaa gctgcatggg acatggtatg 3180

tgacacacct tatggaagtg tgcaattttt tttccagttt gcaatgacaa tctgtctggt 3240

attccattta tcaggatgat gttgctgggt gctttgagta cttcgcagat caggcagaag 3300

ctttggacaa aagacaaaat tccccagttt ctcttccgat ggaaactttt aaatgccatc 3360

tccgaagaga gcctattggg gtagttgggc tgataactcc ttggtatttt catacctacc 3420

tcaccttgct gttattcgta tttatgatca aagctcacag gcaagcgacc tgtattcagt 3480

agtacagctt cgtttcctgt aagacctcag agttctatag caaaaaaatc tgcatattct 3540

ctaaccacac aattttctta aactattttt tgacaacttt cctcatcatc gtcctgaaat 3600

atttccagtg ttcatatttg tacttcctat ccagttttta atctcaccta tgatctatat 3660

atccaagtta atgtcaaatt atttgcttgt gtgaatgttt ggccaatgtc aatatgctat 3720

cttggcacaa cgttgtgctt tgtcccagta caactgttgc ttctgctcca taagctcact 3780

attctgctat tatccttttt cacgtatttg ttgggccggg gcatttcact ttattgtgtc 3840

tatatataaa atgttgttga ctaagtaact gatttatcta ttttttcata tgtttttgtt 3900

ttacttattc tgattctaaa gtattatgct ttgtacttgt atttgtattg caggaactat 3960

cctctcctga tggctacatg gaaggtagct cctgctctgg ctgctggttg tgcagctgtg 4020

ctaaagccat ctgaattggc ttctgtgtaa gtattagcat tctatattct catgctagaa 4080

gcaatggcat ttgaagtgcc taccttttga attcccagga cttgcttaga gcttgctgat 4140

atctgtaaag aagtcggtct tcctcccggt gtcttaaaca ttgtgacagg attaggtcct 4200

gatgctggtg ctcctttgtc agcacaccca gatgttgaca aggtaaactg ttctgcatat 4260

aatgacataa tcatgcatgt gcatgacaca tcaatgaaaa cattatttct catatcatgt 4320

gttttctgtg tttgtaggtc gcttttactg ggagttttga aactggtaag aagattatgg 4380

cggctgcagc tcctatggtt aaggtttgtc tgtgaattta tgttttattt caagtaatga 4440

actgtgcatt attcattttg ctctctttta gttgataaat tatcagaagt atgatttgga 4500

taccctacga ttaagaggaa attctattgc attctttaac attgcatttt tcttgacagc 4560

ctgttacact ggaacttggt ggaaaaagtc ctatagtagt atttgatgat gttgacattg 4620

acaaaggtac atgtatattc taaggcttac taaattccta aatttcattg atatttgtgg 4680

attgttgcaa attgcaaaga attgaactga tcacaatgct aaacgcctaa aactcctcaa 4740

agcccttctt ggtatctgag cttttcgtag aaatactcaa ctgagcaggc tactacaaca 4800

agaattgctt tggtattgaa aattgattgt taggatttgt aaaatacagt acataaaatt 4860

gcgggggaaa ctacatgctt gctatggttt tgaccagagt accagacttt gtgttggttg 4920

tctgcatctg acacaaaatt tggagatgca ttatgccagt tgaataaaaa gatgaaatcg 4980

aaagtatttt atgcattatg tacatgttat atgatttcat atttcatcat tgtttttgag 5040

aaatataggg ctgaacttct gtggagaaca taagctttag ttccaagaaa ggggatttta 5100

taaatttact gattctgact tgcttcagtt atgctgatac tttgctcaac atggaattgt 5160

ggattctgat atgcttccat cgttgatcct tctaaataac agctgttgag tggactctgt 5220

ttgggtgctt ttggaccaat ggtcagattt gcagcgcaac atctcgtctt cttgtccatg 5280

taagtgccac atgttattgc ttgtattgtc acttggaata cttctcacac ttaatagttg 5340

tcaaccatga tctatttctt ggagtggtgt cacttagctt gtccttgccc tgatgttaac 5400

ttctgataat cttctgcggg agtgatttta aaattgcctc acagaataaa tagcagcata 5460

tatgtgcttt acgcctgttt tgaataaata gctggtgtgt gtgttgtgtt tcctagtgtt 5520

gttttttcct tacctttgct accttaatga aatgacatgc aactcttgca ttgtttgaga 5580

aaaaaaaaca atatatgcgt tccattgctt aaggtctggg tttgaacttt gaactcttca 5640

atttgcgcac ttaaaaaaaa aagtcttcta tttgctgtga agtgtgtgct tccatctggt 5700

gcatatttag aaatataatc tcaatgactt gattgttttt tactcatctg atacgaaacc 5760

taagatgttt aggacattgc cacggtctcc aatgtaacac tttgacttta gttttgtaag 5820

ttatattatt taaaagggac acacctatat attttatgaa attatttttc atgatgaact 5880

agtaacattg gtcatgcttt actaatctat gcaacttgac atatattgat gagtcaagaa 5940

agaagtttga ccgacttgaa tcgaaaaatg acctacaatt gggaccaaaa ggagtaggtt 6000

aaccatggct atttatcagt ctatattact atttgtctct tccaaatcac atttcagtta 6060

tgaatcagtt atgcactatg ttattgttgt cagtaacata gtaatcaagt tttgccttca 6120

atgaaactgt tgcagacaaa aattgctaaa gaatttaatg agaagatggt tgcatgggcc 6180

aagaatatta aggtttctga tccgcttgaa gagggttgca gacttgggcc agttgttagt 6240

gaagggcagg tattacatgt taacttcatc taaatctaac gtcaccattg acaatgctat 6300

gatttttgtc tcctttctga tttgacagtt cggtacttcc tatttagttg ctatacactc 6360

ttgttctttc tagtttctac gggctacagg accaggatgt agctcccgcc gattttgaga 6420

ggatctattt tgatatgcac tgactgacac cacctttata ttactttgtt atattacagt 6480

atttttgtta cagaaagagc tatggtatag attaatgttt atggtcatat atataacaca 6540

agactgagaa agtggcaccc taatcgccac tatcttggca accatatact ccctccgttt 6600

ctttttatta gtcgctggat agtgcaattt tgcactgtcc agcgactaat aaaaagaaac 6660

ggagggagta catagtttca gattaccttg ttgctttata gttgttcacg agtcttattc 6720

atgtttttgc gttctcagta tgagaagatt aaaaagttca tattgaatgc caaaagcgaa 6780

ggtgctacta ttctgactgg aggtgttaga cctgcggtaa ggcctgcatt tggatttaca 6840

tggaccacat gttatagtga gacataacta atgttttata ttttacagca tcttgagaag 6900

gggttcttta ttgaaccaac aatcattact gatatcacca catcaatgga aatttggagg 6960

gaggaagtct tcggtccagt cctgtgtgtt aaagaattta gcactgaaga tgaagccatt 7020

gaactggcca atgatacaca gtgagctact tatttttagt acaacttcaa tgctcttttg 7080

caggctttgc atctcatgcg tagtcagtag cttaagaatt catgtcacta tcctttcttt 7140

tataggtatg gtttagctgg tgctgtaatt tctggtgatc gtgagcgctg ccagagatta 7200

tctgaggtat gtttagtgaa ggggttcaca gtatttggct cgtggtttga tgactgaatc 7260

agactgatac tcggagtctc tctctctctc tctctctctc ttgctctgtc catgttgcca 7320

cattgacttg ctctcagaac tgtttttggg tactcctact agacatctct aatgaaaact 7380

tgcgcaacag gagattgatg ctggaattat ctgggtaaac tgctcacagc cctgcttctg 7440

ccaggctccc tggggcggta acaagcgtag tggatttgga cgtgagcttg gagaagggtg 7500

ggtaacatgg aacgataaca ttttaagacg tctaacagct atatttggga tctgactgac 7560

actgcctgtt tacctgtagg ggcattgata actacctgag cgtcaagcaa gtcacggagt 7620

acatctctga tgagccgtgg ggatggtatc aatccccctc caagctgtaa actggcatga 7680

aaatttgttt gttccattag aataaatata tctcgatgct atacagaacg aactcgtgta 7740

tcaaatggag tatgacattg tgaaaaaggc acatcagcgg aacaaatgtc agagttgaca 7800

attccctcgt accactccct tgatccggtc agatagatgt ttgcttagtt ggaaaaagac 7860

tgatctacct gtcttctttc gtgctgatct tctttctcaa atcaattgaa atacaacaat 7920

aataatatag ccttttgttc taagcaagtt ggggtagact aaggatgaga ctcacaaaaa 7980

acaaggatat aaaaggaaaa aacaacaacg aaaaggtaaa agaaagtgct gatcttcttt 8040

ctcaaatcaa ttgacataca acaataataa tatagccttt tgttctaagc aagttagggt 8100

agactaagga tgagactcac aaaaaacaag gatataaaag gaaaaaacaa caacgaaaag 8160

gtaaaagaaa gacgataaat ttaagggtaa aaaaaggcaa agattatggt tcgggtattt 8220

