CN111621513A - RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof - Google Patents
RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof Download PDFInfo
- Publication number
- CN111621513A CN111621513A CN201910145905.0A CN201910145905A CN111621513A CN 111621513 A CN111621513 A CN 111621513A CN 201910145905 A CN201910145905 A CN 201910145905A CN 111621513 A CN111621513 A CN 111621513A
- Authority
- CN
- China
- Prior art keywords
- plant
- expression vector
- promoter
- rice
- rnai
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/795—Porphyrin- or corrin-ring-containing peptides
- C07K14/80—Cytochromes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8278—Sulfonylurea
Abstract
The invention provides an RNAi plant expression vector for inhibiting cytochrome P450 by using a rice endogenous sequence and application thereof, a method for interfering the expression of a plant cytochrome P450 gene CYP81A6 and a method for obtaining a herbicide dominant sensitive plant. The RNAi plant expression vector is used for transforming rice, so that the expression of the gene CYP81A6 can be successfully inhibited, the rice is converted from herbicide resistance to sensitivity, sensitive plants can be eliminated in a herbicide application mode, and the rice which is dominant sensitive to the herbicide is cultivated. The rice has important application value in the aspects of cultivating new transgenic varieties, producing hybrid rice seeds, preventing transgene escape and the like.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to an RNAi plant expression vector for inhibiting cytochrome P450 by using a rice endogenous sequence and application thereof.
Background
The utilization of crop heterosis is one of the important means for increasing agricultural yield. Rice is one of the most important grain crops in the world and has obvious heterosis. China is the first country in the world to successfully realize commercial production of hybrid rice, the yield of the rice in China is improved by 20% by the hybrid rice, and the annual planting area of the hybrid rice in China exceeds 50% of the annual planting area of the rice. The three-line method and the two-line method are the main methods for producing seeds of hybrid rice at present, but the development of the hybrid rice industry is restricted due to the genotype limitation of three-line nuclear-cytoplasmic interaction and the instability of photo-thermo-sensitivity of two lines under special conditions. The SPT technology of the American Pioneer company successfully solves a series of problems in hybrid seed production by using a transgenic technology, and realizes commercial application in corn in 2012, and the hybrid seed production of rice is also very likely to realize updating by using a similar SPT technology. Meanwhile, the application of the transgenic technology in various crop fields is more and more extensive. However, the development of transgenic products since their birth has been considered to be very noisy. Therefore, the transgenic products need to be strictly controlled and supervised, and it is important to prevent the transgene from drifting and polluting other varieties and even other species. Therefore, there is a need to establish a mechanism that allows targeted elimination of hybrid seeds or transgenic plants. The cultivation of sterile lines sensitive to herbicides is one of the effective means for solving the problems.
Bentazon is a benzothiadiazole herbicide, belongs to a heterocyclic selective chemical herbicide, most broadleaf weeds and cyperaceae weeds are sensitive to bentazon, gramineae and leguminous plants including rice have strong drug resistance, and bentazon has the characteristics of broad spectrum, high efficiency and low toxicity. Therefore, bentazone is very effective in removing broadleaf weeds and sedge weeds in rice fields, and is very safe to rice (Zhang Collection (2010) progress on research on sensitive mutation of bentazone in rice. China Rice science 24: 551-. The resistance of rice to bentazon is controlled by a single recessive gene cytochrome P450(CYP81A6), which is located on No.3 chromosome of rice and participates in the hydroxylation detoxification process of bentazon in plants. The bentazon sensitive mutants of Norin 8M, M8077S, Jiazhe mB, GZ mlS, GZ M2S and the like are all caused by CYP81A6 gene mutation. The mutation of the CYP81A6 gene causes that the mutant can not degrade bentazon in vivo, thereby causing the death of plants when the bentazon herbicide is sprayed. Meanwhile, the cytochrome P450 is also an action target of sulfonylurea herbicides, contains CYP81A6 mutant genes or bentazon sensitive plants, and can also cause death when the sulfonylurea herbicides are sprayed.
Therefore, a technical means capable of effectively and dominantly influencing the expression of the rice cytochrome P450(CYP81A6) is developed, and an effective control scheme can be provided for the aspects of hybrid rice seed production, new transgenic variety cultivation, transgene escape prevention and the like. RNA interference technology (RNAi technology) can achieve the aim of dominant inhibition of gene expression. The RNAi typical structure is composed of a stem and a loop, specifically, two reverse complementary sequences form the stem and a spacer sequence between the two reverse complementary sequences forms the loop, the complementary stem structure is a target gene locus sequence, the loop sequence can be any sequence unrelated to the stem sequence theoretically, but in practical application, the interference efficiency difference of different stems and different loops is very large.
Disclosure of Invention
The invention aims to provide a plant expression vector capable of effectively influencing the expression of rice cytochrome P450(CYP81A6) and a construction method thereof:
in order to achieve the above object, the present invention provides an RNAi plant expression vector for inhibiting expression of cytochrome P450 gene, comprising a hairpin structure expression cassette, wherein the hairpin structure expression cassette comprises a hairpin structure formed by DNA fragments represented by SEQ ID Nos. 1-3.
Wherein, the DNA fragment shown in SEQ ID No.1 is a forward DNA fragment with the length of 211bp based on a CYP81A6 coding frame, and the DNA fragment shown in SEQ ID No.3 is a DNA fragment with the length of 211bp based on a CYP81A6 coding frame and is reversely complementary with the DNA fragment shown in SEQ ID No. 1. SEQ ID No.2 is an intron from the rice CYP81A6 gene.
The DNA fragments shown in SEQ ID Nos. 1 to 3 are arranged in order from the upstream to the downstream. The hairpin expression cassette can be transcribed in a transformed plant cell to form a hairpin-type secondary structure, the DNA fragment shown in SEQ ID No.2 forms a hairpin 'loop', and the DNA fragments shown in SEQ ID Nos. 1 and 3 are complemented to form a hairpin 'stem'.
Wherein the hairpin expression cassette further comprises a plant constitutive promoter or a plant tissue specific promoter upstream of the hairpin and a terminator downstream of the hairpin.
Wherein the plant constitutive promoter is a Ubi promoter, a CAMV 35S promoter or an Actin promoter of rice or corn; the plant tissue specific promoter is a Rubisco small subunit promoter or a Cab promoter. Preferably, when the promoter is a Ubi promoter of rice or maize, a very strong interference effect on the expression of the CYP81a6 gene can be obtained.
The terminator includes: DNA sequences capable of terminating gene transcription in plants, such as NOS terminator and Ubi terminator. Preferably, the terminator is a NOS terminator.
The RNAi plant expression vector also comprises a selective marker expression cassette, wherein the selective marker expression cassette contains a promoter, a marker gene and a terminator, the promoter is a Ubi promoter, a CAMV 35S promoter or an Actin promoter of rice or corn, and preferably, when the promoter is the CAMV 35S promoter, a good effect of driving the selective marker gene to be excessively expressed in plants can be achieved. The terminator is a NOS terminator or a Ubi terminator, preferably a NOS terminator.
The marker gene is a gene of an enzyme capable of producing a color change (e.g., a GUS gene, a luciferase gene, etc.), a fluorescent marker gene (e.g., a fluorescent protein gene), an antibiotic marker gene (an antibiotic marker for selection such as a hygromycin, gentamicin, a kanamycin gene), a herbicide selection marker gene (e.g., a glyphosate-resistant gene, a bispyribac-resistant gene, etc.), or a chemical agent resistance marker gene (e.g., an herbicide-resistant gene, etc.). Particularly preferably, the marker gene is the hygromycin gene.
In a preferred embodiment of the invention, the RNAi plant expression vector is obtained by connecting the DNA fragment shown in SEQ ID No.1-3 to AscI and BamHI sites of a plant binary transformation vector pCAMBIA1300-Ubi-Nos by overlapping method, thus obtaining the RNAi plant expression vector pC1300-UN-P450 i-8.
Particularly preferably, the RNAi plant expression vector has a nucleotide sequence shown as SEQ ID No. 4.
Wherein the plant is rice, preferably, the plant is a transgenic rice line.
It is noted that intermediate vectors for constructing RNAi plant expression vectors, RNAi expression vectors with selectable marker genes, engineering bacteria, cells containing P450i-8 stem-loop structures, callus tissues, transgenic seedlings, seeds and the like all belong to the protection scope of the invention.
In another aspect of the present invention, there is provided a method for constructing an RNAi plant expression vector, the method comprising: the DNA fragment shown in SEQ ID No.1-3 is connected between AscI and BamHI sites of a plant binary transformation vector pCAMBIA1300-Ubi-Nos by using overlapping method to obtain an RNAi plant expression vector pC1300-UN-P450 i-8.
Specifically, the method can be performed according to the following steps:
(1) designing 3 pairs of primers, respectively amplifying DNA fragments shown in SEQ ID No.1-3, wherein 5' ends of the two adjacent fragments, namely the upstream primer and the downstream primer, have about 15 nucleotide sequences which are repeated with corresponding connection positions of the fragments or the vector, so as to realize recombinant connection by utilizing Gibsonasseblank.
