CN108531439B

CN108531439B - Escherichia coli genetic engineering bacterium and construction method and application thereof

Info

Publication number: CN108531439B
Application number: CN201810336575.9A
Authority: CN
Inventors: 应汉杰; 刘娜; 陈勇; 任培芳; 余斌; 杨乐云; 孙文俊; 奚迅
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2018-04-16
Filing date: 2018-04-16
Publication date: 2020-04-07
Anticipated expiration: 2038-04-16
Also published as: CN108531439A

Abstract

The invention discloses an escherichia coli genetic engineering bacterium, which introduces recombinant plasmid carrying fimH gene. The invention also discloses a construction method of the genetic engineering bacteria. The invention further discloses application of the genetic engineering bacteria in fermentation production of L-threonine. According to the invention, by constructing the escherichia coli genetic engineering bacteria for over-expressing fimH genes, the yield of the biomembrane is increased in the process of producing L-threonine by fermentation of escherichia coli, the adhesion is increased, the number of flora is increased, the yield of L-threonine and the sugar conversion rate are increased, and the fermentation period is shortened.

Description

Escherichia coli genetic engineering bacterium and construction method and application thereof

Technical Field

The invention relates to L-threonine fermentation, in particular to an escherichia coli genetic engineering bacterium and a construction method and application thereof.

Background

L-threonine, an amino acid isolated and identified from fibrin hydrolysate in 1935 by w.c. rose, has proven to be the last essential amino acid discovered and cannot be synthesized by the human body itself and must be ingested from food. L-threonine is widely used as a food additive in the feed industry, health food and pharmaceutical industry, and due to the wide role of L-threonine, the market demand of threonine has increased rapidly in recent years, and the market of threonine will increase rapidly and the demand of threonine will increase continuously in the future.

The preparation method of L-threonine mainly comprises a protein hydrolysis method, a chemical synthesis method and a microbial fermentation method, wherein the microbial fermentation method has the advantages of resource saving, low cost, small environmental pollution and the like, and is widely applied to the production of L-threonine. With the rapid advancement of modern society genetic engineering technology, the application demand of industrial microorganisms and industrial technology is increased, and particularly, the construction of an industrial microorganism carrier system provides reliable technical support for the screening of excellent L-threonine production strains and the improvement of acid production level, so that the production of L-threonine by a microorganism direct fermentation method becomes a cheap industrial production method. Microorganisms capable of producing threonine at present include Escherichia, Corynebacterium, and Serratia. The threonine produced by escherichia coli is commonly applied to microbial fermentation experiments at present, and has the advantages of fast strain propagation, short fermentation period, low cost and the like, but the yield is stably increased but the speed is slower compared with the requirement of the amino acid industry.

Disclosure of Invention

The purpose of the invention is as follows: in order to solve the problems of low yield and long fermentation period when the existing Escherichia coli is used for producing L-threonine by fermentation, the invention provides an Escherichia coli genetic engineering bacterium, further provides a construction method of the Escherichia coli genetic engineering bacterium, and further provides application of the Escherichia coli genetic engineering bacterium in producing L-threonine by fermentation.

The technical scheme is as follows: the invention relates to an escherichia coli genetic engineering bacterium, which is introduced with recombinant plasmid carrying fimH gene. The invention starts from the medical field, most of bacterial infections are closely related to the formation of a biological film, and the reduction of the formation of the biological film is adopted in the medical science to reduce the bacterial infections; the invention firstly proposes that the adhesion of the escherichia coli is increased by increasing the biological membrane amount of the escherichia coli, the adhesion can be adhered to the surface of a non-living organism, and the yield and the fermentation period of the L-threonine in the process of producing the L-threonine by fermentation are improved.

Wherein the original Escherichia coli is CCTCC NO: M2015233; the recombinant plasmid is PET-28a plasmid carrying fimH gene.