tgattgctgg tatctatgtg cacctatctt tagctatttt cttagagatg tttcacacct 8280

taggcctgtt cgtttctgca ggaatgcacc aagaattatt cctgttgctc aaaacttata 8340

caaattagag aagcaatccg gctaggaaca gttccggtac tccattccgt atcaaccgaa 8400

cggaccctta agatatctct taaccgtctc gccctatgtc attttaggtt gatccctctc 8460

tctttttaca ttatcatctt gctctaaaac ccttacgcat tggtgcctga ggaggtctcc 8520

tttggacatg tctaaaccat cttaaaccga tgttgaatca atttctcctc aattggtacc 8580

accctgaccc tgtcttgaat atcatcgttt tagactatcc ctttttttgt gtgcccacaa 8640

aaccaatgta acatgcacat ctctgctaca ctcagttctt ggacatgtcg tcctttttgt 8700

cggccaacat tcagtaacat ataacattgc cgggcgaatc gttgccctat aaaacttacc 8760

tttaagcttt tgcggcaccc tcttgtcaca aaggacgcca gaaggatgat gttatttcaa 8820

ccaacaa 8827

<210> 4

<211> 1521

<212> DNA

<213> Artificial Sequence

<400> 4

atgatggcct cgcaagcgat ggtaccgctg cggcagctct ttgtcgacgg cgagtggcgc 60

ccgcccgcgc agggccgccg cctccccgtc gtcaacccta ccactgaggc tcacatcggc 120

gagatcccgg cgggcacggc ggaggacgtg gacgccgcgg tggcggcggc gcgcgcggcg 180

ctcaagagga accgcggccg cgattgggcg cgcgcgccgg gggccgttcg ggccaagtac 240

ctccgcgcca tcgccgccaa ggtaattgag aggaaacaag agctagctaa gctagaggca 300

cttgattgcg ggaagcctta tgatgaagct gcatgggaca tggatgatgt tgctgggtgc 360

tttgagtact tcgcagatca ggcagaagct ttggacaaaa gacaaaattc cccagtttct 420

cttccgatgg aaacttttaa atgccatctc cgaagagagc ctattggggt agttgggctg 480

ataactcctt ggaactatcc tctcctgatg gctacatgga aggtagctcc tgctctggct 540

gctggttgtg cagctgtgct aaagccatct gaattggctt ctgtgacttg cttagagctt 600

gctgatatct gtaaagaagt cggtcttcct cccggtgtct taaacattgt gacaggatta 660

ggtcctgatg ctggtgctcc tttgtcagca cacccagatg ttgacaaggt cgcttttact 720

gggagttttg aaactggtaa gaagattatg gcggctgcag ctcctatggt taagcctgtt 780

acactggaac ttggtggaaa aagtcctata gtagtatttg atgatgttga cattgacaaa 840

gctgttgagt ggactctgtt tgggtgcttt tggaccaatg gtcagatttg cagcgcaaca 900

tctcgtcttc ttgtccatac aaaaattgct aaagaattta atgagaagat ggttgcatgg 960

gccaagaata ttaaggtttc tgatccgctt gaagagggtt gcagacttgg gccagttgtt 1020

agtgaagggc agtatgagaa gattaaaaag ttcatattga atgccaaaag cgaaggtgct 1080

actattctga ctggaggtgt tagacctgcg catcttgaga aggggttctt tattgaacca 1140

acaatcatta ctgatatcac cacatcaatg gaaatttgga gggaggaagt cttcggtcca 1200

gtcctgtgtg ttaaagaatt tagcactgaa gatgaagcca ttgaactggc caatgataca 1260

cagtatggtt tagctggtgc tgtaatttct ggtgatcgtg agcgctgcca gagattatct 1320

gaggagattg atgctggaat tatctgggta aactgctcac agccctgctt ctgccaggct 1380

ccctggggcg gtaacaagcg tagtggattt ggacgtgagc ttggagaagg gggcattgat 1440

aactacctga gcgtcaagca agtcacggag tacatctctg atgagccgtg gggatggtat 1500

caatccccct ccaagctgta a 1521

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

tctccgaaga gagcctattg 20

<210> 6

<211> 28915

<212> DNA

<213> Artificial Sequence

<400> 6

taggtttacc cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac 60

gacaatctga tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc 120

gggacaagcc gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc 180

aagctggtac gattgtaata cgactcacta tagggcgaat tgagcgctgt ttaaacgctc 240

ttcaactgga agagcggtta cgctgtttaa acgctcttca actggaagag cggttactac 300

cggttcacta gctagctgct aatcgagcta gttaccctat ggtaccaggc gacccatcgc 360

tgctttgtct acatcatgtt cttcatcatc ctccccaggc gacgcgtgct gctgttctta 420

ttcagactac cgttcgagtg actgcatggc gtacatcttt ctgcatcgac tttgtacggc 480

tacatcgaac atatacacga gatgtctcgt gtgaatagag tcactaatgc cttaagcatc 540

ggttactccg tagggtacat tctgttcttc ttatttgtgc atatttttat tgttgtttac 600

tgattatacg agtagttata catacatgca catacatatc atcacatata tcacaatatt 660

tttctaaatt aaattaaaac taaaaatgac taaatttcta acaccaacga cattgtaatg 720

ttttctccaa caactttacc tattctacat tgttctattt cgaatttcac tctataaaca 780

acatagtcta caatggaaaa cagtgctttg tacgactata tacgcgatgt gtggctacaa 840

cataagacaa tatagtcgtt tgaagattga acctatatat cggtacggtt aatccgtcta 900

tgtacgtggg catgacgaac acccgtgata acgaaggatt aacgtgcaca atcataaatc 960

caaagtagga gcggtgcatg atgagaatcg ctctcagtac tcgacataat gaaccttacg 1020

aggtacaaca ggcaggcagg cagggaccag gggccgcctt tatttcaggc tcgctggccc 1080

cacgggcgtg ctgcgtgcac gaagggcact accccaacct ctcaccgaaa accgcgctgg 1140

atcggcaaat caaacgaggt ggtgccccgt gcccactctc cacgtccacg gcaccatccc 1200

tctgcagccg ctcaccagcc atgccgtgtc gcggaacggc acaaccaccc ccaacccact 1260

cacgaaaccc cgtcccggcc gtgcccgtgt cggtccgcgc tcggcaacga ggcggcccgc 1320

gctgctgagt cccctggaca cccgacaccc tgtcggccct ttgtttattc atcccgaaat 1380

ctcatctgcc cccacggccg actgcgctgc gccgcccgga tatatatacc catcgttatc 1440

gactggggac tctatcagtg atagagtcta gaggatcgct caggaaggcc gctgagatag 1500

aggcatggcg gccaatgcgg gcggcggtgg agcgggagga ggcagcggca gcggcagcgt 1560

ggctgcgccg gcggtgtgcc gccccagcgg ctcgcggtgg acgccgacgc cggagcagat 1620

caggatgctg aaggagctct actacggctg cggcatccgg tcgcccagct cggagcagat 1680

ccagcgcatc accgccatgc tgcggcagca cggcaagatc gagggcaaga acgtcttcta 1740

ctggttccag aaccacaagg cccgcgagcg ccagaagcgc cgcctcacca gcctcgacgt 1800

caacgtgccc gccgccggcg cggccgacgc caccaccagc caactcggcg tcctctcgct 1860

gtcgtcgccg ccgccttcag gcgcggcgcc tccctcgccc accctcggct tctacgccgc 1920

cggcaatggc ggcggatcgg ctgtgctgct ggacacgagt tccgactggg gcagcagcgg 1980

cgctgctatg gccaccgaga catgcttcct gcaggactac atgggcgtga cggacacggg 2040

cagctcgtcg cagtggccac gcttctcgtc gtcggacacg ataatggcgg cggccgcggc 2100

gcgggcggcg acgacgcggg cgcccgagac gctccctctc ttcccgacct gcggcgacga 2160

cggcggcagc ggtagcagca gctacttgcc gttctggggt gccgcgtcca caactgccgg 2220

cgccacttct tccgttgcga tccaacagca acaccagctg caggagcagt acagctttta 2280

cagcaacagc aacagcaccc agctggccgg caccggcaac caagacgtat cggcaacagc 2340

agcagcagcc gccgccctgg agctgagcct cagctcatgg tgctcccctt accctgctgc 2400

agggagtatg tgagagcaac gcgagctgcc actgctcttc actggtaccg ttaacagatc 2460

aattcgacaa agcagcatta gtccgttgat cggtggaaga ccactcgtca gtgttgagtt 2520

gaatgtttga tcaataaaat acggcaatgc tgtaagggtt gttttttatg ccattgataa 2580

tacactgtac tgttcagttg ttgaactcta tttcttagcc atgccaagtg cttttcttat 2640

tttgaataac attacagcaa aaagttgaaa gacaaaaaaa aaaacccccg aacagagtgc 2700

tttgggtccc aagcttcttt agactgtgtt cggcgttccc cctaaatttc tccccctata 2760

tctcactcac ttgtcacatc agcgttctct ttccccctat atctccacgc tctacagcag 2820

