CN114015678A - Aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41 as well as recombinant strain and application thereof - Google Patents

Abstract

The invention discloses a gene of aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41 and application thereofThe amino acid sequence constructs a recombinant plasmid containing the enzyme coding gene, recombinant Escherichia coli BL21(pET28a-amp0279) and recombinant Bacillus subtilis WB800N (pHT43-amp 0279). The enzyme is heterologously expressed in escherichia coli, purified by a nickel column affinity chromatography method, and the enzymological property of the purified protein is detected by taking Leu-pNA as a substrate. The optimum reaction conditions of the aminopeptidase Amp0279 provided by the invention are that the enzyme activity is stable at 50 ℃, the pH is 8.0, the enzyme activity is stable at 40-55 ℃ and the pH is 6.0-9.0, and 100 mu MCo is added²⁺Then, the specific enzyme activity can reach 35383U/mg, and the method is suitable for industrial fields of feed, food, brewing, medicine and the like.

Description

Aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41 as well as recombinant strain and application thereof

Technical Field

The invention belongs to the field of protein engineering and genetic engineering, and particularly relates to aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41, and a recombinant strain and application thereof.

Background

During food processing processes such as fermentation and aging, proteins can be hydrolyzed into small molecular substances such as polypeptides or amino acids by protease and peptidase, or sensitization epitopes are destroyed, so that sensitization potential is reduced, and the food is more beneficial to human body to take and absorb. Protein hydrolysates are therefore widely used in the food industry. However, the protein hydrolysis process generates bitter peptides, which affect the flavor of food and hinder the popularization of protein hydrolysates. Aminopeptidases (EC 3.4.11.-) are enzymes with debittering effect on protein hydrolysate, and can specifically hydrolyze hydrophobic amino acid residues at the amino terminal of bitter peptide, release one to three amino acids at a time, destroy the structure of bitter peptide and achieve debittering effect. Aminopeptidases are widely present in fungi, animals and plants, are of a wide variety, and are often named subtypes by their localization regions (e.g., cell membrane, cytoplasm). Aminopeptidases can also be classified, like carboxypeptidases, by the active center into serine aminopeptidases, metalloaminopeptidases and cysteine aminopeptidases. More than 70% of aminopeptidases are metalloenzymes, the active center of which contains one or two divalent metal ions, the common metal ion being Zn²⁺、Co²⁺And Mn²⁺Etc., which have a stabilizing effect on the protein structure of the enzyme. Aminopeptidases can also be divided into three classes according to the substrate: one is an aminopeptidase with broad specificity, such as leucyl aminopeptidase, membrane and cytoplasmic alanyl aminopeptidase, and the like; secondly, the specificity of stenosisAminopeptidases of (a), such as aminopeptidase B which prefers basic amino acid substrates, glutamyl-peptidase which prefers acidic amino acid substrates, aspartyl-amido peptidase, cysteinyl-amido peptidase which prefers specific amino acids, methionine-amido peptidase, prolinamido peptidase, etc.; and thirdly, an enzyme for cutting the short peptide with 2-3 amino acids at the amino terminal. Aminopeptidase can be used as flavourzyme for removing bitter taste of polypeptide in food processing processes such as baking, brewing and cheese making; in addition, aminopeptidases can be applied to the synthesis of biological peptides and amino acids and are found to be more efficient than chemical synthesis; moreover, aminopeptidases are capable of hydrolysing organophosphorus compounds and are therefore of nutritional, biological and ecological significance. Currently, there are few commercially available aminopeptidases with a single hydrolysis site. The method for mining the new aminopeptidase has important application and popularization values.