The invention further provides a construction method of the escherichia coli genetic engineering bacteria, which comprises the following steps:

(1) extracting the original genome of the escherichia coli;

(2) amplifying fimH gene by using the genome extracted in the step (1) as a template and adopting a PCR technology;

(3) inserting the fimH gene obtained in the step (2) into the NcoI/XbaI enzyme cutting sites of the PET-28a plasmid to obtain a recombinant plasmid carrying the fimH gene;

(4) transforming the recombinant plasmid obtained in the step (3) into a competent cell of E.coli DH5 α, and extracting the recombinant plasmid from E.coli DH5 α;

(5) and (4) transforming the recombinant plasmid extracted in the step (4) into competent cells of original escherichia coli to obtain the escherichia coli genetic engineering bacteria.

Wherein the original escherichia coli in the step (1) is donated from Shanghai Life sciences research institute of Chinese academy of sciences, the escherichia coli is applied for patent 201510199036.1 and is preserved, the preservation number is CCTCC NO: M2015233, and the strain number is CIBTS 1688.

Wherein, the primers used in the PCR in the step (2) are as follows:

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA。

the invention further provides application of the escherichia coli genetic engineering bacteria in fermentation production of L-threonine.

Wherein, the fermentation conditions are as follows: the fermentation temperature is 25-37 ℃, and the fermentation time is 30-32 h.

Has the advantages that: according to the invention, by constructing the escherichia coli genetic engineering bacteria for over-expressing fimH genes, the yield of the biomembrane is increased, the adhesion is increased, the number of flora is increased in the process of producing L-threonine by fermentation of escherichia coli, the yield of L-threonine and the sugar conversion rate are increased, and the fermentation period is shortened.

Drawings

FIG. 1 is an electrophoretogram of the original E.coli genome;

FIG. 2 is an electrophoretogram of fimH gene;

FIG. 3 is an electrophoretogram of recombinant plasmid;

FIG. 4 is a map of a recombinant plasmid;

FIG. 5 is an electron micrograph of the biofilm of strain CIBTS 1688;

FIG. 6 is an electron micrograph of the biofilm of strain CIBTS1688 fimH;

fig. 7 shows the results of fermentation of strain CIBTS1688 and strain CIBTS1688 fimH.

Detailed Description

Example 1

First, extracting original colibacillus CIBTS1688 genome

Kit for extracting bacterial genome (takara minitest bacterial genomic DNA extraction kit ver.3.0) using takara corporation

(1) Activation of glycerol bacteria: 10 mu L of original strain CIBTS1688+5mL of LB liquid medium, and culturing overnight;

wherein the LB liquid culture medium comprises the following formula: sterilizing 10g/L sodium chloride, 10g/L tryptone and 5g/L yeast powder at 121 ℃ for 20 min;

(2) collecting bacterial liquid by using a 1.5mL centrifuge tube (1.2 mL bacterial liquid is filled in each 1.5mL centrifuge tube), centrifuging at 12000rpm for 2min, and discarding the supernatant;

(3) adding 180 mu L of buffer GL, 20 mu L of protease K (20mg/mL) and 10 mu L of RNase A (10mg/mL) into the thallus obtained in the step (2), fully oscillating and uniformly mixing, and carrying out warm bath on the thallus in 56 ℃ for 10min, wherein the solution is transparent and clear;

(4) adding 200 mu L of buffer GB and 200 mu L of absolute ethyl alcohol into the system obtained in the step (3), fully sucking, beating and uniformly mixing;

(5) mounting Spin Column on Collection Tube, transferring the solution obtained in the step (4) into Spin Column, centrifuging at 12000rpm for 2min, and removing the filtrate;

(6) adding 500 μ L Buffer WA into Spin Column, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(7) adding 700 mu L of Buffer WB into Spin Column, centrifuging at 12000rpm for 1min, and removing the filtrate;

(8) buffer WB is added along the periphery of the Spin Column tube wall, which is beneficial to completely washing salt attached to the tube wall;

(9) repeating the operation step (8);

(10) spin Column was mounted on the Collection Tube and centrifuged at 12000rpm for 2 min;

(11) placing Spin Column on a new 1.5mL centrifuge tube, adding 50-200 μ L of sterilized water or Elution Buffer at the center of the Spin Column membrane, and standing at room temperature for 5 min; wherein, the sterilization water is heated to 65 ℃ for use, which is beneficial to improving the elution efficiency;

(12) then, the DNA was eluted by centrifugation at 12000rpm for 2 min. If a larger yield is required, the supernatant can be added into the center of a Spin Column membrane again or 50-200 mu L of sterilized water is added, after standing for 5min at room temperature, the solution is centrifuged at 12000rpm for 2min to elute DNA, and the electrophoresis chart of the original Escherichia coli DNA is shown in figure 1.

