CN108531439A

CN108531439A - A kind of Recombinant organism and its construction method and application

Info

Publication number: CN108531439A
Application number: CN201810336575.9A
Authority: CN
Inventors: 应汉杰; 刘娜; 陈勇; 任培芳; 余斌; 杨乐云; 孙文俊; 奚迅
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2018-04-16
Filing date: 2018-04-16
Publication date: 2018-09-14
Anticipated expiration: 2038-04-16
Also published as: CN108531439B

Abstract

The invention discloses a kind of Recombinant organism, the recombinant plasmid for carrying fimH genes has been imported.The invention also discloses the construction methods of genetic engineering bacterium.The present invention further discloses application of the genetic engineering bacterium in fermenting and producing L threonines.The present invention is overexpressed the Recombinant organism of fimH genes by structure, make Escherichia coli biomembrane output increased during L threonines are produced in fermentation, and adhesion increases, Microflora increases, the yield of L threonines and sugared conversion ratio are improved, fermentation period is shortened.

Description

A kind of Recombinant organism and its construction method and application

Technical field

The present invention relates to L-threonine fermentations, and in particular to a kind of Recombinant organism and its construction method with answer With.

Background technology

L-threonine be detached and identified from fibrin hydrolysate by W.C.Rose nineteen thirty-fives Lai a kind of ammonia Base acid, has been demonstrated that it is the essential amino acid being finally found, human body itself cannot synthesize, it is necessary to be absorbed from food.L- revives Propylhomoserin is widely used in feed industry, health food and medical industry as food additives, since the effect of L-threonine is wide General, the market demand rapid growth of global threonine, the market of the following threonine will quickly increase in recent years, the need of threonine The amount of asking also will constantly increase.

The preparation method of L-threonine mainly has protein Hydrolyze method, chemical synthesis, microbe fermentation method, microorganism hair The advantages that ferment method, which has, to economize on resources, at low cost, and environmental pollution is small, has been widely used in L-threonine production.With existing Generation social technique for gene engineering it is like flying push ahead vigorously, industrial microorganism and industrial technology application demand amount increase, especially industrial micro- The structure of bio-carrier system produces the screening of bacterial strain for excellent L-threonine and the raising of acid yield provides reliable skill Art guarantee makes microorganism direct fermentation production L-threonine become a kind of cheap industrialized preparing process.At this stage can The microorganism of production threonine has Escherichia, corynebacterium, Serratia etc..It is now general that Escherichia coli produce threonine All over applying in Fermentation Experiment, its advantage is that culture propagation is fast, fermentation period is short, it is at low cost the features such as, but relative to The demand of amino acid industry, although stable yield increases, speed or slow.

Invention content

Goal of the invention：In order to solve low output when existing Escherichia coli fermentation produces L-threonine, fermentation period length is asked Topic, the present invention provides a kind of Recombinant organisms, and invention further provides the bacillus coli gene engineerings The construction method of bacterium, the present invention further provide the Recombinant organism in production of L-threonine by fermentation Application.

Technical solution：A kind of Recombinant organism of the present invention has imported the recombination for carrying fimH genes Plasmid.For the present invention from medical domain, the formation of most of bacterium infection and biomembrane is closely bound up, uses and subtracts in medicine The formation of few biomembrane reduces the infection of bacterium；Present invention firstly provides the biofilm biomasses by increasing Escherichia coli to increase The adhesiveness of Escherichia coli can be adhered to inanimate surfaces, improve L-threonine during production of L-threonine by fermentation Yield and fermentation period.

Wherein, the original Escherichia coli are CCTCC NO:M 2015233；The recombinant plasmid is to carry fimH genes PET-28a plasmids.

The present invention further provides the construction method of the Recombinant organism, includes the following steps：

(1) genome of original Escherichia coli is extracted；

(2) genome obtained using step (1) extraction expands fimH genes as template using round pcr；

(3) the fimH genes for obtaining step (2) are inserted between I/Xba of Nco, I restriction enzyme sites of PET-28a plasmids, are taken Recombinant plasmid with fimH genes；

(4) in the recombinant plasmid transformed for obtaining step (3) to the competent cell of E.coli DH5 α, from E.coliDH5 Recombinant plasmid is extracted in α；

(5) to get big in the recombinant plasmid transformed to the competent cell of original Escherichia coli for obtaining step (4) extraction Enterobacteria genetic engineering bacterium.