Lysinibacillus sphaericus (Lysinibacillus sphaericus) is a spore-forming gram-positive bacterium. Some strains have specific poisoning effect on mosquitoes or capability of inhibiting pathogenic (true) bacteria and even tumor cells and the like; meanwhile, the genus bacteria has special metabolic synthesis capacity and shows wide application prospects in the fields of vector mosquito biological control, energy utilization, plant protection and the like. The spherical lysine bacillus cannot metabolize sugars. Compared with Bacillus cereus and Bacillus subtilis, the polypeptide has more abundant amino acid transport and metabolism coding genes. And the mosquito-killing toxin protein expressed in the wild strain is dominant, and the yield of other proteins is less. Therefore, it is speculated that the amino acid related protease may have higher activity and meet the metabolic demand of the protease on the amino acid. Therefore, the aminopeptidase-encoding gene of Bacillus lysinibacillus sphaericus can be utilized.

Disclosure of Invention

In order to achieve the aim, the technical scheme provided by the invention is that aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41 has a nucleic acid sequence shown in SEQ ID NO. 1.

And the amino acid sequence is shown as SEQ ID NO. 2.

A recombinant plasmid pHT43-Amp0279 comprising the aminopeptidase Amp0279 coding sequence, wherein: the nucleic acid sequence of the recombinant plasmid pHT43-amp0279 is shown in SEQ ID NO: 4.

And a recombinant strain containing the recombinant plasmid pHT43-amp 0279.

The recombinant strain is Bacillus subtilis WB800N (pHT43-amp0279), and is preserved in China center for type culture Collection with the address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211237, taxonomic nomenclature Bacillus subtilis.

And the application of the recombinant strain in expressing the product aminopeptidase Amp 0279.

And the application of the expression product aminopeptidase Amp0279 in feed, food, brewing or medicine.

A recombinant plasmid pET28a-Amp0279 comprising the coding sequence for aminopeptidase Amp0279, wherein: the nucleic acid sequence of the recombinant plasmid pET28a-amp0279 is shown in SEQ ID NO 3.

And a recombinant strain Escherichia coli BL21(pET28a-amp0279) containing the recombinant plasmid pET28a-amp 0279.

The beneficial effect of this scheme lies in: 1. through means such as bioinformatics prediction, vector construction by genetic engineering technology, biochemical analysis and the like, the aminopeptidase Amp0279 gene sequence derived from the spherical lysine bacillus C3-41 is obtained;

2. constructing an aminopeptidase encoding gene amp0279 derived from the lysinibacillus sphaericus into an escherichia coli expression vector to obtain a recombinant plasmid pHT43-amp0279, and transforming escherichia coli to obtain a recombinant strain BL21(pET28a-amp 0279);

3. after purifying the enzyme expressed by secretion, Leu-pNA is used as a substrate, and the enzymatic property is detected by using a p-nitroaniline method to determine the optimal reaction condition. Finally, the aminopeptidase Amp0279 provided by the invention is determined to belong to a novel Co family of M29²⁺The dependent aminopeptidase has optimum reaction temperature of 50 deg.C, optimum reaction pH of 8.0, stable enzyme activity at 40-55 deg.C and pH of 6.0-9.0, and is added with 100 μ MCo²⁺Then, the specific enzyme activity can reach 35383U/mg, and the method is suitable for useIn the industrial fields of feed, food, brewing, medicine, and the like;

4. meanwhile, in consideration of the complicated, time-consuming and cost-increasing purification and label removal process required by an Escherichia coli expression system, the secretory expression system of aminopeptidase Amp0279 is further developed, and a more excellent recombinant plasmid pHT43-Amp0279 and a recombinant strain Bacillus subtilis WB800N (pHT43-Amp0279) are obtained.

Drawings

FIG. 1Amp0279 amino acid sequence alignment

FIG. 2Amp0279 three-dimensional Structure drawing (SWISS MODEL)

FIG. 3 detection of Amp0279 after purification

FIG. 4Amp0279 optimum temperature analysis

FIG. 5Amp0279 optimum pH analysis

FIG. 6Amp0279 thermal stability analysis

FIG. 7Amp0279 pH stability assay

FIG. 8 Effect of different Metal ions and EDTA on Amp0279 Activity

FIG. 9 different concentrations of Co²⁺Effect on Amp0279 Activity

FIG. 10Western blot for detecting Amp0279 secretion expression in genetically engineered strain WB800N (pHT43-Amp0279)

FIG. 11 detection of secreted Amp0279 crude enzyme activity.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings and examples, and the present invention is not limited to the examples.