Secondly, amplifying the target gene fimH by using PCR technology

(1) Amplifying a target gene fimH by using the DNA obtained in the step one as a template and applying a PCR technology, wherein a reaction system is shown in a table 1;

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA

TABLE 1 PCR reaction System

The PCR product (fimH gene fragment) was electrophoresed using 0.8% (0.8g/100mL) agarose gel, and the result is shown in FIG. 2.

(2) Gel recovery purification fragment fimH

Using the TaKaRa kit (TaKaRa MiniBEST Agarose Gel DNA Extraction KitVer.4.0)

2.1 preparing agarose gel by using TBE buffer solution, and then carrying out agarose gel electrophoresis on the target fragment fimH;

2.2 cutting out agarose gel containing target fragment fimH under an ultraviolet lamp, and completely absorbing surface liquid by using a paper towel;

2.3 chopping the rubber blocks and weighing the rubber blocks. When the volume is calculated, the calculation is carried out according to 1mg to 1 μ L;

2.4 adding a dissolving solution Buffer GM into the rubber block, wherein the adding amount of the Buffer GM is less than that of the rubber block, uniformly mixing, dissolving the rubber block at room temperature of 15-25 ℃, and at the moment, intermittently oscillating and mixing to fully dissolve the rubber block;

2.5 placing Spin Colum in the kit on the Collection Tube;

2.6 transferring the solution obtained in the step 2.4 into Spin Column, centrifuging at 1200000 rpm for 1min, and discarding the filtrate;

2.7 adding 700 μ L Buffer WB into Spin Column, centrifuging at 12000rpm for 1min at room temperature, and discarding the filtrate;

2.8 repeating the operation step 2.7;

2.9 Spin Column was mounted on the Collection Tube, centrifuged at 12000rpm for 1min at room temperature, and the filtrate was discarded;

2.10 placing Spin Column in a new centrifuge tube of 1.5mL, adding 30 μ L of sterilized water at the center of the Spin Column membrane, and standing at room temperature for 1 min;

2.11 centrifugation at 12000rpm for 1min at room temperature to elute fimH fragment;

2.12 carrying out agarose gel electrophoresis verification on the purified fimH target fragment, and calculating the concentration; wherein the nucleotide sequence of fimH gene is shown in SEQ ID NO: 1.

thirdly, extracting the plasmid PET-28a

Using the TaKaRa Kit (TaKaRa MiniBEST plasma Purification Kit Ver.4.0)

(1) Selecting a single E.coli DH5 α colony (containing PET-28a, from Koehai Biotechnology Co., Ltd., and having a nucleotide sequence shown in SEQ ID NO: 2) from a plate culture medium, wherein the E.coli DH5 α is purchased from Shanghai Biotechnology engineering (Shanghai) Ltd., NO.B528413, and the preservation method of PET-28a is carried out according to a method in molecular cloning experimental guidance (Huang Petang et al, China, science publishers, 2002, third edition), inoculating the colony to a 5mL LB liquid culture medium containing antibiotics (the resistance is 50 mu g/mL kanamycin), and carrying out overnight culture at 37 ℃ for 12-16 h;

(2) taking 1-4 mL of overnight culture bacterial liquid, centrifuging at 12000rpm for 2min, and removing supernatant;

(3) suspending the bacterial pellet with 250 μ L Solution I (containing RNase A);

(4) adding 250 mu L of Solution II, slightly turning and mixing the mixture up and down for 5-6 times to ensure that the thalli are fully cracked to form a transparent Solution;