ttccacctat atcaaacctc tataccccac cacaacaata ttatatactt tcatcttcaa 2880

ctaactcatg taccttccaa tttttttcta ctaataatta tttacgtgca cagaaactta 2940

gcaaggagag agagagcggg gtgacccacc ttgctagttg gatattacct cttctcttca 3000

aagtatcctt gaacgctcac cggttatcaa atctctacac tatagctctg tagtcttgct 3060

agatagttag ttctttagct ctcggtgacc aagcttggcg cgatcaagct tatcgatacc 3120

gtcgacctcg aagcttggtc acccggtccg ggcctagaag gccagcttca agtttgtaca 3180

aaaaagcagg ctccggccag aatggcccgg accgggttac cgaattctta ccctagctcc 3240

ctgcggctgt tacgcggtcc cccatcaatc ttctgttctt gcggttgtag cctgtgtaac 3300

agtgctagag tatgtatgat aaataggttt taagtctgct tacatgacat tttttattgt 3360

ggaagagaca tataaaaatt agagagagtg gttctcatgc aacggcggac ggcccggtgc 3420

taaaagagct tcaagacaaa ataatgaaac aggaagagag tagatttatc taagagccaa 3480

ctttattata tgaatgtgtt tattgttggc tttagatgat atggtaagga gttagagcta 3540

ataatagata ggctctatta ttattattat taattaaact cgctctaagg aggaaagtgg 3600

gaggaaggga cgaggacgaa gactactgga agcatcgtgc atggatgatg gatgtggtgt 3660

ctcttaatgt aggtggccgg aggatgtacg tgttaattgc gcgataagca ctcagatcca 3720

accgcaaact acctccacac tgacacactg atagagagaa agagagacct ccgacgactg 3780

ccgccgcaga tgagccacgt acgtatacga cgtctgccgg ccggctcagg ctgccgccat 3840

caccctgctc gaaagtcgcg ttaggcggcg ccagctacat aggagtatct agtctagcca 3900

gttagtatac tactactgcg ctgatgatga attaactctg catagatact gtacttgcct 3960

ccctccaaca cccaaccacc tcctgctcgg ctcttaataa cttggacacg gatcgatgcc 4020

atccaaggaa gaacacgacg acgacgacgg aacatccacc atgcaagctt gcatccatac 4080

gccgatacgc gtgcatccat ccatccacca ttatttccat tttccaccga tcacacgtac 4140

acaggcctat ttaaggagcg acatcccact gcaactctcc tcaccactca tcaccagcta 4200

gctctagcaa agcacttgcc atctaccgac cgccgcattc caaacagccc gacgagctag 4260

cagagcggca ggcacctccc tcctcaagga acccatggcc actgtgaaca actggctcgc 4320

tttctccctc tccccgcagg agctgccgcc ctcccagacg acggactcca cactcatctc 4380

ggccgccacc gccgaccatg tctccggcga tgtctgcttc aacatccccc aagattggag 4440

catgagggga tcagagcttt cggcgctcgt cgcggagccg aagctggagg acttcctcgg 4500

cggcatctcc ttctccgagc agcatcacaa ggccaactgc aacatgatac ccagcactag 4560

cagcacagtt tgctacgcga gctcaggtgc tagcaccggc taccatcacc agctgtacca 4620

ccagcccacc agctcagcgc tccacttcgc ggactccgta atggtggctt cctcggccgg 4680

tgtccacgac ggcggtgcca tgctcagcgc ggccgccgct aacggtgtcg ctggcgctgc 4740

cagtgccaac ggcggcggca tcgggctgtc catgattaag aactggctgc ggagccaacc 4800

ggcgcccatg cagccgaggg tggcggcggc tgagggcgcg caggggctct ctttgtccat 4860

gaacatggcg gggacgaccc aaggcgctgc tggcatgcca cttctcgctg gagagcgcgc 4920

acgggcgccc gagagtgtat cgacgtcagc acagggtgga gccgtcgtcg tcacggcgcc 4980

gaaggaggat agcggtggca gcggtgttgc cggcgctcta gtagccgtga gcacggacac 5040

gggtggcagc ggcggcgcgt cggctgacaa cacggcaagg aagacggtgg acacgttcgg 5100

gcagcgcacg tcgatttacc gtggcgtgac aaggcataga tggactggga gatatgaggc 5160

acatctttgg gataacagtt gcagaaggga agggcaaact cgtaagggtc gtcaagtcta 5220

tttaggtggc tatgataaag aggagaaagc tgctagggct tatgatcttg ctgctctgaa 5280

gtactggggt gccacaacaa caacaaattt tccagtgagt aactacgaaa aggagctcga 5340

ggacatgaag cacatgacaa ggcaggagtt tgtagcgtct ctgagaagga agagcagtgg 5400

tttctccaga ggtgcatcca tttacagggg agtgactagg catcaccaac atggaagatg 5460

gcaagcacgg attggacgag ttgcagggaa caaggatctt tacttgggca ccttcagcac 5520

ccaggaggag gcagcggagg cgtacgacat cgcggcgatc aagttccgcg gcctcaacgc 5580

cgtcaccaac ttcgacatga gccgctacga cgtgaagagc atcctggaca gcagcgccct 5640

ccccatcggc agcgccgcca agcgcctcaa ggaggccgag gccgcagcgt ccgcgcagca 5700

ccaccacgcc ggcgtggtga gctacgacgt cggccgcatc gcctcgcagc tcggcgacgg 5760

cggagccctg gcggcggcgt acggcgcgca ctaccacggc gccgcctggc cgaccatcgc 5820

gttccagccg ggcgccgcca gcacaggcct gtaccacccg tacgcgcagc agccaatgcg 5880

cggcggcggg tggtgcaagc aggagcagga ccacgcggtg atcgcggccg cgcacagcct 5940

gcaggacctc caccacctga acctgggcgc ggccggcgcg cacgactttt tctcggcagg 6000

gcagcaggcc gccgccgctg cgatgcacgg cctgggtagc atcgacagtg cgtcgctcga 6060

gcacagcacc ggctccaact ccgtcgtcta caacggcggg gtcggcgaca gcaacggcgc 6120

cagcgccgtc ggcggcagtg gcggtggcta catgatgccg atgagcgctg ccggagcaac 6180

cactacatcg gcaatggtga gccacgagca ggtgcatgca cgggcctacg acgaagccaa 6240

gcaggctgct cagatggggt acgagagcta cctggtgaac gcggagaaca atggtggcgg 6300

aaggatgtct gcatggggga ctgtcgtgtc tgcagccgcg gcggcagcag caagcagcaa 6360

cgacaacatg gccgccgacg tcgggcatgg cggcgcgcag ctcttcagtg tctggaacga 6420

cacttaagcg tacctagtgg tacctgacat cttatagtct gcaacctctc gtgtctgaat 6480

tcctatcttt atcaagtgtt attgcttcca cgactatagg acagctttcg tcgaaaggtt 6540

ttgctcatgt gatctcgaag gattcatcta gtctgatttt tcgtgacttg tatcggtttt 6600

attggattca tccaacatat atcaataaaa aatgagttgt gtttcctttc ttcctagttc 6660

agttaaaatt atttccctcc tgcgcttgtg ctgtaattgt ctgtgtacct gttgtttgtg 6720

actgtgttag ttcccttgga tatgatttcg tatttgatat gtacatggag atagcttagc 6780

ttcattattg gagtatgaag ttagtatgac atagtcactc tcctggaaaa ttgacactgc 6840

aaaccatatt tttattctga accacaaatc ctagtcagtc cgctggcata tgccgtccgt 6900

ttgctgaatc cagaacgtgg gtttggagat gtacggctga gatgcctcta tgcgaagggg 6960

atttcgtggt gaaacgagat gggagtagag caacgcccgt ggaagatgct tcaaacttcc 7020

acacttttga gcaacgatcg gcagtagtaa ggtagacgat ttcaagatca aagcatatga 7080

agataaacaa catcaacaac aaaatttgtt ggggttctat agagagaaac agagctacat 7140

acatacactg ttttgtatct accatctgag atgatgaaaa gatgaaaaac taaagaatgc 7200

cccggcgcca acgccaggac acgccgcgcg cgcgtcaccc gagccatctc ttgacccagc 7260

cggcgctgta tatttacaca cgttgcagca tcgatcacca cctgttcgat cgcgtcgccg 7320

tcaccggtac cgaatgcggc cgccaccgcg gtggagctcg aattccggtc cgaagcttaa 7380

gccatggccc gggaatctta gcggccgcct gcagagttaa cggcgcgcca attggccctt 7440

acaaaatagc tagacgtgca ggtggctgga tgtgcgctcc ctgaatatca acttgtgtct 7500

cctccgattc agtccgcaga tgaaacttgg taataactgc agctgatccg tcgtcattca 7560

tgctatgcag gggattcgat cttcagcatg tgcagtgcag gcaacaacaa tctacgttgt 7620

ctgggcttgc gataggtaca cgaccacgag ggaaggcaac gcgtgatgta tgggccgcgc 7680

ctaagcatcc agcccacgcg ggcgtgcgcg tcgtcgctac ggcttgcggg ggaagggatc 7740

aagggacgaa ccgagaacta gtaccagacc ggccagcgag cattgcagac accggcttat 7800

aagttcagct gcgaccaccg ctccggatcc ttcagagcac cagtggtcta gtggtagaat 7860