The gene encoding aminopeptidase Amp0279 was predicted in the genome of Bacillus lysinibacillus globiformis C3-41: the nucleic acid sequence is shown as SEQ ID NO. 1.

The corresponding amino acid sequence is shown in SEQ ID NO. 2.

Passing amp0279 full gene through primer pair

P6-F:CGCGGATCCATGACGTTTGAAGAAAAATTAC

P6-R:CGCGAGCTCTTAGAAAGCCCAGCTACCT

Amplified from the C3-41 genome, and the amp0279 gene is inserted into an expression vector pET28a through double digestion and connection to construct a recombinant expression plasmid pET28a-amp 0279.

The nucleic acid sequence of the recombinant plasmid pET28a-amp0279 is shown in SEQ ID NO 3. (the sequence of bold letters is the sequence of amp0279 inserted in pET28 a).

The recombinant plasmid is transformed into escherichia coli BL21 competent cells, a positive clone bacterial strain is screened out by a PCR verification method, and the plasmid is extracted for further sequencing verification. This procedure yielded the recombinant strain E.coli BL21(pET28a-amp 0279).

The aminopeptidase Amp0279 producing genetic engineering strain BL21(pET28a-Amp0279) provided by the invention is used for purifying the expressed aminopeptidase by a nickel column affinity chromatography and detecting the enzymological property.

The specific aminopeptidase Amp0279 gene sequence obtaining method, the recombinant plasmid and recombinant strain construction method, the product aminopeptidase Amp0279 property analysis method and the application condition analysis method are as follows:

experimental materials:

1) strains and plasmids: bacillus sphaericus C3-41, Escherichia coli JM109, JM110 and BL21, and Bacillus subtilis WB 800N.

2) Enzymes and kits: restriction enzymes (NEB), Golden Mix (Scirpus), Rapid Tag Master Mix (Vazyme), T4 DNA ligase (NEB); DNA purification Kit (Omega), FastPerure Plasmid Mini Kit (Vazyme), PAGE gel Rapid preparation Kit (10%) (Shanghai Yazyme biomedical science and technology Co., Ltd.), BCA Kit (Takara), protein dye (Biosharp), and protein affinity chromatography Nickel column (Ni-Sepharose TM 6Fast Flow, GE healthcare, US); a tool enzyme (TaKaRa) such as in-fusion ligase; Cycle-Pure Kit and Gel Extraction Kit (Omega Bio-Tek); prestained Protein Ladder 26616 (seimer feishel technologies (china) ltd);

Western(Millipore，USA)。

3) biochemical reagents: isoproyl-beta-D-thiogalactoside (IPTG); kanamycin; chloromycetin

50mM disodium phosphate-citric acid buffer: after preparing 50mM disodium hydrogen phosphate solution, adjusting pH (3.0-5.0) with 0.1M citric acid solution; the 10 XTSST buffer was purchased from Beijing Solaibao Tech Co., Ltd; tryptone (Tryptone), yeast extract was purchased from seimer feishell scientific; SDS, Tris purchased from Beijing Byeldi Biotechnology, Inc.; glycerol, acetic acid, hydrochloric acid, sodium chloride, magnesium chloride and calcium chloride are purchased from national medicine group limited company; Leu-pNA was purchased from SIGMA-ALDRICH; the skimmed milk powder is purchased from Beijing Lei Gen Biotechnology Co.

Solution required by a p-nitroaniline method:

substrate 200mM Leu-pNA: prepared by DMSO, 0.063g Leu-pNA is dissolved in 1250 mu L DMSO, and 50 mu L is subpackaged.

Reaction termination solution: 40% (v/v) glacial acetic acid, 160mL acetic acid, and 400mL of ultra pure water.