Wherein, original Escherichia coli described in step (1) are given from Shanghai Inst. of Life Science, CAS, described big Enterobacteria patent applied for 201510199036.1 has simultaneously carried out preservation, and deposit number is CCTCC NO:M 2015233, bacterial strain Number be CIBTS1688.

Wherein, the primer that PCR is used described in step (2) is as follows：

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA.

The present invention further provides application of the Recombinant organism in production of L-threonine by fermentation.

Wherein, fermentation condition is as follows：Fermentation temperature is 25~37 DEG C, and fermentation time is 30~32h.

Advantageous effect：The present invention is overexpressed the Recombinant organism of fimH genes by structure, makes Escherichia coli Biomembrane output increased during L-threonine is produced in fermentation, adhesion increase, and Microflora increases, and improves L-threonine Yield and sugared conversion ratio, shorten fermentation period.

Description of the drawings

Fig. 1 is the electrophoretogram of original genome of E.coli；

Fig. 2 is the electrophoretogram of fimH genes；

Fig. 3 is the electrophoretogram of recombinant plasmid；

Fig. 4 is the collection of illustrative plates of recombinant plasmid；

Fig. 5 is the biomembrane electron microscope of bacterial strain CIBTS1688；

Fig. 6 is the biomembrane electron microscope of bacterial strain CIBTS1688fimH*；

Fig. 7 is the fermentation results of bacterial strain CIBTS1688 and bacterial strain CIBTS1688fimH*.

Specific implementation mode

Embodiment 1

One, original Escherichia coli CIBTS1688 genomes are extracted

Kit (the takara minibest bacteria genomic of bacterial genomes are extracted using takara companies DNA extractionkit ver.3.0)

(1) glycerol stock activates：10 μ L original strain CIBTS1688+5mL LB liquid mediums, are incubated overnight；

Wherein, LB liquid medium formula is as follows：Sodium chloride 10g/L, tryptone 10g/L, yeast powder 5g/L, 121 DEG C, Sterilize 20min；

(2) 1.5mL centrifuge tubes is used to collect bacterium solution (per 1.5mL centrifuge tube dress 1.2mL bacterium solutions), 12000rpm centrifuges 2min, Abandon supernatant；

(3) buffer GL of 180 μ L, the Proteinase K (20mg/ of 20 μ L are added in the thalline obtained to step (2) ML) and the RNase A of 10 μ L (10mg/mL) fully vibrate mixing, and in 56 DEG C of water-bath warm bath 10min, solution is transparent, clear at this time Clear shape；

(4) absolute ethyl alcohol of the buffer GB and 200 μ L of 200 μ L are added in the system obtained to step (3), fully inhales Beat mixing；

(5) Spin Column are mounted on Collection Tube, the solution that step (4) obtains moves to Spin In Column, 12000rpm centrifuges 2min, abandons filtrate；

(6) the Buffer WA of 500 μ L are added into Spin Column, 12000rpm centrifuges 1min, abandons filtrate；

(7) the Buffer WB of 700 μ L are added into Spin Column, 12000rpm centrifuges 1min, abandons filtrate；

(8) Buffer WB are added along Spin Column tube wall surroundings, help to rinse the salt attached on tube wall completely；

(9) repetitive operation step (8)；

(10) Spin Column are placed on Collection Tube, 12000rpm centrifuges 2min；

(11) Spin Column are placed on new 1.5mL centrifuge tubes, are added in the centre of Spin Column films The aqua sterilisa or Elution Buffer of 50~200 μ L, is stored at room temperature 5min；Wherein, aqua sterilisa is heated to 65 DEG C of uses has Conducive to raising elution efficiency；

(12) and then 12000rpm centrifuges 2min eluted dnas.If you need to obtain bigger receipts amount, can will be rejoined from lower liquid The center of Spin Column films or the aqua sterilisa for adding 50~200 μ L, after being stored at room temperature 5min, 12000rpm centrifuges 2min The electrophoretogram of eluted dna, original e. coli dna is shown in Fig. 1.