(5) adding 350 mu L of Solution III precooled at 4 ℃, slightly turning and mixing the Solution III up and down for 5 to 6 times until compact aggregates are formed, and then standing the aggregates for 2min at room temperature;

(6) centrifuging at 12000rpm for 10min at room temperature, and collecting supernatant;

(7) placing Spin Column in the kit on the Collection Tube;

(8) transferring the supernatant obtained in the step (6) into Spin Column, centrifuging at 12000rpm for 1min, and removing the filtrate;

(9) adding 500 mu L of Buffer WA into Spin Column, centrifuging at 12000rpm for 1min, and removing the filtrate;

(10) adding 700 mu L of Buffer WB into Spin Column, centrifuging at 12000rpm for 1min, and removing the filtrate;

(11) repeating the operation step (10);

(12) placing Spin Column on Collection Tube again, centrifuging at 12000rpm for 1min, and removing residual lotion;

(13) placing Spin Column on a new centrifuge tube of 1.5mL, adding 30-50 μ L of 65 ℃ sterilized water at the center of the Spin Column membrane, and standing at room temperature for 1 min;

(14) centrifuging at 12000rpm for 1min to elute DNA;

(15) and carrying out agarose gel electrophoresis verification on the extracted plasmid PET-28a, and calculating the concentration.

Fourthly, the plasmid PET28a is double digested by restriction enzymes Nco I and Xba I

TABLE 2 enzymatic hydrolysis System

Fifthly, connecting the target gene fimH and the plasmid PET28a after double enzyme digestion to obtain a recombinant plasmid PET28a + fimH

One-step cloning kit using Novozan

The following reaction systems were prepared in an ice-water bath, see table 3.

TABLE 3 enzyme Linked systems

Sixthly, the recombinant plasmid PET28a + fimH is transformed into E.coli DH5 α

(1) A tube of 200. mu.L E.coli DH5 α competent cell (No. B528413, Shanghai Biotechnology engineering, Ltd.) suspension was taken out of a-80 ℃ refrigerator, thawed at room temperature, and immediately placed on ice after thawing;

(2) adding the recombinant plasmid PET-28a + fimH solution obtained in the fifth step into E.coli DH5 α competent cell suspension, shaking up gently, and standing on ice for 30 min;

(3) heating in 42 deg.C water bath for 90s, immediately cooling on ice for 5 min;

(4) adding 1mL LB liquid culture medium, mixing, and shake culturing at 37 deg.C for 40min to recover normal growth state of thallus;

(5) shaking the bacterial solution uniformly, coating 100 mu L of the bacterial solution on an LB resistance plate, inverting a culture dish, and culturing for 12 hours in a constant-temperature incubator at 37 ℃;

the formula of the LB resistant plate is as follows: 10g/L of sodium chloride, 10g/L of tryptone, 5g/L of yeast powder and 20g/L of agar powder, sterilizing for 20min at 121 ℃, cooling and adding kanamycin to the final concentration of 50 mu g/mL.

(6) Picking single colony from the resistant plate, preserving bacteria, extracting plasmid PET-28a + fimH according to the third step, carrying out agarose gel electrophoresis verification and sequencing verification on the extracted plasmid PET-28a + fimH, and obtaining a correct result, wherein the result is shown in figure 3, the map of the plasmid PET-28a + fimH is shown in figure 4, and the nucleotide sequence is shown in SEQ ID NO: 3.

seventhly, the recombinant plasmid PET-28a + fimH is transformed into the original escherichia coli

And (3) transforming the correctly verified recombinant plasmid PET-28a + fimH into competent cells of the original strain CIBTS1688 according to the sixth step, picking a single colony, extracting the plasmid according to the third step, and performing sequencing verification to obtain the constructed recombinant Escherichia coli CIBTS1688 fimH.