agtaccctgc cacggtacag acccgggttc gattcccggc tggtgcatct ccgaagagag 7920

cctattggtt tcagagctat gctggaaaca gcatagcaag ttgaaataag gctagtccgt 7980

tatcaacttg aaaaagtggc accgagtcgg tgcttttttt tttttttttg ttataacaat 8040

ataacacata tttgtacata aattatcatg atattatatg ttaccgttgc aaagcacggg 8100

cactcaccta gtatataata taacatcagt cgtacgtaat gtactgatgg gcgggttaac 8160

aaatgtcact cactatcagc accagcagcg cttagatgca tccggccggg ccaagaccca 8220

ggaccagaaa gcgcgcacgt tcacagcgga tgctgatggg ttagatcgac tgatcgagga 8280

agaggagagc ttaattaaga aacgccctgt tccgctttgc tagcttgcgc cctgactgtc 8340

cagcccacgc gcttcggtcc gattcacatg ctaggctggt gcaagcgagc cgagactttt 8400

ttttagaacc accttgctca gcaaacctta ggaacaccgg cttataagtc gaagcgaagc 8460

gctgtgcact ttcagagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag 8520

acccgggttc gattcccggc tggtgcatgt gctaaagcca tctgaatgtt tcagagctat 8580

gctggaaaca gcatagcaag ttgaaataag gctagtccgt tatcaacttg aaaaagtggc 8640

accgagtcgg tgcttttttt tttttgaagc aacttaaagt tatcaggcat gcatggatct 8700

tggaggaatc agatgtgcag tcagggacca tagcacaaga caggcgtctt ctactggtgc 8760

taccagcaaa tgctggaagc cgggaacact gggtacgttg gaaaccacgt gatgtgaaga 8820

agtaagataa actgtaggag aaaagcattt cgtagtgggc catgaagcct ttcaggacat 8880

gtattgcagt atgggccggc ccattacgca attggacgac aacaaagact agtattagta 8940

ccacctcggc tatccacata gatcaaagct gatttaaaag agttgtgcag atgatccgtg 9000

gcttcagagc accagtggtc tagtggtaga atagtaccct gccacggtac agacccgggt 9060

tcgattcccg gctggtgcac gatgtgagcc tcagtggtag tttcagagct atgctggaaa 9120

cagcatagca agttgaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc 9180

ggtgcttttt tttttttaac ctcgcttgta tagttccttg tgctctaaca cacgatgatg 9240

ataagtcgta aaatagtggt gtccaaagaa tttccaggcc cagttgtaaa agctaaaatg 9300

ctattcgaat ttctactagc agtaagtcgt gtttagaaat tattttttta tatacctttt 9360

ttccttctat gtacagtagg acacagtgtc agcgccgcgt tgacggagaa tatttgcaaa 9420

aaagtaaaag agaaagtcat agcggcgtat gtgccaaaaa cttcgtcaca gagagggcca 9480

taagaaacat ggcccacggc ccaatacgaa gcaccgcgac gaagcccaaa cagcagtccg 9540

taggtggagc aaagcgctgg gtaatacgca aacgttttgt cccaccttga ctaatcacaa 9600

gagtggagcg taccttataa accgagccgc aagcaccgaa ttttcagagc accagtggtc 9660

tagtggtaga atagtaccct gccacggtac agacccgggt tcgattcccg gctggtgcat 9720

atggcggctg cagctcctag tttcagagct atgctggaaa cagcatagca agttgaaata 9780

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt tttttttaag 9840

cttctgcagt gcagcgtgac ccggtcgtgc ccctctctag agataatgag cattgcatgt 9900

ctaagttata aaaaattacc acatattttt tttgtcacac ttgtttgaag tgcagtttat 9960

ctatctttat acatatattt aaactttact ctacgaataa tataatctat agtactacaa 10020

taatatcagt gttttagaga atcatataaa tgaacagtta gacatggtct aaaggacaat 10080

tgagtatttt gacaacagga ctctacagtt ttatcttttt agtgtgcatg tgttctcctt 10140

tttttttgca aatagcttca cctatataat acttcatcca ttttattagt acatccattt 10200

agggtttagg gttaatggtt tttatagact aattttttta gtacatctat tttattctat 10260

tttagcctct aaattaagaa aactaaaact ctattttagt ttttttattt aataatttag 10320

atataaaata gaataaaata aagtgactaa aaattaaaca aatacccttt aagaaattaa 10380

aaaaactaag gaaacatttt tcttgtttcg agtagataat gccagcctgt taaacgccgt 10440

cgacgagtct aacggacacc aaccagcgaa ccagcagcgt cgcgtcgggc caagcgaagc 10500

agacggcacg gcatctctgt cgctgcctct ggacccctct cgagagttcc gctccaccgt 10560

tggacttgct ccgctgtcgg catccagaaa ttgcgtggcg gagcggcaga cgtgagccgg 10620

cacggcaggc ggcctcctcc tcctctcacg gcaccggcag ctacggggga ttcctttccc 10680

accgctcctt cgctttccct tcctcgcccg ccgtaataaa tagacacccc ctccacaccc 10740

tctttcccca acctcgtgtt gttcggagcg cacacacaca caaccagatc tcccccaaat 10800

ccacccgtcg gcacctccgc ttcaaggtac gccgctcgtc ctcccccccc ccccctctct 10860

accttctcta gatcggcgtt ccggtccatg gttagggccc ggtagttcta cttctgttca 10920

tgtttgtgtt agatccgtgt ttgtgttaga tccgtgctgc tagcgttcgt acacggatgc 10980

gacctgtacg tcagacacgt tctgattgct aacttgccag tgtttctctt tggggaatcc 11040

tgggatggct ctagccgttc cgcagacggg atcgatttca tgattttttt tgtttcgttg 11100

catagggttt ggtttgccct tttcctttat ttcaatatat gccgtgcact tgtttgtcgg 11160

gtcatctttt catgcttttt tttgtcttgg ttgtgatgat gtggtctggt tgggcggtcg 11220

ttctagatcg gagtagaatt ctgtttcaaa ctacctggtg gatttattaa ttttggatct 11280

gtatgtgtgt gccatacata ttcatagtta cgaattgaag atgatggatg gaaatatcga 11340

tctaggatag gtatacatgt tgatgcgggt tttactgatg catatacaga gatgcttttt 11400

gttcgcttgg ttgtgatgat gtggtgtggt tgggcggtcg ttcattcgtt ctagatcgga 11460

gtagaatact gtttcaaact acctggtgta tttattaatt ttggaactgt atgtgtgtgt 11520

catacatctt catagttacg agtttaagat ggatggaaat atcgatctag gataggtata 11580

catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca tctattcata 11640

tgctctaacc ttgagtacct atctattata ataaacaagt atgttttata attattttga 11700

tcttgatata cttggatgat ggcatatgca gcagctatat gtggattttt ttagccctgc 11760

cttcatacgc tatttatttg cttggtactg tttcttttgt cgatgctcac cctgttgttt 11820

ggtgttactt ctgcagtacg taagcatgga ctacaaggac cacgacgggg attacaaaga 11880

ccacgacata gactacaagg atgacgatga caaaatggca ccgaagaaaa aaaggaaggt 11940

cggcggctcc ccgaagaaaa aaaggaaggt cggcggctcc ccgaagaaaa aaaggaaggt 12000

cggcggctcc ccgaagaaaa aaaggaaggt cggaatccat ggcgttccag ctgccagcga 12060

gccgccacgg gcggagacat tcgtgttcct ggacctcgag gcaaccggcc tcccgaacat 12120

ggacccggag atcgccgaga tctctctgtt cgcggtccac aggtccagcc tcgagaatcc 12180

tgagcgggac gattccggct ccctggtgct cccacgggtc ctcgacaagc tgacactctg 12240

catgtgccca gagcgccctt tcacggccaa ggcgtccgag atcaccggcc tctcctccga 12300

gagcctcatg cattgcggca aggcgggctt caacggcgcg gtggtgcgca ccctccaggg 12360

cttcctctcc cggcaggagg gacctatctg cctggtggcc cacaatggct tcgactacga 12420

tttcccgctg ctctgcaccg agctccagcg cctcggcgcg catctcccac aggacaccgt 12480

ctgcctcgat acactgccgg cactgagggg cctcgaccgg gcccactctc atggcacgag 12540

ggcacaggga cgcaagagct actctctggc gtcactcttc cacaggtact tccaggccga 12600

gccatcagcc gcgcactcgg ccgagggcga tgtgcatacc ctcctgctca tcttcctgca 12660

cagggccccg gagctgctgg catgggccga cgagcaggca aggtcctggg cccatattga 12720

gcctatgtat gtgccgccgg atggcccgtc cctcgaggcc ggcggcggcg gcagcgaatt 12780

cgacaagaag tactccatcg gcctcgacat cggcaccaac agcgtcggct gggcggtgat 12840

caccgacgag tacaaggtcc cgtccaagaa gttcaaggtc ctgggcaaca ccgaccgcca 12900