Two, with round pcr amplifying target genes fimH

(1) DNA obtained using step 1 is template, and with round pcr amplifying target genes fimH, reaction system is shown in Table 1；

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA

1 PCR reaction systems of table

Electrophoresis, knot are carried out to above-mentioned PCR product (fimH genetic fragments) using 0.8% (0.8g/100mL) Ago-Gel Fruit sees Fig. 2.

(2) glue recovery purifying segment fimH

Use takara kits (TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0)

2.1 make Ago-Gels using tbe buffer liquids, then to target fragment fimH into row agarose gel electrophoresis；

2.2 cut out the Ago-Gel containing target fragment fimH in the UV lamp, and surface liquid is exhausted with paper handkerchief；

2.3 chopping blob of viscoses, weigh blob of viscose weight.When calculating volume, calculated with 1mg=1 μ L；

2.4 are added lysate Buffer GM, Buffer GM dosages into blob of viscose did not had blob of viscose, after evenly mixing room 15~25 DEG C of dissolving blob of viscoses of temperature, should be interrupted oscillation mixing, blob of viscose is made fully to dissolve at this time；

2.5 are placed in the Spin Colum in kit on Collection Tube；

2.6 are transferred to the solution that step 2.4 obtains in Spin Column, and 12 00000rpm centrifuge 1min, abandon filtrate；

2.7 the Buffer WB of 700 μ L are added in Spin Column, and room temperature 12000rpm centrifuges 1min, abandons filtrate；

2.8 repetitive operation steps 2.7；

2.9 are placed in Spin Column on Collection Tube, and room temperature 12000rpm centrifuges 1min, abandons filtrate；

2.10 are placed in Spin Column on the centrifuge tube of new 1.5mL, add in the centre of Spin Column films Enter 30 μ L aqua sterilisas, is stored at room temperature 1min；

2.11 room temperature 12000rpm centrifugations 1min elute fimH segments；

2.12 pairs of fimH target fragments after purification are verified into row agarose gel electrophoresis, calculate concentration；Wherein fimH bases The nucleotide sequence of cause is shown in SEQ ID NO：1.

Three, extraction plasmid PET-28a

It utilizes takara kits (TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0)

(1) E.coli DH5 α single bacterium colonies are selected from plating medium (to include PET-28a, from Ke Lei biotechnologies have Limit company, nucleotide sequence are shown in SEQ ID NO：2), wherein E.coli DH5 α give birth to work bioengineering (Shanghai) stock purchased from Shanghai Part Co., Ltd, the store method of NO.B528413, PET-28a refer to according to《Molecular Cloning:A Laboratory guide》(Huang Peitang etc. is translated, China, Science Press, 2002, the third edition) in method carry out；Then the LB Liquid Cultures containing antibiotic of 5mL are seeded to In base (resistance is 50 μ g/mL of kanamycins), 37 DEG C are incubated overnight 12~16h；

(2) bacterium solution that is incubated overnight of 1~4mL, 12000rpm is taken to centrifuge 2min, abandon supernatant；

(3) with the Solution I (A containing RNase) of 250 μ L fully suspended bacterial precipitations；

(4) Solution II that 250 μ L are added gently spins upside down mixing 5~6 times, and thalline is made fully to crack, and is formed saturating Bright solution；

(5) Solution III of 4 DEG C of precoolings of 350 μ L is added, gently spins upside down mixing 5~6 times, until forming consolidation It is aggregated block, is then stored at room temperature 2min；

(6) room temperature 12000rpm centrifuges 10min, takes supernatant；

(7) the Spin Column in kit are placed on Collection Tube；

(8) supernatant that step (6) obtains is transferred in Spin Column, 12000rpm centrifuges 1min, abandons filtrate；

(9) the Buffer WA of 500 μ L are added in Spin Column, 12000rpm centrifuges 1min, abandons filtrate；

(10) the Buffer WB of 700 μ L are added in Spin Column, 12000rpm centrifuges 1min, abandons filtrate；

(11) repetitive operation step (10)；

(12) Spin Column are placed on Collection Tube again, 12000rpm centrifuges 1min, eliminates residual Stay washing lotion；

(13) Spin Column are placed on the centrifuge tube of new 1.5mL, are added in the centre of Spin Column films 65 DEG C of aqua sterilisas for entering 30~50 μ L, are stored at room temperature 1min；

(14) 12000rpm centrifuges 1min eluted dnas；

(15) the plasmid PET-28a after extraction is verified into row agarose gel electrophoresis, calculates concentration.