P450i-8-1F tgtttggtgttacttggcgcgccCGACGACATCAGAATGGGC
P450i-8-1R agcagaagatgaactcacggtaccTCGGCGGAGGACTCGTGC
P450i-8-2F gcacgagtcctccgccgaggtaccGTGAGTTCATCTTCTGCT
P450i-8-2R acgagtcctccgccgaactagtCTGCACGGCAAGAGGGTGGA
P450i-8-3F accctcttgccgtgcagactagtTCGGCGGAGGACTCGTGC
P450i-8-3R aggtcgactctagaggatccCGACGACATCAGAATGGGC
(2) Construction and transformation of RNAi plant expression vectors
The primers were used to amplify P450i-8 gene fragments 1 and 3 by PCR using the rice cDNA as a template. The amplification system and procedure were as follows:
the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 63 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
The procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 63 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
The P450i-8 gene fragment 2 was PCR amplified using the above primers using rice DNA as a template. The amplification system and procedure were as follows:
the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
PCR product fragments are obtained and are respectively named as P450i-8-1 (shown in SEQ ID No. 1), P450i-8-2 (shown in SEQ ID No. 2) and P450i-8-3 (shown in SEQ ID No. 3) after being recovered. The binary plant transformation vector pCAMBIA1300-Ubi-Nos is digested by AscI + BamHI, and target fragments P450i-8-1, P450i-8-2 and P450i-8-3 are directly connected into the digested pCAMBIA1300-Ubi-Nos plasmid, so as to obtain the vector pC1300-UN-P450 i-8.
The invention also provides application of the RNAi plant expression vector in preparation of herbicide dominant sensitive plants by interfering expression of plant cytochrome P450 gene CYP81A 6.
The RNAi plant expression vector of the present invention can be used to transform plant cells or tissues by conventional biological methods such as Agrobacterium-mediated genetic transformation, particle gun method, pollen tube channel method, etc.
Preferably, said use comprises introducing pC1300-UN-P450i-8 into Agrobacterium EHA105 strain and transforming callus. The callus can be anther-induced callus, mature embryo-induced callus, young embryo-induced callus, and young ear-induced callus.
In one aspect of the invention, the invention also provides a method for obtaining a herbicide dominant sensitive plant, which comprises the step of transforming a plant with the RNAi plant expression vector and interfering the expression of the plant cytochrome P450 gene CYP81A 6.
In one embodiment of the present invention, the method for obtaining a herbicide dominant sensitive plant comprises:
(1) constructing RNAi plant expression vector: connecting the DNA fragment shown in SEQ ID No.1-3 to AscI and BamHI sites of a plant binary transformation vector pCAMBIA1300-Ubi-Nos by using an overlapping method to obtain an RNAi plant expression vector pC1300-UN-P450 i-8;
(2) and (3) transformation: introducing pC1300-UN-P450i-8 into Agrobacterium EHA105 strain, transforming callus, and inducing and differentiating the transformed callus to obtain herbicide dominant sensitive plant.
Wherein, the RNAi plant expression vector pC1300-UN-P450i-8 has a nucleotide sequence shown in SEQ ID No. 4.
Wherein, the herbicide can be bentazone or sulfonylurea herbicide. The plant is rice, preferably, the plant is a transgenic rice line.
The invention provides application of the RNAi plant expression vector in cultivating new transgenic varieties, hybrid rice seed production or preventing transgene escape.
The invention constructs a plant binary transgenic vector aiming at rice cytochrome P450(CYP81A6) by screening based on RNAi technology, the vector can efficiently inhibit the cytochrome P450(CYP81A6) vector, the sequence of the vector is completely a rice endogenous sequence, and the risk and worry of the public to exogenous gene transgene can be effectively eliminated. The carrier is used for transforming the rice, the expression of the CYP81A6 gene is successfully inhibited, and the rice is converted from being resistant to bentazon or sulfonylurea herbicides into being sensitive, so that the rice which is dominant sensitive to bentazon or sulfonylurea herbicides is cultivated. So that the transgenic plants can be eliminated by means of applying herbicides. The rice has very important application value in the aspects of cultivating new transgenic varieties, producing hybrid rice seeds, preventing transgene escape and the like.
Drawings
FIG. 1 shows the electrophoresis diagram of the amplification of P450i-8-1, P450i-8-2 and P450 i-8-33 target fragments and the enzyme digestion recovery of pCAMBIA1300-Ubi-Nos backbone vector. Wherein; 1, P450i-8-1 target fragment; 2, P450i-8-2 destination fragment; 3, P450i-8-3 destination fragment; 4, carrying out double enzyme digestion on the pCAMBIA1300-Ubi-Nos skeleton vector by using AscI/BamHI.
FIG. 2 shows the electrophoresis of pC1300-UN-P450i-8 vector after double digestion with AscI and BamHI. In the figure, lanes 1 and 3 are respectively the uncleaved monoclonal recombinant plasmid, lanes 2 and 4 are respectively the digested monoclonal recombinant plasmid, M is D2000marker, the size of the excised fragment is 1167bp, and the excised fragment comprises the forward and reverse complementary sequences of the target fragment and the CYP81A6 gene intron sequence.
FIG. 3 is a PCR detection electrophoresis chart of hygromycin resistance gene of a part of transgenic lines; lane 1, H2O; lane 2-3 negative control (middle flower 11 non-transgenic plants); lane 4, positive control (pC1300-UN-P450i-8 plasmid); lanes 5-24, transgenic lines; m, Marker.
FIG. 4 shows the sensitivity test of pC1300-UN-P450i-8 transgenic T0 trilobate seedlings to 1g/L bentazon solution. White arrows indicate CK (ZH11 non-transgenic plants), and withered and dead plants are all sensitive lines. 0d is before spraying; 7d and 14d are recorded 7 days and 14 days after spraying.
FIG. 5 shows that the sensitivity of bentazon-sensitive P450i transgenic line T0 generation 3-5 leaf stage seedlings in comparative example 1 to bentazon solution with concentration of more than 10g/L is tested, wherein 1-2, 6-1, 9-1, 18-2 and 33-1 are independent P450i transgenic lines.
FIG. 6 is a graph showing a comparison of the sensitivity test phenotype of bentazon-sensitive P450i-7 transgenic line T0 generation 3-5 leaf stage seedlings in comparative example 2 to a 1g/L concentration bentazon solution at 7 d; and 0d is recorded before spraying.
Detailed Description
The present invention will be described in detail with reference to the following embodiments.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available.
EXAMPLE 1 Strain, plasmid acquisition and PCR primer Synthesis
(1) Strains and plasmids
The plant binary transformation vector pCAMBIA1300-Ubi-Nos serving as a framework vector contains a hygromycin resistance gene, a maize Ubi promoter and an NOS terminator. The E.coli (Escherichia coli) strain is DH5 alpha; the Agrobacterium tumefaciens (Agrobacterium tumefaciens) strain was EHA 105.
(2) PCR primer sequences
Designing 3 pairs of primers, respectively amplifying DNA fragments shown in SEQ ID No.1-3, wherein 5' ends of the two adjacent fragments, namely the upstream primer and the downstream primer, have about 15 nucleotide sequences which are repeated with corresponding connection positions of the fragments or the vector, so as to realize recombinant connection by utilizing Gibsonasseblank.
450i-8-1F tgtttggtgttacttggcgcgccCGACGACATCAGAATGGGC
P450i-8-1R agcagaagatgaactcacggtaccTCGGCGGAGGACTCGTGC
P450i-8-2F gcacgagtcctccgccgaggtaccGTGAGTTCATCTTCTGCT
P450i-8-2R acgagtcctccgccgaactagtCTGCACGGCAAGAGGGTGGA
P450i-8-3F accctcttgccgtgcagactagtTCGGCGGAGGACTCGTGC
P450i-8-3R aggtcgactctagaggatccCGACGACATCAGAATGGGC
Example 2 construction and transformation of RNAi plant expression vectors
In order to construct an interference vector for cytochrome P450 gene CYP81A6, PCR was performed using the primers of example 1 using rice cDNA as a template to amplify the P450i-8 gene fragment 1-3. The amplification system and procedure were as follows:
the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 63 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
The procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 63 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
The P450i-8 gene fragment 2 was PCR amplified using the above primers using rice DNA as a template. The amplification system and procedure were as follows:
the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.
After agarose gel electrophoresis, e.z.n.a was used.The PCR product fragments were recovered from the Extraction kit (Omega, the same applies hereinafter), and the sizes were 211bp, 726bp and 211bp, respectively, and they were designated as P450i-8-1, P450i-8-2 and P450i-8-3, respectively. The vector plasmid pCAMBIA1300-Ubi-Nos was digested with AscI + BamHI, subjected to agarose gel electrophoresis, and then subjected to double digestionUsing e.z.n.a.The Extraction kit (Omega, the same below) recovered a band of about 11kb in size to give pCAMBIA1300-Ubi-Nos linear fragment (FIG. 1).