ctccatcaag aagaacctca tcggcgccct cctcttcgac tccggcgaga cggcggaggc 12960

gacccgcctc aagcgcaccg cccgccgccg ctacacccgc cgcaagaacc gcatctgcta 13020

cctccaggag atcttctcca acgagatggc gaaggtcgac gactccttct tccaccgcct 13080

cgaggagtcc ttcctcgtgg aggaggacaa gaagcacgag cgccacccca tcttcggcaa 13140

catcgtcgac gaggtcgcct accacgagaa gtaccccact atctaccacc ttcgtaagaa 13200

gcttgttgac tctactgata aggctgatct tcgtctcatc taccttgctc tcgctcacat 13260

gatcaagttc cgtggtcact tccttatcga gggtgacctt aaccctgata actccgacgt 13320

ggacaagctc ttcatccagc tcgtccagac ctacaaccag ctcttcgagg agaaccctat 13380

caacgcttcc ggtgtcgacg ctaaggcgat cctttccgct aggctctcca agtccaggcg 13440

tctcgagaac ctcatcgccc agctccctgg tgagaagaag aacggtcttt tcggtaacct 13500

catcgctctc tccctcggtc tgacccctaa cttcaagtcc aacttcgacc tcgctgagga 13560

cgctaagctt cagctctcca aggataccta cgacgatgat ctcgacaacc tcctcgctca 13620

gattggagat cagtacgctg atctcttcct tgctgctaag aacctctccg atgctatcct 13680

cctttcggat atccttaggg ttaacactga gatcactaag gctcctcttt ctgcttccat 13740

gatcaagcgc tacgacgagc accaccagga cctcaccctc ctcaaggctc ttgttcgtca 13800

gcagctcccc gagaagtaca aggagatctt cttcgaccag tccaagaacg gctacgccgg 13860

ttacattgac ggtggagcta gccaggagga gttctacaag ttcatcaagc caatccttga 13920

gaagatggat ggtactgagg agcttctcgt taagcttaac cgtgaggacc tccttaggaa 13980

gcagaggact ttcgataacg gctctatccc tcaccagatc caccttggtg agcttcacgc 14040

catccttcgt aggcaggagg acttctaccc tttcctcaag gacaaccgtg agaagatcga 14100

gaagatcctt actttccgta ttccttacta cgttggtcct cttgctcgtg gtaactcccg 14160

tttcgcttgg atgactagga agtccgagga gactatcacc ccttggaact tcgaggaggt 14220

tgttgacaag ggtgcttccg cccagtcctt catcgagcgc atgaccaact tcgacaagaa 14280

cctccccaac gagaaggtcc tccccaagca ctccctcctc tacgagtact tcacggtcta 14340

caacgagctc accaaggtca agtacgtcac cgagggtatg cgcaagcctg ccttcctctc 14400

cggcgagcag aagaaggcta tcgttgacct cctcttcaag accaaccgca aggtcaccgt 14460

caagcagctc aaggaggact acttcaagaa gatcgagtgc ttcgactccg tcgagatcag 14520

cggcgttgag gaccgtttca acgcttctct cggtacctac cacgatctcc tcaagatcat 14580

caaggacaag gacttcctcg acaacgagga gaacgaggac atcctcgagg acatcgtcct 14640

cactcttact ctcttcgagg atagggagat gatcgaggag aggctcaaga cttacgctca 14700

tctcttcgat gacaaggtta tgaagcagct caagcgtcgc cgttacaccg gttggggtag 14760

gctctcccgc aagctcatca acggtatcag ggataagcag agcggcaaga ctatcctcga 14820

cttcctcaag tctgatggtt tcgctaacag gaacttcatg cagctcatcc acgatgactc 14880

tcttaccttc aaggaggata ttcagaaggc tcaggtgtcc ggtcagggcg actctctcca 14940

cgagcacatt gctaaccttg ctggttcccc tgctatcaag aagggcatcc ttcagactgt 15000

taaggttgtc gatgagcttg tcaaggttat gggtcgtcac aagcctgaga acatcgtcat 15060

cgagatggct cgtgagaacc agactaccca gaagggtcag aagaactcga gggagcgcat 15120

gaagaggatt gaggagggta tcaaggagct tggttctcag atccttaagg agcaccctgt 15180

cgagaacacc cagctccaga acgagaagct ctacctctac tacctccaga acggtaggga 15240

tatgtacgtt gaccaggagc tcgacatcaa caggctttct gactacgacg tcgaccacat 15300

tgttcctcag tctttcctta aggatgactc catcgacaac aaggtcctca cgaggtccga 15360

caagaacagg ggtaagtcgg acaacgtccc ttccgaggag gttgtcaaga agatgaagaa 15420

ctactggagg cagcttctca acgctaagct cattacccag aggaagttcg acaacctcac 15480

gaaggctgag aggggtggcc tttccgagct tgacaaggct ggtttcatca agaggcagct 15540

tgttgagacg aggcagatta ccaagcacgt tgctcagatc ctcgattcta ggatgaacac 15600

caagtacgac gagaacgaca agctcatccg cgaggtcaag gtgatcaccc tcaagtccaa 15660

gctcgtctcc gacttccgca aggacttcca gttctacaag gtccgcgaga tcaacaacta 15720

ccaccacgct cacgatgctt accttaacgc tgtcgttggt accgctctta tcaagaagta 15780

ccctaagctt gagtccgagt tcgtctacgg tgactacaag gtctacgacg ttcgtaagat 15840

gatcgccaag tccgagcagg agatcggcaa ggccaccgcc aagtacttct tctactccaa 15900

catcatgaac ttcttcaaga ccgagatcac cctcgccaac ggcgagatcc gcaagcgccc 15960

tcttatcgag acgaacggtg agactggtga gatcgtttgg gacaagggtc gcgacttcgc 16020

tactgttcgc aaggtccttt ctatgcctca ggttaacatc gtcaagaaga ccgaggtcca 16080

gaccggtggc ttctccaagg agtctatcct tccaaagaga aactcggaca agctcatcgc 16140

taggaagaag gattgggacc ctaagaagta cggtggtttc gactccccta ctgtcgccta 16200

ctccgtcctc gtggtcgcca aggtggagaa gggtaagtcg aagaagctca agtccgtcaa 16260

ggagctcctc ggcatcacca tcatggagcg ctcctccttc gagaagaacc cgatcgactt 16320

cctcgaggcc aagggctaca aggaggtcaa gaaggacctc atcatcaagc tccccaagta 16380

ctctcttttc gagctcgaga acggtcgtaa gaggatgctg gcttccgctg gtgagctcca 16440

gaagggtaac gagcttgctc ttccttccaa gtacgtgaac ttcctctacc tcgcctccca 16500

ctacgagaag ctcaagggtt cccctgagga taacgagcag aagcagctct tcgtggagca 16560

gcacaagcac tacctcgacg agatcatcga gcagatctcc gagttctcca agcgcgtcat 16620

cctcgctgac gctaacctcg acaaggtcct ctccgcctac aacaagcacc gcgacaagcc 16680

catccgcgag caggccgaga acatcatcca cctcttcacg ctcacgaacc tcggcgcccc 16740

tgctgctttc aagtacttcg acaccaccat cgacaggaag cgttacacgt ccaccaagga 16800

ggttctcgac gctactctca tccaccagtc catcaccggt ctttacgaga ctcgtatcga 16860

cctttcccag cttggtggtg atgacgatga caaaatggca ccgaagaaaa aaaggaaggt 16920

cggcggctcc ccgaagaaaa aaaggaaggt cggcggctcc ccgaagaaaa aaaggaaggt 16980

cggcggctcc ccgaagaaaa aaaggaaggt cggaatccat ggcgttccat agactagtct 17040

gaaatcacca gtctctctct acaaatctat ctctctctat aataatgtgt gagtagttcc 17100

cagataaggg aattagggtt cttatagggt ttcgctcatg tgttgagcat ataagaaacc 17160

cttagtatgt atttgtattt gtaaaatact tctatcaata aaatttctaa ttcctaaaac 17220

caaaatccag tggaagcttg tcgtgcccct ctctagagat aatgagcatt gcatgtctaa 17280

gttataaaaa attaccacat attttttttg tcacacttgt ttgaagtgca gtttatctat 17340

ctttatacat atatttaaac tttactctac gaataatata atctatagta ctacaataat 17400

atcagtgttt tagagaatca tataaatgaa cagttagaca tggtctaaag gacaattgag 17460

tattttgaca acaggactct acagttttat ctttttagtg tgcatgtgtt ctcctttttt 17520

tttgcaaata gcttcaccta tataatactt catccatttt attagtacat ccatttaggg 17580

tttagggtta atggttttta tagactaatt tttttagtac atctatttta ttctatttta 17640

gcctctaaat taagaaaact aaaactctat tttagttttt ttatttaata atttagatat 17700

aaaatagaat aaaataaagt gactaaaaat taaacaaata ccctttaaga aattaaaaaa 17760

actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa cgccgtcgac 17820

gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg tcgggccaag cgaagcagac 17880