Wherein, the competent cells of the CIBTS1688 are prepared by the following steps:

(1) transferring 500 μ L of fresh overnight CIBTS1688 cell culture solution obtained by step-glycerol activation to 50mL LB liquid medium, shaking at 37 deg.C for 3h (shaking table 200r/min), and measuring OD₆₀₀About 0.8-1.0;

(2) transferring 1.5mL of the bacterial culture solution into a centrifugal tube precooled by ice under the aseptic condition, and placing the centrifugal tube on the ice for 10 min;

(3) then centrifuging for 10min at the temperature of 4 ℃ at 4000 r/min;

(4) discarding supernatant, and inverting the centrifuge tube for 1min to drain off residual culture solution;

(5) adding 150 μ L of ice pre-cooled 0.1M CaCl₂Resuspending the cells in the aqueous solution, combining the two tubes, and carrying out ice bath for 10 min;

(6) then centrifuging for 10min at the temperature of 4 ℃ at 4000 r/min;

(7) discarding the supernatant, and inverting the centrifuge tube for 1min to drain the residual trace culture solution;

(8) first, 800. mu.L of ice-precooled 0.1M CaCl was added₂The aqueous solution was used to resuspend the cells, 25. mu.L of pre-cooled 30% v/v glycerol was added, and the cells were aliquoted and stored at-80 ℃ until use.

Example 2

(1) Adding 100 μ L of glycerobacteria CIBTS1688 and CIBTS1688fimH into sterilized 5mL LB liquid culture medium for overnight culture, and activating;

(2) then diluted according to the ratio of 1:100, and slowly shaken at 37 ℃ for 5h to enable the logarithmic phase OD to be reached₆₀₀0.8-1.0；

(3) 2mL of the bacterial solution was taken in OD₆₀₀Measuring the light absorption value, diluting the bacteria solution with sterilized distilled water to obtain diluted bacteria solution OD₆₀₀Is 0.01;

(4) adding 200 mu L of bacterial liquid into a 96-well plate, taking an LB liquid culture medium as a reference, and culturing at 37 ℃ for 24 h;

(5) pouring out the 96-pore plate bacterial liquid, buffering for 3 times by using pure water, and patting dry;

(6) adding 200 μ L of 1% crystal violet solution into 96-well plate, dyeing for 10min, washing with tap water, and air drying;

(7) adding 33% glacial acetic acid 200 μ L into 96-well plate, dissolving, and gently shaking to obtain OD₆₀₀Measuring the biofilm yield, and taking an average value: the OD value of CIBTS1688 cultured in a 96-well plate for 24h is 1.9-2.1, the OD value of CIBTS1688fimH cultured in the 96-well plate for 24h is 2.6-2.7, and the electron microscope images of the biological membrane are respectively shown in figure 5 and figure 6.

Example 3

(1) Inoculating 10 μ L of CIBTS1688 and modified CIBTS1688fimH glycerol bacteria in 5mL LB liquid culture medium, culturing at 37 deg.C and 200rpm overnight;

(2) inoculating the bacterial liquid obtained in the step (1) into 50mL LB liquid culture medium according to the volume ratio of 1:10, culturing at 37 ℃ and 200rpm for 2h until the bacterial liquid concentration reaches OD₆₀₀About 1.0;

(3) inoculating the bacterial liquid into a fermentation culture medium according to the volume ratio of 5%, fermenting at 37 ℃ at 200-250 rpm, finishing the reaction after the glucose is exhausted, and measuring the content of L-threonine in the fermentation liquid by using a high performance liquid chromatograph, wherein the results are shown in table 5 and fig. 7.

The formula of the fermentation medium is as follows: 33g/L of glucose monohydrate, 0.8g/L of sodium chloride, 22g/L of ammonium sulfate, 2.65g/L of dipotassium phosphate trihydrate, 0.8g/L of magnesium sulfate heptahydrate, 0.02g/L of anhydrous copper sulfate, 0.02g/L of ferric sulfate heptahydrate, 0.002g/L of thiamine hydrochloride, 1.0g/L of yeast powder, 30g/L of calcium carbonate and pH 7.2.

The HPLC detection method comprises the following steps:

chromatographic conditions are as follows: sepax AA special column, 4.6 × 150mm, detection wavelength 254nm, column temperature: the sample size was 5. mu.L at 36 ℃.