The AscI + BamHI double enzyme digestion reaction system is as follows:
(2)2x lighting Cloning Kit connection KitThree fragments of P450i-8-1, P450i-8-2 and P450i-8-3 are connected to a pCAMBIA1300-Ubi-Nos vector, and the connection system is as follows:
and (3) connecting procedures: 30min at 50 ℃.
The ligation product is transformed into escherichia coli DH5 alpha competent cells, the recombinant plasmid is subjected to double enzyme digestion by AscI and BamHI, the size of a target fragment accords with the expectation (figure 2), and a recombinant is subjected to sequencing verification to be correct, namely, a P450i-8RNAi vector is constructed by taking a CYP81A6 gene intron as a ring, and the vector is named as pCAMBIA1300-Ubi-Nos-P450i-8 (hereinafter referred to as pC1300-UN-P450 i-8).
Example 3 Agrobacterium transformation of Rice and identification of transgenic plants
Introducing the pC1300-UN-P450i-8 recombinant plasmid into an agrobacterium EHA105 strain, transforming 11 calli of japonica rice midflowers, screening hygromycin resistance, differentiating and rooting to obtain 20 regenerated transgenic strains, identifying hygromycin resistance genes transferred into the transgenic strains through PCR (polymerase chain reaction), wherein the results show that 17 PCR positive strains and 3 weak positive strains can be considered as negative strains (figure 3), and transplanting the positive strains into soil to obtain 14 viable strains.
Example 4 acquisition of Rice Bendalong sensitive and resistant transgenic lines
In order to detect the effect of the designed interference vector segment in the transgenic plant, 48% bentazon mother liquor (Changzhou precision biotechnology limited) is used for preparing 1g/L bentazon solution, pC1300-UN-P450i-8 transgenic T0 generation trifoliate-stage seedlings obtained in example 3 are sprayed, and continuous observation is carried out after spraying.
After the spraying, the leaf tips of partial strains of the seedlings of the P450i-8 transgenic T0 generation are curled and withered and yellow 4 d; after 7d, 3 of 14 transgenic lines P450i-8 are subjected to irreversible death and belong to highly sensitive lines after spraying; before 2 strains, the leaves wither seriously but recover to grow gradually, and belong to moderate sensitive strains; the leaf tips of 4 strains are withered and yellow but grow normally, and the strains belong to low-degree sensitive strains; there were 5 strains that did not change significantly before and after spraying, and they were resistant strains (FIG. 4). It should be emphasized that although the example uses 1g/L of bentazon for spraying and screening bentazon-sensitive transgenic lines, the screening-sensitive lines are not limited to 1g/L, and 0.1g/L is the lowest concentration of bentazon of the screening-bentazon-sensitive transgenic lines applied in the present invention. The results show that the invention successfully obtains the transgenic material with dominant sensitivity to the herbicide.
Example 5 susceptibility testing of sensitive lines to bentazon at various growth stages
In order to detect the sensitivity of the dominant sensitive strain obtained by the invention to bentazon in different growth periods, the critical concentration test of bentazon is carried out in different growth periods.
Wild type ZH11 as control, spraying bentazon solution 0.005-0.2g/m at seedling stage (before five-leaf stage) of transgenic sensitive line2After spraying, the sensitive strain is continuously observed, and after 10-15 days, the sensitive strain dies irreversibly, but the wild type grows normally.
Using wild type ZH11 as control, spraying bentazon solution 0.2-0.5g/m at the early tillering stage (2-4 weeks after transplanting) of transgenic sensitive line2After spraying, the sensitive strain is continuously observed, and after 10-15 days, the sensitive strain dies irreversibly, but the wild type grows normally.
Taking wild type ZH11 as control, spraying 0.6-1.2g/m Bendalong solution from maximum tillering stage to heading stage (about 6-10 weeks after transplanting)2After spraying, the sensitive strain is continuously observed, and after 10-15 days, the sensitive strain dies irreversibly, but the wild type grows normally.
Using wild type ZH11 as control, spraying bentazon solution 1.2-1.5g/m at 7d after the transgenic sensitive strain blooms2After spraying, the sensitive strain is continuously observed, and after 10-15 days, the sensitive strain dies irreversibly, but the wild type grows normally.
Example 6 sensitivity test of sensitive lines to sulfonylurea herbicides at various growth stages
In order to detect the sensitivity of the dominant sensitive strain to the sulfonylurea herbicide in different growth periods, the invention tests the critical concentration of the sulfonylurea herbicide such as bensulfuron-methyl in different growth periods.
Wild type ZH11 as control, spraying bensulfuron-methyl solution 0.5-5mg/m during seedling stage (before five-leaf stage) of transgenic sensitive line2And continuously observing after spraying, wherein after 5-10 days, the growth of the sensitive strain is stopped, but the wild type grows normally.
Using wild type ZH11 as control, spraying sulfobensulfuron-methyl solution 5-12mg/m at the early tillering stage (2-4 weeks after transplanting) of transgenic sensitive line2And continuously observing after spraying, wherein after 5-10 days, the growth of the sensitive strain is stopped, but the wild type grows normally.
Using wild type ZH11 as control, spraying bensulfuron methyl solution 20-40mg/m from the maximum tillering stage to heading stage (about 6-10 weeks after transplanting)2And continuously observing after spraying, wherein after 5-10 days, the growth of the sensitive strain is stopped, but the wild type grows normally.
Using wild type ZH11 as control, spraying bensulfuron-methyl solution 40-60mg/m 7d after the transgenic sensitive strain blooms2And continuously observing after spraying, wherein after 5-10 days, the growth of the sensitive strain is stopped, but the wild type grows normally.
In combination with examples 5 and 6, the present invention provides the killing concentration of P450RNAi transgenic rice at each growth phase.
Comparative example 1
The hairpin structure was constructed and the bentazon-sensitive transgenic line was prepared using Zhonghua 11 according to the method previously reported by Lin et al (Lin C, Fang J, Xu X, ZHao T, Cheng J, Tu J, Ye G, Shen Z (2008) A build-in strain for relationship of transgenic plants: metabolic of plos One 3: e 1818).
Transgenic lines sensitive to bentazon are sprayed with bentazon with the concentration of 0.5g/L and 1g/L respectively, and as a result, no transgenic line is killed. When the bentazon with the concentration of more than 10g/L is sprayed on the transgenic plant line, the phenotype exists (figure 5), and the phenotype rate of the bentazon sensitivity is low, which indicates that the interference efficiency of the P450i designed according to the method on the endogenous gene is low.
Comparative example 2
Meanwhile, a 258bp fragment (SEQ ID NO.5) from the downstream of the initiation codon ATG of the rice CYP81A6 gene from +667 to +924 and a reverse complementary fragment (SEQ ID NO.7) of the fragment are used as RNAi interference stems, and an intron partial sequence (122bp) (SEQ ID NO.6) of the CYP81A6 gene is used as RNAi interference loops to construct another RNA interference vector of P450, which is abbreviated as P450i-7 (the nucleotide sequence is shown as SEQ ID NO. 8).
Through three transformation experiments, 0.25g/L and 1g/L bentazon are sprayed on the obtained vector transgenic plant line, and the result shows that none of the transgenic plant lines is killed (figure 6), and the phenotype appears after 10 days when the bentazon with the concentration of more than 2g/L is sprayed, but the proportion of the high-sensitivity plant lines is not high (see table 1).