ggcacggcat ctctgtcgct gcctctggac ccctctcgag agttccgctc caccgttgga 17940

cttgctccgc tgtcggcatc cagaaattgc gtggcggagc ggcagacgtg agccggcacg 18000

gcaggcggcc tcctcctcct ctcacggcac cggcagctac gggggattcc tttcccaccg 18060

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 18120

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 18180

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc tctctacctt 18240

ctctagatcg gcgttccggt ccatggttag ggcccggtag ttctacttct gttcatgttt 18300

gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg gatgcgacct 18360

gtacgtcaga cacgttctga ttgctaactt gccagtgttt ctctttgggg aatcctggga 18420

tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt cgttgcatag 18480

ggtttggttt gcccttttcc tttatttcaa tatatgccgt gcacttgttt gtcgggtcat 18540

cttttcatgc ttttttttgt cttggttgtg atgatgtggt ctggttgggc ggtcgttcta 18600

gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg gatctgtatg 18660

tgtgtgccat acatattcat agttacgaat tgaagatgat ggatggaaat atcgatctag 18720

gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc tttttgttcg 18780

cttggttgtg atgatgtggt gtggttgggc ggtcgttcat tcgttctaga tcggagtaga 18840

atactgtttc aaactacctg gtgtatttat taattttgga actgtatgtg tgtgtcatac 18900

atcttcatag ttacgagttt aagatggatg gaaatatcga tctaggatag gtatacatgt 18960

tgatgtgggt tttactgatg catatacatg atggcatatg cagcatctat tcatatgctc 19020

taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat tttgatcttg 19080

atatacttgg atgatggcat atgcagcagc tatatgtgga tttttttagc cctgccttca 19140

tacgctattt atttgcttgg tactgtttct tttgtcgatg ctcaccctgt tgtttggtgt 19200

tacttctgca ggtcgacatg cagaagctga tcaacagcgt gcagaactac gcctggggca 19260

gcaagaccgc cctgaccgag ctgtacggca tggagaaccc cagcagccag cccatggccg 19320

agctgtggat gggcgcccac cccaagagca gcagccgcgt gcagaacgcc gccggcgaca 19380

tcgtgagcct gcgcgacgtg atcgagagcg acaagagcac cctgctgggc gaggccgtgg 19440

ccaagcgctt cggcgagctg cccttcctgt tcaaggtgct gtgcgccgcc cagcccctga 19500

gcatccaggt gcaccccaac aagcacaaca gcgagatcgg cttcgccaag gagaacgccg 19560

ccggcatccc catggacgcc gccgagcgca actacaagga ccccaaccac aagcccgagc 19620

tggtgttcgc cctgaccccc ttcctggcca tgaacgcctt ccgcgagttc agcgagatcg 19680

tgagcctgct gcagcccgtg gccggcgccc accccgccat cgcccacttc ctgcagcagc 19740

ccgacgccga gcgcctgagc gagctgttcg ccagcctgct gaacatgcag ggcgaggaga 19800

agagccgcgc cctggccatc ctgaagagcg ccctggacag ccagcagggc gagccctggc 19860

agaccatccg cctgatcagc gagttctacc ccgaggacag cggcctgttc agccccctgc 19920

tgctgaacgt ggtgaagctg aaccccggcg aggccatgtt cctgttcgcc gagacccccc 19980

acgcctacct gcagggcgtg gccctggagg tgatggccaa cagcgacaac gtgctgcgcg 20040

ccggcctgac ccccaagtac atcgacatcc ccgagctggt ggccaacgtg aagttcgagg 20100

ccaagcccgc caaccagctg ctgacccagc ccgtgaagca gggcgccgag ctggacttcc 20160

ccatccccgt ggacgacttc gccttcagcc tgcacgacct gagcgacaag gagaccacca 20220

tcagccagca gagcgccgcc atcctgttct gcgtggaggg cgacgccacc ctgtggaagg 20280

gcagccagca gctgcagctg aagcccggcg agagcgcctt catcgccgcc aacgagagcc 20340

ccgtgaccgt gaagggccac ggccgcctgg cccgcgtgta caacaagctg tgataggagc 20400

tccgatcgtt caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt 20460

gcgatgatta tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa 20520

tgcatgacgt tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa 20580

tacgcgatag aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca 20640

tctatgttac tagatcggat cccctaggga gacccctgca gggagctcga attcattccg 20700

attaatcgtg gcctcttgct cttcaggatg aagagctatg tttaaacgtg caagcgctac 20760

tagacaattc agtacattaa aaacgtccgc aatgtgttat taagttgtct aagcgtcaat 20820

ttgtttacac cacaatatat cctgccacca gccagccaac agctccccga ccggcagctc 20880

ggcacaaaat caccactcga tacaggcagc ccatcagtcc gggacggcgt cagcgggaga 20940

gccgttgtaa ggcggcagac tttgctcatg ttaccgatgc tattcggaag aacggcaact 21000

aagctgccgg gtttgaaaca cggatgatct cgcggagggt agcatgttga ttgtaacgat 21060

gacagagcgt tgctgcctgt gatcaccgcg gtttcaaaat cggctccgtc gatactatgt 21120

tatacgccaa ctttgaaaac aactttgaaa aagctgtttt ctggtattta aggttttaga 21180

atgcaaggaa cagtgaattg gagttcgtct tgttataatt agcttcttgg ggtatcttta 21240

aatactgtag aaaagaggaa ggaaataata aatggctaaa atgagaatat caccggaatt 21300

gaaaaaactg atcgaaaaat accgctgcgt aaaagatacg gaaggaatgt ctcctgctaa 21360

ggtatataag ctggtgggag aaaatgaaaa cctatattta aaaatgacgg acagccggta 21420

taaagggacc acctatgatg tggaacggga aaaggacatg atgctatggc tggaaggaaa 21480

gctgcctgtt ccaaaggtcc tgcactttga acggcatgat ggctggagca atctgctcat 21540

gagtgaggcc gatggcgtcc tttgctcgga agagtatgaa gatgaacaaa gccctgaaaa 21600

gattatcgag ctgtatgcgg agtgcatcag gctctttcac tccatcgaca tatcggattg 21660

tccctatacg aatagcttag acagccgctt agccgaattg gattacttac tgaataacga 21720

tctggccgat gtggattgcg aaaactggga agaagacact ccatttaaag atccgcgcga 21780

gctgtatgat tttttaaaga cggaaaagcc cgaagaggaa cttgtctttt cccacggcga 21840

cctgggagac agcaacatct ttgtgaaaga tggcaaagta agtggcttta ttgatcttgg 21900

gagaagcggc agggcggaca agtggtatga cattgccttc tgcgtccggt cgatcaggga 21960

ggatatcggg gaagaacagt atgtcgagct attttttgac ttactgggga tcaagcctga 22020

ttgggagaaa ataaaatatt atattttact ggatgaattg ttttagtacc tagaatgcat 22080

gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 22140

caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 22200

accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 22260

ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt 22320

aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 22380

accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 22440

gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 22500

ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac 22560

gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 22620

gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 22680

ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 22740

aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 22800

gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc 22860

tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga 22920

agagcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac accgcatatg 22980

gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagtata cactccgcta 23040

tcgctacgtg actgggtcat ggctgcgccc cgacacccgc caacacccgc tgacgcgccc 23100

tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc 23160

tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgaggcaggg tgccttgatg 23220

tgggcgccgg cggtcgagtg gcgacggcgc ggcttgtccg cgccctggta gattgcctgg 23280

ccgtaggcca gccatttttg agcggccagc ggccgcgatc ctacaaggta gaatccgcct 23340

gagtcgcaag ggtgacttcg cctatattgg acgacggcgc gcagagggcg acctcttttt 23400

gggttacgat tgtaggatta tcactaaaac aatacatgaa catattcaaa tggcaatctc 23460

tctaaggcat tggaaataaa tacaaataac agttgggtgg agtttttcga cctgagggcg 23520

ttaaccttct gttaacctaa aagctcttgc ccaaacagca gaatcggcgc taattgccag 23580

cggcggaact tttccagttt cgcgaaaaat atcgccactg gcaaggaatg ggtttgagat 23640

ggcgaagtct gtcctaaaag cagcgcctgt agttgtaggg ttgacggcct tgatggagcg 23700

tcatgccgat gccctctcga gccaacttca agcacatcat cttaaggttt tcccgccgca 23760

ttccgagaag ggcattcgaa cattcgggcc atcggaggcg tccaagctgc tcggcgttgg 23820

cgagtcatat ttacggcaga ccgcgtctga gatgccagag ttgaatgtta gcatgagccc 23880

gggtggcagg cgaatgttct caattgaaga tatccatgtg attcggaagt atatggatca 23940

ggtcggccgc gggaaccggc gctacctgcc acatcgtcga ggcggcgagc agcttcaggt 24000

tatctctgtg atgaatttca aaggtgggtc gggtaagacc accaccgccg cgcatctggc 24060

gcagtacctc gctatgcgcg gatatcgagt cttggccatt gatctcgatc ctcaagcgag 24120

cctttctgca ctctttggga gccaaccgga gacggacgtt ggcccgaacg aaacgctcta 24180

cggcgctata aggtatgatg atgagcaggt ggcaatcgaa cgagtcgtcc gagggactta 24240

cattcccgac ctccacctga ttcctggtaa ccttgagctg atggagtttg aacacgatac 24300

gccacgcgcg ctgatgaacc gcaaagaggg cgacacgctc ttttatggtc gcatcagcca 24360

agtaattgaa gatatcgcgg ataactatga cgtcgtggtc atcgactgcc ctccccagct 24420

tgggtatctc acgctatccg cattgactgc ggcgacgtcc attcttgtca cggtccatcc 24480

gcagatgctg gatgtgatgt cgatgaacca gtttctggca atgacatcga accttttgcg 24540

tgaaatcgag aatgctggcg ccaagttcaa gtttaattgg atgcgctatc tgataacccg 24600

tttcgaaccg agcgacggac cacagaacca aatggtaggt tatctgcggt cgatttttgg 24660

cgaaaatgtc ctcaattttc cgatgcttaa aaccaccgcg gtttcggacg ctggcctgac 24720

aaaccagact ctattcgaag tggagcgtgg cctgttcacg cgctcgacct atgatcgagc 24780

cttggaggcg atgaacgccg tcaacgacga gatcgaaaca ctgatcaaaa aagcatgggg 24840

taggcccaca tgagccggaa gcacatcctt ggcgtctcaa ctgacgcccc tgagacgtcg 24900

cccgccgaca ataggacggc aaagaaccgc tccatgccgc tcctcggcgt aacaaggaag 24960

gagcgcgatc cggcaacgaa gctcacagcg aacattggta acgcactgcg agagcaaaac 25020

gatcgtctta gccgtgccga agagatcgag cggcgtctcg ctgaaggtca ggcagtgata 25080

gagttggatg cctcgtcaat agaaccgtct ttcgtgcagg atcgtatgcg aggggacatt 25140

gacgggctcc ttacttcgat ccgggaacaa ggacagcaag tcccaatcct tgtgcgaccg 25200

catccgagcc agccgggccg atatcaggtt gccttcggcc accgccggct acgcgccgtt 25260

tcagaactcg gacttccggt cagagcggtc gttcgcgaac tgacggacga gcaagtggtc 25320

gtagcacagg gtcaggaaaa caatgagcgc gaagatctta ccttcatcga aaaggcgcgc 25380

ttcgcacatc gcctgaacag gcagttttct cgagagattg tcatcgccgc gatgtcgatc 25440

gacaagagca atttgtccaa gatgcttctg ctcgtcgacg ccctcccctc tgaactgacc 25500

gatgctattg gtgccgctcc tggtgttgga cggccgagtt ggcaacaact tgccgagctg 25560

attgagaaag tttcttcacc ggccgacgtg gctaaatatg ctatgtcgga ggaagttcaa 25620

gcgctgccat cggcagaacg attcaaggcg gtgatcgcta gtctgaagcc cagtcgggtt 25680

gcgcgtggac ttcccgaggt catggccacc ccagacggca ccagaattgc acaggtgacg 25740

cagagcaagg ccaaactgga aatcacgatt gacaggaagg cgacgcccga ttttgcgacc 25800

ttcgtgctcg atcatgtgcc agcgctgtat caagcgtacc acgctgagaa ccaacggaaa 25860

cggggagagt aaaccgcaaa agaaaagagc cccctcaacg tcgccgtcgc ggaagccctt 25920

ctgtctctct agcgcgaaca gaatcgcatt tcctcgaatc ctcgtcaaga gtttttagcg 25980

ccgttttggt gagctgattt cctttgcctg ctgaaaggtg aaagatgatg cagacaggaa 26040

gtgtaacgac gccattcggg cggcggccaa tgacgcttgc gcttgtgcgg cgccagacgg 26100

cgctggccga tatcaaacaa ggcaagacag cggacaagtg gaaggtcttt agagacgcgt 26160

ccgcggccat ggaactactt ggaatccagt ccaacagtct tgccgtcctt gatgcgctat 26220

tgagctttca cccggaaacg gagttgcgtc aggaggcaca gctgatcgtc ttcccgtcga 26280

atgctcagct tgcccttcgg gcgcatggga tggctggcgc gactttgcgt aggcacatcg 26340

ccatgctcgt ggagtcaggc ttgatcgtcc ggaaggatag cgccaacgga aagcgttacg 26400

ctcgtaagga tggcgctggt cagatcgagc gcgcgtttgg cttcgatttg tctccgcttc 26460

tcgcgcggtc cgaagagcta gcgatgatgg cacagcaggt gatggccgat cgagcagcat 26520

tcaggatggc caaagaaagt ctgacgattt gccgacggga cgttcggaag ctaattacgg 26580

cagctatgga agagggagcg gagggcgact ggcaagctgt cgaggaagtc tatgtggaac 26640

ttgtgggtag aattccacgc gccccgacgc ttgctgatgt agagtcaatt ctcgaagaga 26700

tgtggatgct ccaggaagag ataatcaacc ggttggaaat tagagacaat tcagaaaata 26760

atagcaccaa tgctgcccag agcgagcagc acatacagaa ttcaaaaccc gaatccgtta 26820

atgaacttga acctcgctct gaaaaggagc agggcgctaa gccgagtgaa atagaccggg 26880

caaggagcga gccgataaaa gcgttccccc tcgggatgat cctgaaagca tgcccgacca 26940

ttggcaatta tgggccgagc ggtgcggttg ctagctggcg tgacctcatg tcggctgcgg 27000

tggtggttcg gtctatgctg ggggtcagcc cgtcggctta ccaagacgcg tgtgaggcaa 27060

tgggaccgga gaatgcggca gcagcgatgg cgtgcatttt ggagcgagcg aacttcatca 27120

attcgcccgg gggctatctc cgagatctga cacggcggag cgagctcggg aagttttcac 27180

ttggcccgat gataatggcg ctcttgaagg ctagcgggca ggggacgttg cggtttggct 27240

agaattagcg agtatggagc aggatggtct gtggtcagct gaccacagac ctaataggtt 27300

gaaaacatga gcgttttttg gatgatcgac agaccatccg attcccggag taccaagcgt 27360

gctctgatgg gagcgataac attactcaac aagcacgaag gccccatgcc gatcgttgat 27420

cgtgaaggag agcctgctct acatgcggcg gtattttgcc ggccgaggca tgtagtcgcg 27480

gagcactgcc tatttactgc cctaggcaca aacgttgact cttggatcga gctggcagac 27540

aaagcaataa cccacacaga ggacgattaa tggctgacga agagatccag aatccgccgg 27600

acggtactgc tgctgccgaa gttgagccgg ctgctcctag aggtagaaga gcaaagaaag 27660