Four, I double digestion plasmid PET28a of restriction enzyme Nco I and Xba is utilized

2 enzymatic hydrolysis system of table

Five, plasmid PET28a obtains recombinant plasmid PET28a+fimH after connecting target gene fimH and double digestion

One-step cloning kit is only praised using promiseIt is formulated as follows reaction system in ice-water bath, sees Table 3.

3 enzyme disjunctor system of table

Six, recombinant plasmid PET28a+fimH is transformed into E.coli DH5 α

(1) 200 μ L E.coli DH5 α competent cells of a pipe are taken out from -80 DEG C of refrigerators (gives birth to work bioengineering in Shanghai (Shanghai) limited liability company NO.B528413)) suspension, thaws, is immediately placed on ice after defrosting at room temperature；

(2) it is outstanding in E.coli DH5 α competent cells that the recombinant plasmid PET-28a+fimH solution that step 5 obtains is added It in liquid, gently shakes up, places 30min on ice；

(3) 42 DEG C of water-bath heat shock 90s, are immediately placed on cooled on ice 5min；

(4) after the LB liquid medium mixing of 1mL being added, 37 DEG C of shaken cultivation 40min make thalline restore normal growth shape State；

(5) it takes 100 μ L to be coated on LB resistance plates after shaking up above-mentioned bacterium solution, is inverted culture dish, 37 DEG C of constant incubator trainings Support 12h；

The formula of wherein LB resistances plate is as follows：Sodium chloride 10g/L, tryptone 10g/L, yeast powder 5g/L, agar powder 20g/L, 121 DEG C of sterilizing 20min, adds kanamycins to final concentration of 50 μ g/mL after cooling.

(6) from picking single bacterium colony on resistance plate, after protecting bacterium, plasmid PET-28a+fimH is extracted by step 3, after extraction Plasmid PET-28a+fimH into row agarose gel electrophoresis verify and sequence verification as a result correctly see Fig. 3, plasmid PET-28a The collection of illustrative plates of+fimH is shown in that Fig. 4, nucleotide sequence are shown in SEQ ID NO：3.

Seven, recombinant plasmid PET-28a+fimH is transformed into original Escherichia coli

Correct recombinant plasmid PET-28a+fimH will be verified according to step 6 and is transformed into the sense of original strain CIBTS1688 In by state cell, picking single bacterium colony carries out sequence verification, the recombination bacillus coli built by step 3 extraction plasmid CIBTS1688fimH*。

Wherein, the competent cell of CIBTS1688 is prepared as follows：

(1) the fresh overnight CIBTS1688 cells bacterium solution that 500 μ L step 1 glycerine activate is gone into 50mL LB In fluid nutrient medium, 3h (shaking table 200r/min) is shaken up in 37 DEG C of oscillations, measures OD₆₀₀=0.8-1.0 or so；

(2) aseptically, 1.5mL inoculums are transferred in the centrifuge tube of ice precooling, are placed on ice 10min；

(3) and then in 4 DEG C of 4000r/min 10min is centrifuged；

(4) liquid is discarded supernatant, centrifuge tube is inverted 1min, residual culture solution is made to flow to end；

(5) respectively add the 0.1M CaCl of 150 μ L ice precooling₂Cell is resuspended in aqueous solution, merges two pipes, ice bath 10min；

(6) and then in 4 DEG C of 4000r/min 10min is centrifuged；

(7) liquid is discarded supernatant, centrifuge tube is inverted 1min, remaining trace culture solution is made to flow to end；

(8) the 0.1M CaCl of 800 μ L ice precooling are first added₂Cell is resuspended in aqueous solution, adds the 30%v/ of 25 μ L precoolings It is spare to be sub-packed in -80 DEG C of storages later for the glycerine of v.