TABLE 1P 450i-7 transgenic seedlings bentazon sensitivity test results
In conclusion, a series of experiments show that different stem-loop structures have obvious influence on RNAi interference efficiency, any sequence is not used as an RNAi interference stem loop, the constructed P450RNAi interference vector can successfully inhibit the expression of the gene CYP81A6, and rice is converted from herbicide resistance to sensitivity, the high-efficiency rice CYP81A6 interference vector (the nucleotide sequence shown in SEQ ID No. 4) obtained by screening the application has the functions, and the interference vector formed by the sequence of the CYP81A6 does not introduce an exogenous sequence, so that the risk and public worry caused by exogenous gene transfer are reduced, and the high-efficiency rice CYP81A6 interference vector can be used for cultivating new transgenic varieties and hybrid rice seed production, prevents transgene from escaping, and has excellent application value.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Hainan Borax Rice Gene science and technology Co., Ltd
<120> RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof
<130>KHP191110807.8
<160>14
<170>SIPOSequenceListing 1.0
<210>1
<211>211
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgacgacatc agaatgggcg atgtcgctac tgctgaacca ccccgacaca ctcaagaaag60
cgcaagccga gatcgacgca tccgtcggca actctcgcct gatcaccgcc gacgacgtga 120
ctcgcctcgg ctacctccag tgcatcgtca gggagacgct ccgcctgtac cccgccgcgc 180
cgatgctcct cccgcacgag tcctccgccg a 211
<210>2
<211>726
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gtgagttcat cttctgctgt tttacctttc tgatatctga attctctcat tggtgcgtaa 60
tttttttttt ttggctgtca tcggtatagc tttcttaagc actcagtagc cttgcaatta 120
taaaaagaaa aacaatcagt agctttttac atgctttgag tcagtcagta gcagtgtggc 180
actatcagca ttcagcagta ttcatgttgt ttgctaatca ctatcatggt ttgagtcagc 240
acaatcagta gcttttgaca tggtttgagt cagcagtatc ttttctagga actgaattag 300
ttattcattt agtacaactt gtttgtctgt ctattgattg ctttaaatta tttcttctat 360
gcaaccctct aatcctagta tagtactagc cttttatatg aagaatcatc aataattttc 420
ttctcacttt cagtgtagct ttacttaatg aatattttga aagatcgcct agttgcctta 480
ttataattgt ataaaaggaa aacaatcagt agccttttac atggttgagt cagcgagtta 540
tcaggagtac tattgtttat catggtagta gcacgataga ctattcaacc cgggcgatta 600
aaatccttct cccaaatttg tattctttgt tttttcctca aaaattcacc aaactcttgg 660
aactattata gttcagtttt agacaaaaaa aaaatgaaat cttagttcca ccctcttgcc 720
gtgcag 726
<210>3
<211>211
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tcggcggagg actcgtgcgg gaggagcatc ggcgcggcgg ggtacaggcg gagcgtctcc 60
ctgacgatgc actggaggta gccgaggcga gtcacgtcgt cggcggtgat caggcgagag 120
ttgccgacgg atgcgtcgat ctcggcttgc gctttcttga gtgtgtcggg gtggttcagc 180
agtagcgaca tcgcccattc tgatgtcgtc g 211
<210>4
<211>12330
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
aattcgagct cgtgcagcgt gacccggtcg tgcccctctc tagagataat gagcattgca 60
tgtctaagtt ataaaaaatt accacatatt ttttttgtca cacttgtttg aagtgcagtt 120
tatctatctt tatacatata tttaaacttt actctacgaa taatataatc tatagtacta 180
caataatatc agtgttttag agaatcatat aaatgaacag ttagacatgg tctaaaggac 240
aattgagtat tttgacaaca ggactctaca gttttatctt tttagtgtgc atgtgttctc 300
cttttttttt gcaaatagct tcacctatat aatacttcat ccattttatt agtacatcca 360
tttagggttt agggttaatg gtttttatag actaattttt ttagtacatc tattttattc 420
tattttagcc tctaaattaa gaaaactaaa actctatttt agttttttta tttaataatt 480
tagatataaa atagaataaa ataaagtgac taaaaattaa acaaataccc tttaagaaat 540
taaaaaaact aaggaaacat ttttcttgtt tcgagtagat aatgccagcc tgttaaacgc 600
cgtcgacgag tctaacggac accaaccagc gaaccagcag cgtcgcgtcg ggccaagcga 660
agcagacggc acggcatctc tgtcgctgcc tctggacccc tctcgagagt tccgctccac 720
cgttggactt gctccgctgt cggcatccag aaattgcgtg gcggagcggc agacgtgagc 780
cggcacggca ggcggcctcc tcctcctctc acggcaccgg cagctacggg ggattccttt 840
cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca 900
ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca 960
aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc cccccccctc 1020
tctaccttct ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt 1080
tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga 1140
tgcgacctgt acgtcagaca cgttctgatt gctaacttgc cagtgtttct ctttggggaa 1200
tcctgggatg gctctagccg ttccgcagac gggatcgatt tcatgatttt ttttgtttcg 1260
ttgcataggg tttggtttgc ccttttcctt tatttcaata tatgccgtgc acttgtttgt 1320
cgggtcatct tttcatgctt ttttttgtct tggttgtgat gatgtggtct ggttgggcgg 1380
tcgttctaga tcggagtaga attctgtttc aaactacctg gtggatttat taattttgga 1440
tctgtatgtg tgtgccatac atattcatag ttacgaattg aagatgatgg atggaaatat 1500
cgatctagga taggtataca tgttgatgcg ggttttactg atgcatatac agagatgctt 1560
tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg tcgttcattc gttctagatc 1620
ggagtagaat actgtttcaa actacctggt gtatttatta attttggaac tgtatgtgtg 1680
tgtcatacat cttcatagtt acgagtttaa gatggatgga aatatcgatc taggataggt 1740
atacatgttg atgtgggttt tactgatgca tatacatgat ggcatatgca gcatctattc 1800
atatgctcta accttgagta cctatctatt ataataaaca agtatgtttt ataattattt 1860
tgatcttgat atacttggat gatggcatat gcagcagcta tatgtggatt tttttagccc 1920
tgccttcata cgctatttat ttgcttggta ctgtttcttt tgtcgatgct caccctgttg 1980
tttggtgtta cttggcgcgc ccgacgacat cagaatgggc gatgtcgcta ctgctgaacc 2040
accccgacac actcaagaaa gcgcaagccg agatcgacgc atccgtcggc aactctcgcc 2100
tgatcaccgc cgacgacgtg actcgcctcg gctacctcca gtgcatcgtc agggagacgc 2160
tccgcctgta ccccgccgcg ccgatgctcc tcccgcacga gtcctccgcc gaggtaccgt 2220
gagttcatct tctgctgttt tacctttctg atatctgaat tctctcattg gtgcgtaatt 2280
tttttttttt ggctgtcatc ggtatagctt tcttaagcac tcagtagcct tgcaattata 2340
aaaagaaaaa caatcagtag ctttttacat gctttgagtc agtcagtagc agtgtggcac 2400
tatcagcatt cagcagtatt catgttgttt gctaatcact atcatggttt gagtcagcac 2460
aatcagtagc ttttgacatg gtttgagtca gcagtatctt ttctaggaac tgaattagtt 2520
attcatttag tacaacttgt ttgtctgtct attgattgct ttaaattatt tcttctatgc 2580
aaccctctaa tcctagtata gtactagcct tttatatgaa gaatcatcaa taattttctt 2640
ctcactttca gtgtagcttt acttaatgaa tattttgaaa gatcgcctag ttgccttatt 2700
ataattgtataaaaggaaaa caatcagtag ccttttacat ggttgagtca gcgagttatc 2760
aggagtacta ttgtttatca tggtagtagc acgatagact attcaacccg ggcgattaaa 2820
atccttctcc caaatttgta ttctttgttt tttcctcaaa aattcaccaa actcttggaa 2880
ctattatagt tcagttttag acaaaaaaaa aatgaaatct tagttccacc ctcttgccgt 2940
gcagactagt tcggcggagg actcgtgcgg gaggagcatc ggcgcggcgg ggtacaggcg 3000
gagcgtctcc ctgacgatgc actggaggta gccgaggcga gtcacgtcgt cggcggtgat 3060
caggcgagag ttgccgacgg atgcgtcgat ctcggcttgc gctttcttga gtgtgtcggg 3120
gtggttcagc agtagcgaca tcgcccattc tgatgtcgtc gggatcctct agagtcgacc 3180
tgcaggcatg cgtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata 3240
atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat 3300
gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga tagaaaacaa 3360
aatatagcgc gcaaactagg ataaattatc gcgcgcggtg tcatctatgt tactagatcg 3420
ggaagcttgg cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc 3480
caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc 3540
cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatgcta gagcagcttg 3600
agcttggatc agattgtcgt ttcccgcctt cagtttaaac tatcagtgtt tgacaggata 3660
tattggcggg taaacctaag agaaaagagc gtttattaga ataacggata tttaaaaggg 3720
cgtgaaaagg tttatccgtt cgtccatttg tatgtgcatg ccaaccacag ggttcccctc 3780
gggatcaaag tactttgatc caacccctcc gctgctatag tgcagtcggc ttctgacgtt 3840
cagtgcagcc gtcttctgaa aacgacatgt cgcacaagtc ctaagttacg cgacaggctg 3900
ccgccctgcc cttttcctgg cgttttcttg tcgcgtgttt tagtcgcata aagtagaata 3960
cttgcgacta gaaccggaga cattacgcca tgaacaagag cgccgccgct ggcctgctgg 4020
gctatgcccg cgtcagcacc gacgaccagg acttgaccaa ccaacgggcc gaactgcacg 4080
cggccggctg caccaagctg ttttccgaga agatcaccgg caccaggcgc gaccgcccgg 4140
agctggccag gatgcttgac cacctacgcc ctggcgacgt tgtgacagtg accaggctag 4200
accgcctggc ccgcagcacc cgcgacctac tggacattgc cgagcgcatc caggaggccg 4260
gcgcgggcct gcgtagcctg gcagagccgt gggccgacac caccacgccg gccggccgca 4320
tggtgttgac cgtgttcgcc ggcattgccg agttcgagcg ttccctaatc atcgaccgca 4380
cccggagcgg gcgcgaggcc gccaaggccc gaggcgtgaa gtttggcccc cgccctaccc 4440
tcaccccggc acagatcgcg cacgcccgcg agctgatcga ccaggaaggc cgcaccgtga 4500
aagaggcggc tgcactgctt ggcgtgcatc gctcgaccct gtaccgcgca cttgagcgca 4560