Reaction buffer: Tris-HCl pH 8.050 mM, 1.2114g was dissolved in 200mL of ultrapure water.

50mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution: respectively preparing 0.1M disodium hydrogen phosphate solution and sodium dihydrogen phosphate solution, mixing at a certain proportion, adjusting pH to 6.0 and 7.0, adding equal volume of ultrapure water to adjust to concentration of 50mM

50mM Tris-HCl buffer: preparing 50mM Tris solution, adding concentrated hydrochloric acid to adjust pH (8.0-9.0)

50mM glycine-sodium hydroxide buffer: with 50mM glycine solution, adjusting the pH (10.0-11.0) with 5M sodium hydroxide solution

Metal ion solution mother liquor: 10mL of ultrapure water was used for preparation

1M K⁺Solution: 0.7455g of KCl;

100mM Na⁺solution: 0.0584g NaCl;

100mM Mg²⁺solution: 0.2033g MgCl₂·6H₂O；

100mM Ca²⁺Solution: 0.1010g CaCl₂；

100mM Mn²⁺Solution: 0.1258g MnCl₂；

100mM Cu²⁺Solution: 0.1705g CuCl₂·2H₂O；

100mM Zn²⁺Solution: 0.288g of ZnSO₄·7H₂O；

100mM Fe²⁺Solution: 0.278g FeSO₄·7H₂O；

100mM Co²⁺Solution: 0.2379gCoCl₂·6H₂O。

100mM EDTA：0.3722g EDTA。

The experimental procedures in the following examples are conventional unless otherwise specified.

The percentages in the following examples are by mass unless otherwise specified.

Example 1: aminopeptidase Amp0279 Structure and function prediction and Gene sequence acquisition

According to the genome sequence (CP000817) of the Bacillus lysinibacillus globiformis C3-41, the protein Amp0279 encoded by the Amp0279 gene (300199..301428) is predicted to be possibly aminopeptidase. Sequence alignment found the amino acid sequence of Amp0279 to have the highest similarity (51%) to AmpS encoded by bacillus subtilis (see fig. 1). 3D modeling analysis found it to be a dimeric structure with four cobalt ion binding sites, probably belonging to the M29 family (see FIG. 2). FIG. 2 is an Amp 02793D structural MODEL (SWISS-MODEL). Amp0279 is a homodimer. The left side in the figure is chain A, the right side is chain B, 4Co²⁺The active center is marked as a dot. The predicted 6 active sites (GLU 249, GLU 315, HIS 344, TYR 351, HIS 377 and ASP 379) surround two Co on chain A²⁺. Designing primers with enzyme cutting sites BamHI and SacI according to the gene sequence, amplifying the gene from the genome, and purifying.

Example 2: construction of recombinant expression plasmid pET28a-Amp0279 and recombinant bacterium BL21(pET28a-Amp0279) containing aminopeptidase Amp0279 gene

Restriction enzyme BamHI and SacI sites are respectively introduced into the 5 'end and the 3' end of the aminopeptidase Amp0279 gene, the restriction enzymes BamHI and SacI are used for completing double enzyme digestion of the aminopeptidase Amp0279 gene and an Escherichia coli inducible expression vector pET28a, and then the two are connected by using ligase to construct a recombinant expression plasmid pET28a-Amp 0279. The recombinant expression plasmid is transformed into escherichia coli BL21 competent cells, a positive clone strain BL21(pET28a-amp0279) is screened out by a PCR verification method, and plasmid sequencing verification is extracted.