Embodiment 2

(1) respectively take 100 μ L glycerol bacterium CIBTS1688 and CIBTS1688fimH* that the 5mL LB liquid mediums of sterilizing are added In be incubated overnight, activate；

(2) and then by 1:100 dilutions, 37 DEG C are shaken 5h slowly, reach logarithmic phase OD₆₀₀0.8-1.0；

(3) take 2mL bacterium solutions in OD₆₀₀Lower measurement light absorption value dilutes bacterium solution so that bacterium solution after dilution with the distilled water of sterilizing OD₆₀₀It is 0.01；

(4) take 200 μ L bacterium solutions that 96 orifice plates are added, LB liquid medium compares, and 37 DEG C of cultures are for 24 hours；

(5) 96 orifice plate bacterium solutions are poured out, is buffered 3 times, is patted dry with pure water；

(6) it takes 1% crystal violet solution, 200 μ L that 96 orifice plates are added, dyes 10min, tap water is rinsed, dried；

(7) it after taking 33% glacial acetic acid, 200 μ L that the dissolving of 96 orifice plates is added, gently vibrates, OD₆₀₀Biomembrane yield is measured, is made even Mean value：In 96 orifice plate cultures, OD values are 1.9-2.1 to CIBTS1688 for 24 hours, and CIBTS1688fimH* is in 96 orifice plate cultures OD for 24 hours Value is 2.6-2.7, and biomembrane electron microscope is shown in Fig. 5 and Fig. 6 respectively.

Embodiment 3

(1) CIBTS1688fimH* glycerol stocks are inoculated in 5mL LB liquid mediums after taking 10 μ L CIBTS1688 and transformation In, 37 DEG C, 200rpm overnight incubations；

(2) by volume 1:10 are inoculated in the bacterium solution that step (1) obtains in the LB liquid medium of 50mL, 37 DEG C, 200rpm cultivates 2h, and bacterial concentration reaches OD₆₀₀=1.0 or so；

(3) bacterium solution is inoculated in fermentation medium by 5% ratio by volume, 37 DEG C, 200~250rpm, fermentation, Portugal Grape sugar reacts after exhausting to be terminated, and the content of L-threonine in zymotic fluid is measured using high performance liquid chromatograph, the results are shown in Table 5, figure 7。

Wherein, fermentative medium formula is as follows：One glucose monohydrate 33g/L, sodium chloride 0.8g/L, ammonium sulfate 22g/L, three Hypophosphite monohydrate hydrogen dipotassium 2.65g/L, epsom salt 0.8g/L, anhydrous cupric sulfate 0.02g/L, green-vitriol 0.02g/L, salt Allithiamine 0.002g/L, yeast powder 1.0g/L, calcium carbonate 30g/L, pH7.2.

Wherein, HPLC detection methods are as follows：

Chromatographic condition：Sepax AA dedicated columns, 4.6*150mm, Detection wavelength 254nm, column temperature：36 DEG C, 5 μ L of sample size.

Derivating agent configures：Triethylamine acetonitrile solution：Triethylamine 1.4mL is taken, acetonitrile 2mL mixings are added；

Phenyl isothiocyanate acetonitrile solution：25 μ L of phenyl isothiocyanate are taken to add acetonitrile 2mL mixings.

Mobile phase A：The sodium acetate for weighing 15.2g adds water 1850mL, with glacial acetic acid tune pH value to 6.5 after dissolving.

Mobile phase B：80% acetonitrile (v/v)；

Flow velocity：0.8mL/min, data acquisition time 50min.

Table 4 is HPLC gradient elution program

Table 5 is the L-threonine yield of genetic engineering bacterium

Note：Microflora is measured after fermentation stability, CIBTS1688 fermentation 36h threonines yield reach stablize and Reach peak, sugar consumption terminates, and CIBTS1688fimH* fermentation 32h production amount of threonine, which reaches, stablizes and reach peak, sugar consumption Terminate.