gcgaggaagt gacgcccacc gaggccaggc ggcgcggtgc cttccgtgag gacgcattga 4620
ccgaggccga cgccctggcg gccgccgaga atgaacgcca agaggaacaa gcatgaaacc 4680
gcaccaggac ggccaggacg aaccgttttt cattaccgaa gagatcgagg cggagatgat 4740
cgcggccggg tacgtgttcg agccgcccgc gcacgtctca accgtgcggc tgcatgaaat 4800
cctggccggt ttgtctgatg ccaagctggc ggcctggccg gccagcttgg ccgctgaaga 4860
aaccgagcgc cgccgtctaa aaaggtgatg tgtatttgag taaaacagct tgcgtcatgc 4920
ggtcgctgcg tatatgatgc gatgagtaaa taaacaaata cgcaagggga acgcatgaag 4980
gttatcgctg tacttaacca gaaaggcggg tcaggcaaga cgaccatcgc aacccatcta 5040
gcccgcgccc tgcaactcgc cggggccgat gttctgttag tcgattccga tccccagggc 5100
agtgcccgcg attgggcggc cgtgcgggaa gatcaaccgc taaccgttgt cggcatcgac 5160
cgcccgacga ttgaccgcga cgtgaaggcc atcggccggc gcgacttcgt agtgatcgac 5220
ggagcgcccc aggcggcgga cttggctgtg tccgcgatca aggcagccga cttcgtgctg 5280
attccggtgc agccaagccc ttacgacata tgggccaccg ccgacctggt ggagctggtt 5340
aagcagcgca ttgaggtcac ggatggaagg ctacaagcgg cctttgtcgt gtcgcgggcg 5400
atcaaaggca cgcgcatcgg cggtgaggtt gccgaggcgc tggccgggta cgagctgccc 5460
attcttgagt cccgtatcac gcagcgcgtg agctacccag gcactgccgc cgccggcaca 5520
accgttcttg aatcagaacc cgagggcgac gctgcccgcg aggtccaggc gctggccgct 5580
gaaattaaat caaaactcat ttgagttaat gaggtaaaga gaaaatgagc aaaagcacaa 5640
acacgctaag tgccggccgt ccgagcgcac gcagcagcaa ggctgcaacg ttggccagcc 5700
tggcagacac gccagccatg aagcgggtca actttcagtt gccggcggag gatcacacca 5760
agctgaagat gtacgcggta cgccaaggca agaccattac cgagctgcta tctgaataca 5820
tcgcgcagct accagagtaa atgagcaaat gaataaatga gtagatgaat tttagcggct 5880
aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg acgccgtgga atgccccatg 5940
tgtggaggaa cgggcggttg gccaggcgta agcggctggg ttgtctgccg gccctgcaat 6000
ggcactggaa cccccaagcc cgaggaatcg gcgtgacggt cgcaaaccat ccggcccggt 6060
acaaatcggc gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg cgcaggccgc 6120
ccagcggcaa cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag cggccgctga 6180
tcgaatccgc aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga ttaggaagcc 6240
gcccaagggc gacgagcaac cagatttttt cgttccgatg ctctatgacg tgggcacccg 6300
cgatagtcgc agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg accgacgagc 6360
tggcgaggtg atccgctacg agcttccaga cgggcacgta gaggtttccg cagggccggc 6420
cggcatggcc agtgtgtggg attacgacct ggtactgatg gcggtttccc atctaaccga 6480
atccatgaac cgataccggg aagggaaggg agacaagccc ggccgcgtgt tccgtccaca 6540
cgttgcggac gtactcaagt tctgccggcg agccgatggc ggaaagcaga aagacgacct 6600
ggtagaaacc tgcattcggt taaacaccac gcacgttgcc atgcagcgta cgaagaaggc 6660
caagaacggc cgcctggtga cggtatccga gggtgaagcc ttgattagcc gctacaagat 6720
cgtaaagagc gaaaccgggc ggccggagta catcgagatc gagctagctg attggatgta 6780
ccgcgagatc acagaaggca agaacccgga cgtgctgacg gttcaccccg attacttttt 6840
gatcgatccc ggcatcggcc gttttctcta ccgcctggca cgccgcgccg caggcaaggc 6900
agaagccaga tggttgttca agacgatcta cgaacgcagt ggcagcgccg gagagttcaa 6960
gaagttctgt ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg agtacgattt 7020
gaaggaggag gcggggcagg ctggcccgat cctagtcatg cgctaccgca acctgatcga 7080
gggcgaagca tccgccggtt cctaatgtac ggagcagatg ctagggcaaa ttgccctagc 7140
aggggaaaaa ggtcgaaaag gtctctttcc tgtggatagc acgtacattg ggaacccaaa 7200
gccgtacatt gggaaccgga acccgtacat tgggaaccca aagccgtaca ttgggaaccg 7260
gtcacacatg taagtgactg atataaaaga gaaaaaaggc gatttttccg cctaaaactc 7320
tttaaaactt attaaaactc ttaaaacccg cctggcctgt gcataactgt ctggccagcg 7380
cacagccgaa gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc 7440
cgcttcgcgt cggcctatcg cggccgctgg ccgctcaaaa atggctggcc tacggccagg 7500
caatctacca gggcgcggac aagccgcgcc gtcgccactc gaccgccggc gcccacatca 7560
aggcaccctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 7620
cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 7680
cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 7740
gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat 7800
gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc 7860
ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 7920
ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 7980
agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 8040
taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 8100
cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 8160
tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 8220
gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 8280
gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 8340
tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 8400
gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 8460
cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 8520
aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 8580
tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 8640
ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgca 8700
ttctaggtac taaaacaatt catccagtaa aatataatat tttattttct cccaatcagg 8760
cttgatcccc agtaagtcaa aaaatagctc gacatactgt tcttccccga tatcctccct 8820
gatcgaccgg acgcagaagg caatgtcata ccacttgtcc gccctgccgc ttctcccaag 8880
atcaataaag ccacttactt tgccatcttt cacaaagatg ttgctgtctc ccaggtcgcc 8940
gtgggaaaag acaagttcct cttcgggctt ttccgtcttt aaaaaatcat acagctcgcg 9000
cggatcttta aatggagtgt cttcttccca gttttcgcaa tccacatcgg ccagatcgtt 9060
attcagtaag taatccaatt cggctaagcg gctgtctaag ctattcgtat agggacaatc 9120
cgatatgtcg atggagtgaa agagcctgat gcactccgca tacagctcga taatcttttc 9180
agggctttgt tcatcttcat actcttccga gcaaaggacg ccatcggcct cactcatgag 9240
cagattgctc cagccatcat gccgttcaaa gtgcaggacc tttggaacag gcagctttcc 9300
ttccagccat agcatcatgt ccttttcccg ttccacatca taggtggtcc ctttataccg 9360
gctgtccgtc atttttaaat ataggttttc attttctccc accagcttat ataccttagc 9420
aggagacatt ccttccgtat cttttacgca gcggtatttt tcgatcagtt ttttcaattc 9480
cggtgatatt ctcattttag ccatttatta tttccttcct cttttctaca gtatttaaag 9540
ataccccaag aagctaatta taacaagacg aactccaatt cactgttcct tgcattctaa 9600
aaccttaaat accagaaaac agctttttca aagttgtttt caaagttggc gtataacata 9660
gtatcgacgg agccgatttt gaaaccgcgg tgatcacagg cagcaacgct ctgtcatcgt 9720
tacaatcaac atgctaccct ccgcgagatc atccgtgttt caaacccggc agcttagttg 9780
ccgttcttcc gaatagcatc ggtaacatga gcaaagtctg ccgccttaca acggctctcc 9840
cgctgacgcc gtcccggact gatgggctgc ctgtatcgag tggtgatttt gtgccgagct 9900
gccggtcggg gagctgttgg ctggctggtg gcaggatata ttgtggtgta aacaaattga 9960
cgcttagaca acttaataac acattgcgga cgtttttaat gtactgaatt aacgccgaat 10020
taattcgggg gatctggatt ttagtactgg attttggttt taggaattag aaattttatt 10080
gatagaagta ttttacaaat acaaatacat actaagggtt tcttatatgc tcaacacatg 10140
agcgaaaccc tataggaacc ctaattccct tatctgggaa ctactcacac attattatgg 10200
agaaactcga gcttgtcgat cgacagatcc ggtcggcatc tactctattt ctttgccctc 10260
ggacgagtgc tggggcgtcg gtttccacta tcggcgagta cttctacaca gccatcggtc 10320
cagacggccg cgcttctgcg ggcgatttgt gtacgcccga cagtcccggc tccggatcgg 10380
acgattgcgt cgcatcgacc ctgcgcccaa gctgcatcat cgaaattgcc gtcaaccaag 10440
ctctgataga gttggtcaag accaatgcgg agcatatacg cccggagtcg tggcgatcct 10500
gcaagctccg gatgcctccg ctcgaagtag cgcgtctgct gctccataca agccaaccac 10560
ggcctccaga agaagatgtt ggcgacctcg tattgggaat ccccgaacat cgcctcgctc 10620
cagtcaatga ccgctgttat gcggccattg tccgtcagga cattgttgga gccgaaatcc 10680
gcgtgcacga ggtgccggac ttcggggcag tcctcggccc aaagcatcag ctcatcgaga 10740
gcctgcgcga cggacgcact gacggtgtcg tccatcacag tttgccagtg atacacatgg 10800
ggatcagcaa tcgcgcatat gaaatcacgc catgtagtgt attgaccgat tccttgcggt 10860
ccgaatgggc cgaacccgct cgtctggcta agatcggccg cagcgatcgc atccatagcc 10920
tccgcgaccg gttgtagaac agcgggcagt tcggtttcag gcaggtcttg caacgtgaca 10980
ccctgtgcac ggcgggagat gcaataggtc aggctctcgc taaactcccc aatgtcaagc 11040
acttccggaa tcgggagcgc ggccgatgca aagtgccgat aaacataacg atctttgtag 11100
aaaccatcgg cgcagctatt tacccgcagg acatatccac gccctcctac atcgaagctg 11160
aaagcacgag attcttcgcc ctccgagagc tgcatcaggt cggagacgct gtcgaacttt 11220
tcgatcagaa acttctcgac agacgtcgcg gtgagttcag gctttttcat atctcattgc 11280
ccccccggat ctgcgaaagc tcgagagaga tagatttgta gagagagact ggtgatttca 11340
gcgtgtcctc tccaaatgaa atgaacttcc ttatatagag gaaggtcttg cgaaggatag 11400
tgggattgtg cgtcatccct tacgtcagtg gagatatcac atcaatccac ttgctttgaa 11460
gacgtggttg gaacgtcttc tttttccacg atgctcctcg tgggtggggg tccatctttg 11520
ggaccactgt cggcagaggc atcttgaacg atagcctttc ctttatcgca atgatggcat 11580
ttgtaggtgc caccttcctt ttctactgtc cttttgatga agtgacagat agctgggcaa 11640
tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat agccctttgg 11700
tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg ctccaccatg 11760
ttatcacatc aatccacttg ctttgaagac gtggttggaa cgtcttcttt ttccacgatg 11820
ctcctcgtgg gtgggggtcc atctttggga ccactgtcgg cagaggcatc ttgaacgata 11880
gcctttcctt tatcgcaatg atggcatttg taggtgccac cttccttttc tactgtcctt 11940
ttgatgaagt gacagatagc tgggcaatgg aatccgagga ggtttcccga tattaccctt 12000
tgttgaaaag tctcaatagc cctttggtct tctgagactg tatctttgat attcttggag 12060
tagacgagag tgtcgtgctc caccatgttg gcaagctgct ctagccaata cgcaaaccgc 12120
ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga 12180
aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag gcaccccagg 12240
ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc 12300
acacaggaaa cagctatgac catgattacg 12330
<210>5
<211>258
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
atcccgcaca tcggcgcggc caacctgtgg gactacttgc cggcgctccg gtggttcgac 60
gtgttcggcg tcaggaggaa gatcctcgcc gctgtaagcc ggagggacgc gttccttcgc 120
cgcctgatcg acgcggagcg gcggaggctg gacgacggcg acgagggcga gaagaagagc 180
atgatcgccg tgctgctcac tctgcagaag acagagccgg aggtgtacac cgataacatg 240
atcacagctc taacggcg 258
<210>6
<211>122
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gtgagttcat cttctgctgt tttacctttc tgatatctga attctctcat tggtgcgtaa 60
tttttttttt ttggctgtca tcggtatagc tttcttaagc actcagtagc cttgcaatta 120
ta 122
<210>7
<211>258
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
cgccgttaga gctgtgatca tgttatcggt gtacacctcc ggctctgtct tctgcagagt 60
gagcagcacg gcgatcatgc tcttcttctc gccctcgtcg ccgtcgtcca gcctccgccg 120
ctccgcgtcg atcaggcggc gaaggaacgc gtccctccgg cttacagcgg cgaggatctt 180
cctcctgacg ccgaacacgt cgaaccaccg gagcgccggc aagtagtccc acaggttggc 240
cgcgccgatg tgcgggat 258
<210>8
<211>11808
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
aattcgagct cgtgcagcgt gacccggtcg tgcccctctc tagagataat gagcattgca 60
tgtctaagtt ataaaaaatt accacatatt ttttttgtca cacttgtttg aagtgcagtt 120
tatctatctt tatacatata tttaaacttt actctacgaa taatataatc tatagtacta 180
caataatatc agtgttttag agaatcatat aaatgaacag ttagacatgg tctaaaggac 240
aattgagtat tttgacaaca ggactctaca gttttatctt tttagtgtgc atgtgttctc 300
cttttttttt gcaaatagct tcacctatat aatacttcat ccattttatt agtacatcca 360
tttagggttt agggttaatg gtttttatag actaattttt ttagtacatc tattttattc 420
tattttagcc tctaaattaa gaaaactaaa actctatttt agttttttta tttaataatt 480
tagatataaa atagaataaa ataaagtgac taaaaattaa acaaataccc tttaagaaat 540
taaaaaaact aaggaaacat ttttcttgtt tcgagtagat aatgccagcc tgttaaacgc 600
cgtcgacgag tctaacggac accaaccagc gaaccagcag cgtcgcgtcg ggccaagcga 660
agcagacggc acggcatctc tgtcgctgcc tctggacccc tctcgagagt tccgctccac 720
cgttggactt gctccgctgt cggcatccag aaattgcgtg gcggagcggc agacgtgagc 780
cggcacggca ggcggcctcc tcctcctctc acggcaccgg cagctacggg ggattccttt 840
cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca 900
ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca 960
aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc cccccccctc 1020
tctaccttct ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt 1080
tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga 1140
tgcgacctgt acgtcagaca cgttctgatt gctaacttgc cagtgtttct ctttggggaa 1200
tcctgggatg gctctagccg ttccgcagac gggatcgatt tcatgatttt ttttgtttcg 1260
ttgcataggg tttggtttgc ccttttcctt tatttcaata tatgccgtgc acttgtttgt 1320
cgggtcatct tttcatgctt ttttttgtct tggttgtgat gatgtggtct ggttgggcgg 1380
tcgttctaga tcggagtaga attctgtttc aaactacctg gtggatttat taattttgga 1440
tctgtatgtg tgtgccatac atattcatag ttacgaattg aagatgatgg atggaaatat 1500
cgatctagga taggtataca tgttgatgcg ggttttactg atgcatatac agagatgctt 1560
tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg tcgttcattc gttctagatc 1620
ggagtagaat actgtttcaa actacctggt gtatttatta attttggaac tgtatgtgtg 1680
tgtcatacat cttcatagtt acgagtttaa gatggatgga aatatcgatc taggataggt 1740
atacatgttg atgtgggttt tactgatgca tatacatgat ggcatatgca gcatctattc 1800
atatgctcta accttgagta cctatctatt ataataaaca agtatgtttt ataattattt 1860
tgatcttgat atacttggat gatggcatat gcagcagcta tatgtggatt tttttagccc 1920
tgccttcata cgctatttat ttgcttggta ctgtttcttt tgtcgatgct caccctgttg 1980
tttggtgtta cttggcgcgc catcccgcac atcggcgcgg ccaacctgtg ggactacttg 2040
ccggcgctcc ggtggttcga cgtgttcggc gtcaggagga agatcctcgc cgctgtaagc 2100
cggagggacg cgttccttcg ccgcctgatc gacgcggagc ggcggaggct ggacgacggc 2160
gacgagggcg agaagaagag catgatcgcc gtgctgctca ctctgcagaa gacagagccg 2220
gaggtgtaca ccgataacat gatcacagct ctaacggcgg tgagttcatc ttctgctgtt 2280
ttacctttct gatatctgaa ttctctcatt ggtgcgtaat tttttttttt tggctgtcat 2340
cggtatagct ttcttaagca ctcagtagcc ttgcaattat acgccgttag agctgtgatc 2400
atgttatcgg tgtacacctc cggctctgtc ttctgcagag tgagcagcac ggcgatcatg 2460
ctcttcttct cgccctcgtc gccgtcgtcc agcctccgcc gctccgcgtc gatcaggcgg 2520
cgaaggaacg cgtccctccg gcttacagcg gcgaggatct tcctcctgac gccgaacacg 2580
tcgaaccacc ggagcgccgg caagtagtcc cacaggttgg ccgcgccgat gtgcgggatg 2640
gatcctctag agtcgacctg caggcatgcg tttcttaaga ttgaatcctg ttgccggtct 2700
tgcgatgatt atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta 2760
atgcatgacg ttatttatga gatgggtttt tatgattaga gtcccgcaat tatacattta 2820
atacgcgata gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc 2880
atctatgtta ctagatcggg aagcttggca ctggccgtcg ttttacaacg tcgtgactgg 2940
gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg 3000
cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc 3060
gaatgctaga gcagcttgag cttggatcag attgtcgttt cccgccttca gtttaaacta 3120
tcagtgtttgacaggatata ttggcgggta aacctaagag aaaagagcgt ttattagaat 3180
aacggatatt taaaagggcg tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc 3240
aaccacaggg ttcccctcgg gatcaaagta ctttgatcca acccctccgc tgctatagtg 3300
cagtcggctt ctgacgttca gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct 3360
aagttacgcg acaggctgcc gccctgccct tttcctggcg ttttcttgtc gcgtgtttta 3420
gtcgcataaa gtagaatact tgcgactaga accggagaca ttacgccatg aacaagagcg 3480
ccgccgctgg cctgctgggc tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc 3540
aacgggccga actgcacgcg gccggctgca ccaagctgtt ttccgagaag atcaccggca 3600
ccaggcgcga ccgcccggag ctggccagga tgcttgacca cctacgccct ggcgacgttg 3660
tgacagtgac caggctagac cgcctggccc gcagcacccg cgacctactg gacattgccg 3720
agcgcatcca ggaggccggc gcgggcctgc gtagcctggc agagccgtgg gccgacacca 3780
ccacgccggc cggccgcatg gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt 3840
ccctaatcat cgaccgcacc cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt 3900
ttggcccccg ccctaccctc accccggcac agatcgcgca cgcccgcgag ctgatcgacc 3960
aggaaggccg caccgtgaaa gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt 4020
accgcgcact tgagcgcagc gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct 4080
tccgtgagga cgcattgacc gaggccgacg ccctggcggc cgccgagaat gaacgccaag 4140
aggaacaagc atgaaaccgc accaggacgg ccaggacgaa ccgtttttca ttaccgaaga 4200
gatcgaggcg gagatgatcg cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac 4260
cgtgcggctg catgaaatcc tggccggttt gtctgatgcc aagctggcgg cctggccggc 4320
cagcttggcc gctgaagaaa ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta 4380
aaacagcttg cgtcatgcgg tcgctgcgta tatgatgcga tgagtaaata aacaaatacg 4440
caaggggaac gcatgaaggt tatcgctgta cttaaccaga aaggcgggtc aggcaagacg 4500
accatcgcaa cccatctagc ccgcgccctg caactcgccg gggccgatgt tctgttagtc 4560
gattccgatc cccagggcag tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta 4620
accgttgtcg gcatcgaccg cccgacgatt gaccgcgacg tgaaggccat cggccggcgc 4680
gacttcgtag tgatcgacgg agcgccccag gcggcggact tggctgtgtc cgcgatcaag 4740
gcagccgact tcgtgctgat tccggtgcag ccaagccctt acgacatatg ggccaccgcc 4800
gacctggtgg agctggttaa gcagcgcatt gaggtcacgg atggaaggct acaagcggcc 4860
tttgtcgtgt cgcgggcgat caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg 4920
gccgggtacg agctgcccat tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc 4980
actgccgccg ccggcacaac cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag 5040
gtccaggcgc tggccgctga aattaaatca aaactcattt gagttaatga ggtaaagaga 5100
aaatgagcaa aagcacaaac acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg 5160
ctgcaacgtt ggccagcctg gcagacacgc cagccatgaa gcgggtcaac tttcagttgc 5220
cggcggagga tcacaccaag ctgaagatgt acgcggtacg ccaaggcaag accattaccg 5280