caccagccga aacagcccgc acgggatcgt tcaaatccgt gaagccgaaa acccgcggcc 27720

tcagcaaccg agaaaaactg gagaagatcg gtcaaatcga agctcaggtc gctggcggcg 27780

caaccttgaa ggacgccgtt aagatcgtgg gtatttccgt tcagacctat tatcaatgga 27840

agagagctgc ggttcaacct gtctcacaga atccggccgt gtctgtttca gttgacgatg 27900

aactcggcga gttcatccaa ctcgaggagg aaaatcggcg gctcagaaag ctggccaggg 27960

cgtcggcctc ggtcaatgcg tcctcacgga aggcaccgcg ccgcctggcc tcggtgggcg 28020

tcacttcctc gctgcgctca agtgcgcggt acagggtcga gcgatgcacg ccaagcagtg 28080

cagccgcctc tttcacggtg cggccttcct ggtcgatcag ctcgcgggcg tgcgcgatct 28140

gtgccggggt gagggtaggg cgggggccaa acttcacgcc tcgggccttg gcggcctcgc 28200

gcccgctccg ggtgcggtcg atgattaggg aacgctcgaa ctcggcaatg ccggcgaaca 28260

cggtcaacac catgcggccg gccggcgtgg tggtgtcggc ccacggctct gccaggctac 28320

gcaggcccgc gccggcctcc tggatgcgct cggcaatgtc cagtaggtcg cgggtgctgc 28380

gggccaggcg gtctagcctg gtcactgtca caacgtcgcc agggcgtagg tggtcaagca 28440

tcctggccag ctccgggcgg tcgcgcctgg tgccggtgat cttctcggaa aacagcttgg 28500

tgcagccggc cgcgtgcagt tcggcccgtt ggttggtcaa gtcctggtcg tcggtgctga 28560

cgcgggcata gcccagcagg ccagcggcgg cgctcttgtt catggcgtaa tgtctccggt 28620

tctagtcgca agtattctac tttatgcgac taaaacacgc gacaagaaaa cgccaggaaa 28680

agggcagggc ggcagcctgt cgcgtaactt aggacttgtg cgacatgtcg ttttcagaag 28740

acggctgcac tgaacgtcag aagccgactg cactatagca gcggaggggt tggatcaaag 28800

tactttgatc ccgaggggaa ccctgtggtt ggcatgcaca tacaaatgga cgaacggata 28860

aaccttttca cgccctttta aatatccgat tattctaata aacgctcttt tctct 28915

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 7

tttaaatgtc atctccgaag agagcctttg gggtag 36

<210> 8

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 8

tttaaatgtc atctccgaag agagccttgg ggtag 35

<210> 9

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 9

atgccatctc cgaagagagc ctttggggta gttgggc 37

<210> 10

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 10

atgccatctc cgaagagagc ctaattgggg tagttgggc 39

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

tttaaatgtc atattggggt ag 22

<210> 12

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 12

tttaaatgtc atctccgaag agagcctagg tag 33

<210> 13

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 13

atgccatctc cgaattgggg tagttgggc 29

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 14

agctatgggg tagttgggc 19

<210> 15

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 15

tttaaatgtc atctccgaaa gagcctattg gggtag 36

<210> 16

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 16

tttaaatgtc atctccgaag agattggggt ag 32

<210> 17

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 17

atgccatctc cgaagagatt ggggtagttg ggc 33

<210> 18

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 18

atgccatctc cgaagagacc tttggggtag ttgggc 36

<210> 19

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 19

tttaaagcct tggggtag 18

<210> 20

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 20

tttaaatgtc atctccgaag gggtag 26

<210> 21

<211> 35

<212> DNA

<213> Artificial Sequence

<400> 21

atgccatctc cgaagagagc ctggggtagt tgggc 35

<210> 22

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 22

atgccatctc cgaagagagc ctatcttggg gtagttgggc 40

Claims (6)

1. The recombinant vector is applied to any one of the following M1) -M8):

m1) creationZmBADH2-1AndZmBADH2-2a double-gene knockout maize Jing 724 mutant;

m2) preparationZmBADH2-1AndZmBADH2-2the product of the corn Jing 724 mutant with double gene knockout;

m3) cultivating the scented corn;

m4) preparing a product for cultivating fragrant corn;

m5) improving the 2-AP content in the Jing 724 corn grains;

m6) preparing a product for improving the 2-AP content in the Jing 724 corn grains;

m7) improving the fragrance of the Jing 724 corn grains;

m8) preparing a product for improving the fragrance of the Jing 724 corn grains;

the nucleotide sequence of the recombinant vector is sequence 6; wherein, the 495 position 101-495 of the sequence 6 is a ZmU6 promoter sequence, the 578 position 502-578 is a tRNA sequence, the 579-598 position is a target sequence, the 599-684 position is an esgRNA framework sequence, the 685-975 position is an OsU3 terminator sequence, the 982-2695 position is an OsUbq3 promoter sequence, the 2912-7012 position is an SpCas9 encoding gene sequence, the 7169-7423 position is an Nos terminator sequence, the 7452-9423 position is a ZmUbi promoter sequence, the 9430-10608 position is a PMI screening agent resistance gene sequence, and the 10615-10868 position is an Nos terminator sequence;

the describedZmBADH2-1The gene is a genome DNA molecule shown in a sequence 1;

the describedZmBADH2-2The gene is a genome DNA molecule shown in a sequence 3;

the fragrant corns are corns with different fragrance gradients.

2. Creation systemZmBADH2-1AndZmBADH2-2a method for preparing a double knockout corn mutant, comprising the steps of: introducing the recombinant vector of claim 1 into a recipient of Zea mays Pijing 724 to obtainZmBADH2-1AndZmBADH2-2double knockout maize mutants.

3. A method for cultivating fragrant corn comprises the following steps: introducing the recombinant vector of claim 1 into a recipient, maize, Jing 724, to obtain a fragrant maize; the fragrant corns are corns with different fragrance gradients.

4. A method for increasing the 2-AP content in corn kernels comprises the following steps: the recombinant vector of claim 1 is introduced into a receptor corn Jing 724 to improve the 2-AP content in corn grains.

5. A method for improving the aroma of corn kernels comprises the following steps: the recombinant vector of claim 1 is introduced into acceptor corn Jing 724 to raise corn kernel fragrance.

6. A method of maize breeding comprising the steps of: obtained by the method of claim 2ZmBADH2-1AndZmBADH2-2the corn mutant with double knockout genes is used as parent material for breeding.

Images