Embodiment 4

Method the results are shown in Table 6 with embodiment 3 the difference is that concentration of glucose is 100g/L.

The L-threonine yield of table 6 is concentration of glucose when being 100g/L genetic engineering bacterium

Sequence table

<110>Nanjing University of Technology

<120>A kind of Recombinant organism and its construction method and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 903

<212> DNA

<213> FimH

<400> 1

atgaaacgag ttattaccct gtttgctgta ctgctgatgg gctggtcggt aaatgcctgg 60

tcattcgcct gtaaaaccgc caatggtacc gctatcccta ttggcggtgg cagcgccaat 120

gtttatgtaa accttgcgcc cgtcgtgaat gtggggcaaa acctggtcgt ggatctttcg 180

acgcaaatct tttgccataa cgattatccg gaaaccatta cagactatgt cacactgcaa 240

cgaggctcgg cttatggcgg cgtgttatct aatttttccg ggaccgtaaa atatagtggc 300

agtagctatc catttcctac caccagcgaa acgccgcgcg ttgtttataa ttcgagaacg 360

gataagccgt ggccggtggc gctttatttg acgcctgtga gcagtgcggg cggggtggcg 420

attaaagctg gctcattaat tgccgtgctt attttgcgac agaccaacaa ctataacagc 480

gatgatttcc agtttgtgtg gaatatttac gccaataatg atgtggtggt gcctactggc 540

ggctgcgatg tttctgctcg tgatgtcacc gttactctgc cggactaccc tggttcagtg 600

ccaattcctc ttaccgttta ttgtgcgaaa agccaaaacc tggggtatta cctctccggc 660

acaaccgcag atgcgggcaa ctcgattttc accaataccg cgtcgttttc acctgcacag 720

ggcgtcggcg tacagttgac gcgcaacggt acgattattc cagcgaataa cacggtatcg 780

ttaggagcag tagggacttc ggcggtgagt ctgggattaa cggcaaatta tgcacgtacc 840

ggagggcagg tgactgcagg gaatgtgcaa tcgattattg gcgtgacttt tgtttatcaa 900

taa 903

<210> 2

<211> 5369

<212> DNA

<213> PET-28a

<400> 2

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180

cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata 240

tggctgccgc gcggcaccag gccgctgctg tgatgatgat gatgatggct gctgcccatg 300

gtatatctcc ttcttaaagt taaacaaaat tatttctaga ggggaattgt tatccgctca 360

caattcccct atagtgagtc gtattaattt cgcgggatcg agatctcgat cctctacgcc 420

ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc 480

gacatcaccg atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc 540

gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca 600

ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg 660

caggagtcgc ataagggaga gcgtcgagat cccggacacc atcgaatggc gcaaaacctt 720

tcgcggtatg gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc 780

agtaacgtta tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt 840

ggtgaaccag gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc 900

ggagctgaat tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct 960

gattggcgtt gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat 1020

taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg 1080

cgtcgaagcc tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat 1140

cattaactat ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt 1200

tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca 1260

tgaagacggt acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc 1320

gctgttagcg ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa 1380

atatctcact cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat 1440

gtccggtttt caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct 1500

ggttgccaac gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg 1560

cgttggtgcg gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat 1620

cccgccgtta accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg 1680

cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact 1740

ggtgaaaaga aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 1800

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 1860

acgcaattaa tgtaagttag ctcactcatt aggcaccggg atctcgaccg atgcccttga 1920

gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac 1980

ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca 2040

ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat 2100

tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg 2160

gcgagaagca ggccattatc gccggcatgg cggccccacg ggtgcgcatg atcgtgctcc 2220

tgtcgttgag gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac 2280

cgatacgcga gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa 2340

catgaatggt cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct 2400

gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta 2460

catctgtatt aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca 2520

tccataccgc cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag 2580

taacccgtat cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa 2640

atccccctta cacggaggca tcagtgacca aacaggaaaa aaccgccctt aacatggccc 2700

gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg 2760

aacaggcaga catctgtgaa tcgcttcacg accacgctga tgagctttac cgcagctgcc 2820

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2880

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2940

ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 3000

gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa 3060

ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc 3120

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 3180

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 3240

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 3300

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 3360

ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 3420

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 3480

agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 3540