Preparing a derivative: triethylamine acetonitrile solution: taking 1.4mL of triethylamine, adding 2mL of acetonitrile, and uniformly mixing;

phenyl isothiocyanate acetonitrile solution: adding 2mL of acetonitrile into 25 mu L of phenyl isothiocyanate and mixing uniformly.

Mobile phase A: 15.2g of sodium acetate was weighed, 1850mL of water was added, and after dissolution, the pH was adjusted to 6.5 with glacial acetic acid.

Mobile phase B: 80% acetonitrile (v/v);

flow rate: 0.8mL/min, and data acquisition time of 50 min.

Table 4 shows HPLC gradient elution procedure

Table 5 shows the L-threonine production by genetically engineered bacteria

Note: the number of the flora is determined after the fermentation is stable, the yield of threonine fermented for 36h by the CIBTS1688 reaches a stable and highest value, the sugar consumption is finished, the yield of threonine fermented for 32h by the CIBTS1688fimH reaches a stable and highest value, and the sugar consumption is finished.

Example 4

The procedure is as in example 3, except that the glucose concentration is 100g/L, and the results are shown in Table 6.

Table 6 shows the L-threonine yields of the genetic engineering bacteria at a glucose concentration of 100g/L

Sequence listing

<110> Nanjing university of industry

<120> escherichia coli genetic engineering bacterium and construction method and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>903