agctgctatc tgaatacatc gcgcagctac cagagtaaat gagcaaatga ataaatgagt 5340
agatgaattt tagcggctaa aggaggcggc atggaaaatc aagaacaacc aggcaccgac 5400
gccgtggaat gccccatgtg tggaggaacg ggcggttggc caggcgtaag cggctgggtt 5460
gtctgccggc cctgcaatgg cactggaacc cccaagcccg aggaatcggc gtgacggtcg 5520
caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt 5580
gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc 5640
gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc 5700
gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct 5760
ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc 5820
gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga 5880
ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc 5940
ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg 6000
ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg 6060
aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat 6120
gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt 6180
gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga 6240
gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt 6300
tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg 6360
ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg 6420
cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga 6480
cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg 6540
ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct 6600
agggcaaatt gccctagcag gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac 6660
gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa 6720
gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga 6780
tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc 6840
ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct 6900
gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat 6960
ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga 7020
ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 7080
tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 7140
gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 7200
agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt 7260
actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 7320
catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 7380
gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 7440
cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc7500
gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 7560
aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 7620
ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 7680
cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 7740
ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 7800
cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 7860
agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 7920
gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 7980
gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 8040
tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 8100
agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 8160
agggattttg gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt 8220
tattttctcc caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc 8280
ttccccgata tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc 8340
cctgccgctt ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt 8400
gctgtctccc aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa 8460
aaaatcatac agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc 8520
cacatcggcc agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct 8580
attcgtatag ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata 8640
cagctcgata atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc 8700
atcggcctca ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt 8760
tggaacaggc agctttcctt ccagccatag catcatgtcc ttttcccgtt ccacatcata 8820
ggtggtccct ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac 8880
cagcttatat accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc 8940
gatcagtttt ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct 9000
tttctacagt atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca 9060
ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca 9120
aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca 9180
gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca 9240
aacccggcag cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc 9300
gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg 9360
gtgattttgt gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt 9420
gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt 9480
actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta 9540
ggaattagaa attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc 9600
ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact 9660
actcacacat tattatggag aaactcgagc ttgtcgatcg acagatccgg tcggcatcta 9720
ctctatttct ttgccctcgg acgagtgctg gggcgtcggt ttccactatc ggcgagtact 9780
tctacacagc catcggtcca gacggccgcg cttctgcggg cgatttgtgt acgcccgaca 9840
gtcccggctc cggatcggac gattgcgtcg catcgaccct gcgcccaagc tgcatcatcg 9900
aaattgccgt caaccaagct ctgatagagt tggtcaagac caatgcggag catatacgcc 9960
cggagtcgtg gcgatcctgc aagctccgga tgcctccgct cgaagtagcg cgtctgctgc 10020
tccatacaag ccaaccacgg cctccagaag aagatgttgg cgacctcgta ttgggaatcc 10080
ccgaacatcg cctcgctcca gtcaatgacc gctgttatgc ggccattgtc cgtcaggaca 10140
ttgttggagc cgaaatccgc gtgcacgagg tgccggactt cggggcagtc ctcggcccaa 10200
agcatcagct catcgagagc ctgcgcgacg gacgcactga cggtgtcgtc catcacagtt 10260
tgccagtgat acacatgggg atcagcaatc gcgcatatga aatcacgcca tgtagtgtat 10320
tgaccgattc cttgcggtcc gaatgggccg aacccgctcg tctggctaag atcggccgca 10380
gcgatcgcat ccatagcctc cgcgaccggt tgtagaacag cgggcagttc ggtttcaggc 10440
aggtcttgca acgtgacacc ctgtgcacgg cgggagatgc aataggtcag gctctcgcta 10500
aactccccaa tgtcaagcac ttccggaatc gggagcgcgg ccgatgcaaa gtgccgataa 10560
acataacgat ctttgtagaa accatcggcg cagctattta cccgcaggac atatccacgc 10620
cctcctacat cgaagctgaa agcacgagat tcttcgccct ccgagagctg catcaggtcg 10680
gagacgctgt cgaacttttc gatcagaaac ttctcgacag acgtcgcggt gagttcaggc 10740
tttttcatat ctcattgccc ccccggatct gcgaaagctc gagagagata gatttgtaga 10800
gagagactgg tgatttcagc gtgtcctctc caaatgaaat gaacttcctt atatagagga 10860
aggtcttgcg aaggatagtg ggattgtgcg tcatccctta cgtcagtgga gatatcacat 10920
caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg 10980
ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct 11040
ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag 11100
tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa 11160
gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga 11220
gtgtcgtgct ccaccatgtt atcacatcaa tccacttgct ttgaagacgt ggttggaacg 11280
tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca 11340
gaggcatctt gaacgatagc ctttccttta tcgcaatgat ggcatttgta ggtgccacct 11400
tccttttcta ctgtcctttt gatgaagtga cagatagctg ggcaatggaa tccgaggagg 11460
tttcccgata ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc tgagactgta 11520
tctttgatat tcttggagta gacgagagtg tcgtgctcca ccatgttggc aagctgctct 11580
agccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg 11640
acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 11700
ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg 11760
tgagcggata acaatttcac acaggaaaca gctatgacca tgattacg 11808
<210>9
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tgtttggtgt tacttggcgc gcccgacgac atcagaatgg gc 42
<210>10
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
agcagaagat gaactcacgg tacctcggcg gaggactcgt gc 42
<210>11
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
gcacgagtcc tccgccgagg taccgtgagt tcatcttctg ct 42
<210>12
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
acgagtcctc cgccgaacta gtctgcacgg caagagggtg ga 42
<210>13
<211>41
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
accctcttgc cgtgcagact agttcggcgg aggactcgtg c 41
<210>14
<211>39
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
aggtcgactc tagaggatcc cgacgacatc agaatgggc 39
Claims (10)
1. An RNAi plant expression vector for inhibiting cytochrome P450 gene expression, which is characterized by comprising a hairpin structure expression cassette, wherein the hairpin structure expression cassette comprises a hairpin structure formed by DNA fragments shown in SEQ ID No. 1-3.