Example 3: purification of aminopeptidase Amp0279 by Nickel column affinity chromatography

The recombinant strain was inoculated into 5mL LB (50. mu.g/mL kanamycin) and cultured overnight at 37 ℃ and 220rpm to obtain a seed solution. Adding the seed solution into fresh LB culture medium (50. mu.g/mL kanamycin) according to the ratio of 1:100, and culturing for about 3h to OD₆₀₀When the concentration is 0.6 to 0.8, IPTG (final concentration of 1mM) is added to the mixture, and the mixture is slowly induced at a low temperature (25 ℃ C., 160rpm) for about 5 hours. The strain was collected by centrifugation (5000g, 10min) and the supernatant was discarded. The thalli is broken by ultrasonic, at 4 ℃, 12000g, the supernatant is kept for protein nickel column affinity chromatography after 30min of centrifugation. After dialysis, protein concentration was measured with BCA kit. A single band of about 55kD was detected by SDS-PAGE to obtain a known concentration of pure aminopeptidase Amp0279 (see FIG. 3 for Amp0279 after purification).

Example 4: property analysis of aminopeptidase Amp0279

The enzyme activity of the aminopeptidase is detected by a p-nitroaniline method, and a substrate used in the method is Leu-pNA. Preparing 800 mu L reaction liquid from 1mM substrate Leu-pNA, 10 ng/mu L Amp0279 and reaction buffer solution, reacting for 1h, adding 200 mu L of 40% (v/v) glacial acetic acid to terminate the reaction, detecting the absorbance at 405nm, and judging the substrate hydrolysis condition and the substrate hydrolysis capacity of the enzyme. The aminopeptidase activity was measured in 50mM Tris-HCl buffer (pH 8.0) at 30-80 ℃ to examine the optimum temperature for the reaction (FIG. 4). Amp0279 aminopeptidase activity was tested under reaction buffer conditions of varying pH (FIG. 5). Through the above detection, the conditions of 50 ℃ and pH8.0 are determined as the optimal conditions. U is defined as the amount of enzyme that hydrolyzes the substrate Leu-pNA at 50 ℃ and pH8.0 to yield 1. mu. mol pNA per minute. The purified enzyme was incubated at different temperatures (40-80 ℃) for 2h and then cooled to room temperature. Residual activity was measured at 50 ℃, ph8.0 and Amp0279 thermal stability was evaluated (fig. 6). The enzyme was incubated with different buffers (pH 5.0-10.0 as described above) at 4 ℃ for 2h, and the residual activity was measured at pH8.0, 50 ℃ to assess its pH stability (FIG. 7). Detecting the effect of metal ions and metal ion chelating agent EDTA on Amp0279 enzyme activity (FIG. 8), adding into the reaction system under optimum temperature and pH conditionsInto 1mM K⁺、Na⁺、Mg²⁺、Cu²⁺、Zn²⁺、Fe²⁺、Mn²⁺、Co²⁺Or EDTA, and the absorbance is detected after 1 h. Then, different concentrations of Co were investigated²⁺Influence on the enzyme activity (FIG. 9), Co was added to the reaction system at various concentrations²⁺And measuring the enzyme activity.

Through the above analysis, it was found that Amp0279 is optimally stable in enzyme activity at 50 ℃ and pH8.0, at 40-55 ℃ and pH6.0-9.0, and is optimally stabilized by adding 100. mu.M Co²⁺Then, the specific enzyme activity can reach 35383U/mg.

Example 5: comparison of enzyme Activity of aminopeptidase Amp0279 with commercial flavor enzymes

Adding flavor enzyme (A), (B), (C)

Shanghai-derived leaf Biotechnology Co., Ltd., LOT: P29F11B109057) powder was dissolved in a buffer (20mM Tris, 200mM NaCl, pH 8.0) as a stock solution (400. mu.g/mL), and then the protein content was measured using a BCA protein assay kit (TaKaRa Biotech, Japan). The enzyme activity was determined as in example 4, under the conditions including general conditions (usually at 30 ℃ C., pH7.5) and optimized conditions for Amp0279 (50 ℃ C., pH8.0, 100. mu.M Co)²⁺). The results show that Co is not added²⁺Under the optimized condition, Amp0279 has specific enzyme activity of about

1/40(1024Vs.42249U/mg), and 100. mu.M Co was added²⁺Under the condition, the activity of Amp0279 is obviously increased and can reach 35383U/mg which is slightly higher than

(33663U/mg) (see Table 1).