<212>DNA

<213>FimH

<400>1

atgaaacgag ttattaccct gtttgctgta ctgctgatgg gctggtcggt aaatgcctgg 60

tcattcgcct gtaaaaccgc caatggtacc gctatcccta ttggcggtgg cagcgccaat 120

gtttatgtaa accttgcgcc cgtcgtgaat gtggggcaaa acctggtcgt ggatctttcg 180

acgcaaatct tttgccataa cgattatccg gaaaccatta cagactatgt cacactgcaa 240

cgaggctcgg cttatggcgg cgtgttatct aatttttccg ggaccgtaaa atatagtggc 300

agtagctatc catttcctac caccagcgaa acgccgcgcg ttgtttataa ttcgagaacg 360

gataagccgt ggccggtggc gctttatttg acgcctgtga gcagtgcggg cggggtggcg 420

attaaagctg gctcattaat tgccgtgctt attttgcgac agaccaacaa ctataacagc 480

gatgatttcc agtttgtgtg gaatatttac gccaataatg atgtggtggt gcctactggc 540

ggctgcgatg tttctgctcg tgatgtcacc gttactctgc cggactaccc tggttcagtg 600

ccaattcctc ttaccgttta ttgtgcgaaa agccaaaacc tggggtatta cctctccggc 660

acaaccgcag atgcgggcaa ctcgattttc accaataccg cgtcgttttc acctgcacag 720

ggcgtcggcg tacagttgac gcgcaacggt acgattattc cagcgaataa cacggtatcg 780

ttaggagcag tagggacttc ggcggtgagt ctgggattaa cggcaaatta tgcacgtacc 840

ggagggcagg tgactgcagg gaatgtgcaa tcgattattg gcgtgacttt tgtttatcaa 900

taa 903

<210>2

<211>5369

<212>DNA

<213>PET-28a

<400>2

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180

cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata 240

tggctgccgc gcggcaccag gccgctgctg tgatgatgat gatgatggct gctgcccatg 300

gtatatctcc ttcttaaagt taaacaaaat tatttctaga ggggaattgt tatccgctca 360

caattcccct atagtgagtc gtattaattt cgcgggatcg agatctcgat cctctacgcc 420

ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc 480

gacatcaccg atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc 540

gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca 600

ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg 660

caggagtcgc ataagggaga gcgtcgagat cccggacacc atcgaatggc gcaaaacctt 720

tcgcggtatg gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc 780

agtaacgtta tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt 840

ggtgaaccag gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc 900

ggagctgaat tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct 960

gattggcgtt gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat 1020

taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg 1080

cgtcgaagcc tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat 1140

cattaactat ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt 1200

tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca 1260

tgaagacggt acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc 1320

gctgttagcg ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa 1380

atatctcact cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat 1440

gtccggtttt caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct 1500

ggttgccaac gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg 1560

cgttggtgcg gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat 1620

cccgccgtta accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg 1680

cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact 1740

ggtgaaaaga aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 1800

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 1860

acgcaattaa tgtaagttag ctcactcatt aggcaccggg atctcgaccg atgcccttga 1920

gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac 1980

ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca 2040

ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat 2100

tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg 2160

gcgagaagca ggccattatc gccggcatgg cggccccacg ggtgcgcatg atcgtgctcc 2220

tgtcgttgag gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac 2280

cgatacgcga gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa 2340

catgaatggt cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct 2400

gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta 2460

catctgtatt aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca 2520

tccataccgc cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag 2580

taacccgtat cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa 2640

atccccctta cacggaggca tcagtgacca aacaggaaaa aaccgccctt aacatggccc 2700

gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg 2760

aacaggcaga catctgtgaa tcgcttcacg accacgctga tgagctttac cgcagctgcc 2820

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2880

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2940

ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 3000

gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa 3060

ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc 3120

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3180

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3240

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 3300

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 3360

ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 3420

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 3480

agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 3540

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3600

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 3660

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 3720

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 3780

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 3840

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3900

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgaa caataaaact 3960

gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc 4020

ttgctctagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc 4080

tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc 4140

gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat 4200

ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg 4260

tactcctgat gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt 4320

attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg 4380

ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct 4440

cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga 4500

gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc 4560

accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg 4620

gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct 4680

tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca 4740

aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga 4800

gtttttctaa gaattaattc atgagcggat acatatttga atgtatttag aaaaataaac 4860

aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgaaattgta aacgttaata 4920

ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 4980

aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 5040

cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 5100

ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 5160

cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 5220

ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 5280

gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 5340

cgccgctaca gggcgcgtcc cattcgcca 5369

<210>3

<211>6227

<212>DNA

<213>PET-28a+fimH

<400>3

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180

cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata 240

tggctgccgc gcggcaccag gccgctgctg tgatgatgat gatgatggct gctgcttatt 300

gataaacaaa agtcacgcca ataatcgatt gcacattccc tgcagtcacc tgccctccgg 360

tacgtgcata atttgccgtt aatcccagac tcaccgccga agtccctact gctcctaacg 420

ataccgtgtt attcgctgga ataatcgtac cgttgcgcgt caactgtacg ccgacgccct 480

gtgcaggtga aaacgacgcg gtattggtga aaatcgagtt gcccgcatct gcggttgtgc 540