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 3600

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 3660

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 3720

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 3780

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 3840

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3900

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgaa caataaaact 3960

gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc 4020

ttgctctagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc 4080

tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc 4140

gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat 4200

ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg 4260

tactcctgat gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt 4320

attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg 4380

ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct 4440

cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga 4500

gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc 4560

accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg 4620

gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct 4680

tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca 4740

aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga 4800

gtttttctaa gaattaattc atgagcggat acatatttga atgtatttag aaaaataaac 4860

aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgaaattgta aacgttaata 4920

ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 4980

aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 5040

cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 5100

ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 5160

cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 5220

ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 5280

gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 5340

cgccgctaca gggcgcgtcc cattcgcca 5369

<210> 3

<211> 6227

<212> DNA

<213> PET-28a+fimH

<400> 3

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt 180

cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata 240

tggctgccgc gcggcaccag gccgctgctg tgatgatgat gatgatggct gctgcttatt 300

gataaacaaa agtcacgcca ataatcgatt gcacattccc tgcagtcacc tgccctccgg 360

tacgtgcata atttgccgtt aatcccagac tcaccgccga agtccctact gctcctaacg 420

ataccgtgtt attcgctgga ataatcgtac cgttgcgcgt caactgtacg ccgacgccct 480

gtgcaggtga aaacgacgcg gtattggtga aaatcgagtt gcccgcatct gcggttgtgc 540

cggagaggta ataccccagg ttttggcttt tcgcacaata aacggtaaga ggaattggca 600

ctgaaccagg gtagtccggc agagtaacgg tgacatcacg agcagaaaca tcgcagccgc 660

cagtaggcac caccacatca ttattggcgt aaatattcca cacaaactgg aaatcatcgc 720

tgttatagtt gttggtctgt cgcaaaataa gcacggcaat taatgagcca gctttaatcg 780

ccaccccgcc cgcactgctc acaggcgtca aataaagcgc caccggccac ggcttatccg 840

ttctcgaatt ataaacaacg cgcggcgttt cgctggtggt aggaaatgga tagctactgc 900

cactatattt tacggtcccg gaaaaattag ataacacgcc gccataagcc gagcctcgtt 960

gcagtgtgac atagtctgta atggtttccg gataatcgtt atggcaaaag atttgcgtcg 1020

aaagatccac gaccaggttt tgccccacat tcacgacggg cgcaaggttt acataaacat 1080

tggcgctgcc accgccaata gggatagcgg taccattggc ggttttacag gcgaatgacc 1140

aggcatttac cgaccagccc atcagcagta cagcaaacag ggtaataact cgtttcatgg 1200

ggaattgtta tccgctcaca attcccctat agtgagtcgt attaatttcg cgggatcgag 1260

atctcgatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt 1320

gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc 1380

atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc 1440

gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta 1500

ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgagatcc cggacaccat 1560

cgaatggcgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga gtcaattcag 1620

ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta 1680

tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa 1740

agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc 1800

gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc 1860

gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc 1920

gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca 1980

acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga 2040

agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa 2100

cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt 2160

gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg 2220

tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga 2280

aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat 2340

cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat 2400

taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg acgataccga 2460

agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg 2520

gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca 2580

gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc 2640

ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga 2700

aagcgggcag tgagcgcaac gcaattaatg taagttagct cactcattag gcaccgggat 2760

ctcgaccgat gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca 2820

tgactatcgt cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc 2880

cggcagcgct ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg 2940

gcctgtcgct tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc 3000

ccgccaccaa acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccccacggg 3060

tgcgcatgat cgtgctcctg tcgttgagga cccggctagg ctggcggggt tgccttactg 3120