2. The RNAi plant expression vector of claim 1, further comprising a plant constitutive promoter or a plant tissue specific promoter upstream of the hairpin structure and a terminator downstream of the hairpin structure,
wherein the plant constitutive promoter is a Ubi promoter, a CAMV 35S promoter or an Actin promoter of rice or corn; the plant tissue specific promoter is a Rubisco small subunit promoter or a Cab promoter.
3. The RNAi plant expression vector of claim 1, further comprising a selectable marker expression cassette comprising a promoter, a marker gene, and a terminator, wherein the promoter is a Ubi promoter, CAMV 35S promoter, or an Actin promoter of rice or maize; the marker gene is a gene of enzyme capable of generating color change, a fluorescence marker gene, an antibiotic marker gene, a herbicide screening marker gene or an anti-chemical agent marker gene, and the terminator is a NOS terminator or a Ubi terminator.
4. The RNAi plant expression vector of any one of claims 1-3, having the nucleotide sequence shown in SEQ id No. 4.
5. A biomaterial comprising the RNAi plant expression vector of any one of claims 1-4, wherein the biomaterial is an engineered bacterium, a cell comprising a P450i-8 stem-loop structure, or a callus.
6. A method of constructing an RNAi plant expression vector, comprising: the DNA fragment shown in SEQ ID No.1-3 is connected between AscI and BamHI sites of a plant binary transformation vector pCAMBIA1300-Ubi-Nos by using overlapping method to obtain an RNAi plant expression vector pC1300-UN-P450 i-8.
7. Use of the RNAi plant expression vector of any one of claims 1-4 to interfere with expression of the plant cytochrome P450 gene CYP81a6 in the preparation of a herbicide-dominant sensitive plant, comprising introducing pC1300-UN-P450i-8 into agrobacterium EHA105 strain and transforming plant calli.
8. A method for interfering the expression of the plant cytochrome P450 gene CYP81A6, comprising transforming a plant with the RNAi plant expression vector of any one of claims 1 to 4, and interfering the expression of the plant cytochrome P450 gene CYP81A 6.
9. The method of claim 8, comprising:
(1) constructing RNAi plant expression vector: connecting the DNA fragment shown in SEQ ID No.1-3 to AscI and BamHI sites of a plant binary transformation vector pCAMBIA1300-Ubi-Nos by using an overlapping method to obtain an RNAi plant expression vector pC1300-UN-P450 i-8;
(2) and (3) transformation: introducing pC1300-UN-P450i-8 into Agrobacterium EHA105 strain, transforming callus, and inducing and differentiating the transformed callus to obtain herbicide dominant sensitive plant.
10. Use of the RNAi plant expression vector of any one of claims 1-4 for breeding new transgenic varieties, hybrid rice seed production, or preventing transgene escape.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910145905.0A CN111621513A (en) | 2019-02-27 | 2019-02-27 | RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910145905.0A CN111621513A (en) | 2019-02-27 | 2019-02-27 | RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111621513A true CN111621513A (en) | 2020-09-04 |
Family
ID=72256891
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910145905.0A Pending CN111621513A (en) | 2019-02-27 | 2019-02-27 | RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111621513A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102946715A (en) * | 2010-01-07 | 2013-02-27 | 巴斯福农业有限责任公司阿纳姆(荷兰)韦登斯维尔分公司 | Herbicide-tolerant plants |
CN105802994A (en) * | 2016-04-20 | 2016-07-27 | 海南波莲水稻基因科技有限公司 | RNAi (RNA interfere) plant expression vector and application thereof |
CN105886526A (en) * | 2016-04-20 | 2016-08-24 | 海南波莲水稻基因科技有限公司 | Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression |
CN105907782A (en) * | 2016-04-20 | 2016-08-31 | 海南波莲水稻基因科技有限公司 | RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof |
-
2019
- 2019-02-27 CN CN201910145905.0A patent/CN111621513A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102946715A (en) * | 2010-01-07 | 2013-02-27 | 巴斯福农业有限责任公司阿纳姆(荷兰)韦登斯维尔分公司 | Herbicide-tolerant plants |
CN105802994A (en) * | 2016-04-20 | 2016-07-27 | 海南波莲水稻基因科技有限公司 | RNAi (RNA interfere) plant expression vector and application thereof |
CN105886526A (en) * | 2016-04-20 | 2016-08-24 | 海南波莲水稻基因科技有限公司 | Vector capable of inhibiting cytochrome P450 gene expression and application of vector capable of inhibiting cytochrome P450 gene expression |
CN105907782A (en) * | 2016-04-20 | 2016-08-31 | 海南波莲水稻基因科技有限公司 | RNAi plant expression vector for inhibiting expression of cytochrome P450 gene and application thereof |
Non-Patent Citations (5)
Title |
---|
GANG PAN 等: "Map-based cloning of a novel rice cytochrome P450 gene CYP81A6 that confers resistance to two different classes of herbicides", 《PLANT MOLECULAR BIOLOGY》 * |
HAI-PING LU 等: "Expression of cytochrome P450 CYP81A6 in rice: tissue specificity, protein subcellular localization, and response to herbicide application", 《JOURNAL OF ZHEJIANG UNIVERSUTY SCIENCE B》 * |
NCBI: "A bentazon and sulfonylurea herbicide resistant gene Cyp81A6", 《GENBANK: DM143459.1》 * |
NCBI: "Oryza sativa Japonica Group DNA, chromosome 3, cultivar: Nipponbare, complete sequence", 《GENBANK:AP014959.1》 * |
田迪 等: "水稻细胞色素P450基因家族成员CYP81A6基因RNAi载体构建", 《分子植物育种》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109679989A (en) | A method of improving base editing system editorial efficiency | |
AU2021232763A1 (en) | Methods for Nucleic Acid Assembly and High Throughput Sequencing | |
CN106939316B (en) | Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system | |
CN108531439B (en) | Escherichia coli genetic engineering bacterium and construction method and application thereof | |
CN110577965B (en) | Application of xCas9n-epBE base editing system in gene editing | |
CN110724685A (en) | Transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof | |
CN108642061B (en) | Ogura CMS sterility restorer gene RfoB、RfoBPlant expression vector and application thereof | |
CN109355306A (en) | Upland cotton transformation event ICR24-397 and its specificity identification method | |
CN111621513A (en) | RNAi plant expression vector for inhibiting cytochrome P450 by using rice endogenous sequence and application thereof | |
CN113462697B (en) | Degradable glyphosate-resistant gene, plant expression vector, cultivation method of degradable glyphosate-resistant transgenic rice and application | |
CN111100852B (en) | Directional mutation method of OsALS1 and crop endogenous gene directed evolution method | |
CN112280799B (en) | Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system | |
CN109266686A (en) | A kind of method of genome nucleotide fixed point replacement | |
CN112375781B (en) | Application of pC1300-MAS-Cas9 gene editing system in 84K poplar gene editing | |
CN110951773B (en) | Application of FNLS-sABE system in creating rice herbicide resistant material | |
CN110982818B (en) | Application of nuclear localization signal F4NLS in efficient creation of rice herbicide resistant material | |
CN110964742B (en) | Preparation method of herbicide-resistant rice | |
CN110229823B (en) | Upland cotton transformation event 19C006-59-11 and specificity identification method thereof | |
CN110268064A (en) | Targeting recombination between homologue and application thereof | |
CN109666693B (en) | Application of MG132 in editing receptor genome by base editing system | |
CN109666694B (en) | Application of SCR7 in editing receptor genome by base editing system | |
CN110106198B (en) | Upland cotton transformation event C006-10-13 and specificity identification method thereof | |
CN109266673A (en) | A kind of coli expression carrier pBMcopA and its application | |
CN112680474A (en) | Fluorescent-labeled CRISPR/SpCas9 system-mediated gene replacement system and application thereof in plants | |
CN109265562B (en) | Nicking enzyme and application thereof in genome base replacement |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200904 |
|
RJ01 | Rejection of invention patent application after publication |