cggagaggta ataccccagg ttttggcttt tcgcacaata aacggtaaga ggaattggca 600

ctgaaccagg gtagtccggc agagtaacgg tgacatcacg agcagaaaca tcgcagccgc 660

cagtaggcac caccacatca ttattggcgt aaatattcca cacaaactgg aaatcatcgc 720

tgttatagtt gttggtctgt cgcaaaataa gcacggcaat taatgagcca gctttaatcg 780

ccaccccgcc cgcactgctc acaggcgtca aataaagcgc caccggccac ggcttatccg 840

ttctcgaatt ataaacaacg cgcggcgttt cgctggtggt aggaaatgga tagctactgc 900

cactatattt tacggtcccg gaaaaattag ataacacgcc gccataagcc gagcctcgtt 960

gcagtgtgac atagtctgta atggtttccg gataatcgtt atggcaaaag atttgcgtcg 1020

aaagatccac gaccaggttt tgccccacat tcacgacggg cgcaaggttt acataaacat 1080

tggcgctgcc accgccaata gggatagcgg taccattggc ggttttacag gcgaatgacc 1140

aggcatttac cgaccagccc atcagcagta cagcaaacag ggtaataact cgtttcatgg 1200

ggaattgtta tccgctcaca attcccctat agtgagtcgt attaatttcg cgggatcgag 1260

atctcgatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt 1320

gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc 1380

atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc 1440

gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta 1500

ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgagatcc cggacaccat 1560

cgaatggcgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga gtcaattcag 1620

ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta 1680

tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa 1740

agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc 1800

gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc 1860

gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc 1920

gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca 1980

acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga 2040

agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa 2100

cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt 2160

gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcggcgcgtctgcg 2220

tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga 2280

aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat 2340

cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat 2400

taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg acgataccga 2460

agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg 2520

gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca 2580

gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc 2640

ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga 2700

aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag gcaccgggat 2760

ctcgaccgat gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca 2820

tgactatcgt cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc 2880

cggcagcgct ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg 2940

gcctgtcgct tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc 3000

ccgccaccaa acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccccacggg 3060

tgcgcatgat cgtgctcctg tcgttgagga cccggctagg ctggcggggt tgccttactg 3120

gttagcagaa tgaatcaccg atacgcgagc gaacgtgaag cgactgctgc tgcaaaacgt 3180

ctgcgacctg agcaacaaca tgaatggtct tcggtttccg tgtttcgtaa agtctggaaa 3240

cgcggaagtc agcgccctgc accattatgt tccggatctg catcgcagga tgctgctggc 3300

taccctgtgg aacacctaca tctgtattaa cgaagcgctg gcattgaccc tgagtgattt 3360

ttctctggtc ccgccgcatc cataccgcca gttgtttacc ctcacaacgt tccagtaacc 3420

gggcatgttc atcatcagta acccgtatcg tgagcatcct ctctcgtttc atcggtatca 3480

ttacccccat gaacagaaat cccccttaca cggaggcatc agtgaccaaa caggaaaaaa 3540

ccgcccttaa catggcccgc tttatcagaa gccagacatt aacgcttctg gagaaactca 3600

acgagctgga cgcggatgaa caggcagaca tctgtgaatc gcttcacgac cacgctgatg 3660

agctttaccg cagctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc 3720

agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc 3780

agggcgcgtc agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg 3840

atagcggagt gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca 3900

ccatatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc 3960

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 4020

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 4080

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 4140

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 4200

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 4260

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 4320

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 4380

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 4440

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 4500

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 4560

cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 4620

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 4680

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 4740

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 4800

gtcatgaaca ataaaactgt ctgcttacat aaacagtaat acaaggggtg ttatgagcca 4860

tattcaacgg gaaacgtctt gctctaggcc gcgattaaat tccaacatgg atgctgattt 4920

atatgggtat aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgatt 4980

gtatgggaag cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa 5040

tgatgttaca gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac 5100

catcaagcat tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg 5160

gaaaacagca ttccaggtat tagaagaata tcctgattca ggtgaaaata ttgttgatgc 5220

gctggcagtg ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag 5280

cgatcgcgta tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc 5340

gagtgatttt gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca 5400

taaacttttg ccattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa 5460

ccttattttt gacgagggga aattaatagg ttgtattgat gttggacgag tcggaatcgc 5520

agaccgatac caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt 5580

acagaaacgg ctttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt 5640

tcatttgatg ctcgatgagt ttttctaaga attaattcat gagcggatac atatttgaat 5700

gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 5760

aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat 5820

tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga 5880

tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca 5940

acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct 6000

aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc 6060

cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag 6120

cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca 6180

cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgcca 6227

Claims

1. The application of the escherichia coli genetic engineering bacteria in fermentation production of L-threonine is characterized in that the escherichia coli genetic engineering bacteria are obtained by introducing recombinant plasmids carrying fimH genes into original escherichia coli.

2. The use according to claim 1, wherein the original E.coli strain is CCTCC NO: M2015233.

3. The use according to claim 1, wherein the recombinant plasmid is a PET-28a plasmid carrying the fimH gene.

4. The use of any one of claims 1 to 3, wherein the construction method of the Escherichia coli genetically engineered bacteria comprises the following steps:

(1) extracting the original genome of the escherichia coli;

5. The use of claim 4, wherein the primers used in the PCR of step (2) are as follows:

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA。

6. use according to claim 1, characterized in that the fermentation conditions are as follows: the fermentation temperature is 25-37 ℃, and the fermentation time is 30-32 h.