gttagcagaa tgaatcaccg atacgcgagc gaacgtgaag cgactgctgc tgcaaaacgt 3180

ctgcgacctg agcaacaaca tgaatggtct tcggtttccg tgtttcgtaa agtctggaaa 3240

cgcggaagtc agcgccctgc accattatgt tccggatctg catcgcagga tgctgctggc 3300

taccctgtgg aacacctaca tctgtattaa cgaagcgctg gcattgaccc tgagtgattt 3360

ttctctggtc ccgccgcatc cataccgcca gttgtttacc ctcacaacgt tccagtaacc 3420

gggcatgttc atcatcagta acccgtatcg tgagcatcct ctctcgtttc atcggtatca 3480

ttacccccat gaacagaaat cccccttaca cggaggcatc agtgaccaaa caggaaaaaa 3540

ccgcccttaa catggcccgc tttatcagaa gccagacatt aacgcttctg gagaaactca 3600

acgagctgga cgcggatgaa caggcagaca tctgtgaatc gcttcacgac cacgctgatg 3660

agctttaccg cagctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc 3720

agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc 3780

agggcgcgtc agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg 3840

atagcggagt gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca 3900

ccatatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc 3960

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 4020

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 4080

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 4140

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 4200

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 4260

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 4320

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 4380

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 4440

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 4500

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 4560

cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 4620

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 4680

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 4740

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 4800

gtcatgaaca ataaaactgt ctgcttacat aaacagtaat acaaggggtg ttatgagcca 4860

tattcaacgg gaaacgtctt gctctaggcc gcgattaaat tccaacatgg atgctgattt 4920

atatgggtat aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgatt 4980

gtatgggaag cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa 5040

tgatgttaca gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac 5100

catcaagcat tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg 5160

gaaaacagca ttccaggtat tagaagaata tcctgattca ggtgaaaata ttgttgatgc 5220

gctggcagtg ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag 5280

cgatcgcgta tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc 5340

gagtgatttt gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca 5400

taaacttttg ccattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa 5460

ccttattttt gacgagggga aattaatagg ttgtattgat gttggacgag tcggaatcgc 5520

agaccgatac caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt 5580

acagaaacgg ctttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt 5640

tcatttgatg ctcgatgagt ttttctaaga attaattcat gagcggatac atatttgaat 5700

gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 5760

aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat 5820

tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga 5880

tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca 5940

acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct 6000

aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc 6060

cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag 6120

cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca 6180

cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgcca 6227

Claims

1. a kind of Recombinant organism, which is characterized in that original Escherichia coli have imported the recombination for carrying fimH genes Plasmid.

2. a kind of Recombinant organism according to claim 1, which is characterized in that the original Escherichia coli are CCTCC NO:M 2015233。

3. a kind of Recombinant organism according to claim 1, which is characterized in that the recombinant plasmid is to carry The PET-28a plasmids of fimH genes.

4. the construction method of Recombinant organism described in claim 1-3 any one, which is characterized in that including following Step：

(1) genome of original Escherichia coli is extracted；

(3) the fimH genes for obtaining step (2) are inserted between I/Xba of Nco, I restriction enzyme sites of PET-28a plasmids, are carried The recombinant plasmid of fimH genes；

(4) in the recombinant plasmid transformed for obtaining step (3) to the competent cell of E.coli DH5 α, from E.coli DH5 α Extract recombinant plasmid；

(5) to get large intestine bar in the recombinant plasmid transformed to the competent cell of original Escherichia coli for obtaining step (4) extraction Bacterium genetic engineering bacterium.

5. construction method according to claim 4, which is characterized in that original Escherichia coli described in step (1) are CCTCC NO:M 2015233。

6. construction method according to claim 4, which is characterized in that the primer that PCR is used described in step (2) is as follows：

fimH-F：GGATAACAATTCCCCTCTAGAATGAAACGAGTTATTACCCTGTTTGC

fimH-R：GATGATGGCTGCTGCCCATGGTTATTGATAAACAAAAGTCACGCCA.

7. application of the Recombinant organism in production of L-threonine by fermentation described in claim 1-3 any one.

8. application according to claim 7, which is characterized in that fermentation condition is as follows：Fermentation temperature is 25~37 DEG C, fermentation Time is 30~32h.