TABLE 1Amp0279 and commercial flavor enzymes

Comparing enzyme activity of (1).

Wherein, a, the conversion of specific enzyme activity is carried out according to the protein content measured after the flavor enzyme powder is dissolved

General conditions

Optimization condition of Amp0279

On the basis of the verification of Escherichia coli BL21, the invention further develops a secretory expression system of aminopeptidase Amp0279 in consideration of the fact that an Escherichia coli expression system requires a complicated, time-consuming and cost-increasing purification and label-removal process. Since Bacillus subtilis is a relatively mature production strain in the industry at present, the Bacillus subtilis has the following advantages: (1) the protein can be directly secreted into a culture medium, and the active protein is easy to separate; (2) the outer membrane is free of lipopolysaccharide (endotoxin), is nonpathogenic, and is certified by the FDA (U.S. food and drug administration) as Generally Recognized As Safe (GRAS). The bacillus subtilis produces abundant protease, can influence the expression of the protease with heterologous expression, can modify an expression strain through simplifying and optimizing a genome, knocks out unnecessary redundant genes, maintains the growth of the strain, and maximizes the production of a target product. Therefore, the method is favorable for further obtaining more excellent recombinant plasmids and recombinant strains.

Bacillus subtilis WB800N (pHT43-amp0279), which is deposited in the China center for type culture Collection, address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211237, taxonomic nomenclature Bacillus subtilis.

The construction of recombinant plasmid and recombinant bacillus subtilis, the secretion expression condition of Amp0279 and the crude enzyme biopsy of the expression product aminopeptidase Amp0279 are as follows:

construction of pHT43-amp0279 recombinant plasmid: first, amp0279 full Gene was used as a primer set

P6-43-F (ATCAGCCGTAAGGATCCATGACGTTGAAGAAAAATTAC)/P6-43-R (TAGGCGGGCTGCCCCGGGGTTAGAAAGCCCAGCTACCTACT) is amplified from a C3-41 genome, and amp0279 is inserted into an expression vector pHT JM 43 through BamHI/SmaI double digestion and ligation, and the ligation product is transformed into Escherichia coli 109. Positive clones were screened by PCR and plasmids were extracted for further sequencing validation. The recombinant expression plasmid obtained was pHT43-amp 0279. The nucleic acid sequence is shown as SEQ ID NO. 4.

The recombinant expression plasmid pHT43-amp0279 is transformed into competent cells of Bacillus subtilis WB800N, and a positive clone strain is screened out by a PCR verification method. The aminopeptidase secreted and expressed by the obtained genetically engineered strain WB800N (pHT43-Amp0279) for producing the aminopeptidase Amp0279 directly detects the enzyme activity.

The specific embodiment is as follows:

example 6: construction of recombinant expression plasmid pHT43-amp0279 containing amp0279 Gene

Primers with cleavage sites BamHI and SmaI were designed based on the predicted amp0279(300199..301428) gene sequence of Bacillus globuliformis C3-41 genome sequence (CP000817), and the fragment was amplified from the genome and purified to give an amp0279 fragment of the aminopeptidase encoding gene. The amp0279 fragment and the E.coli-B.subtilis shuttle vector pHT43 were digested simultaneously with restriction enzymes BamHI and SmaI, and ligated with ligase to construct recombinant expression plasmid pHT43-amp 0279. Escherichia coli JM109 competent cells were transformed with the recombinant expression plasmid, positive clone strain JM109(pHT43-amp0279) was selected by PCR verification, recombinant plasmid pHT43-amp0279 which was successfully sequenced was retransformed into JM110 competent cells (demethylation), and positive clone strain JM110(pHT43-amp0279) was selected by PCR verification. The culture temperature of Escherichia coli was 37 ℃ and Amp was 100. mu.g/mL.

Example 7: construction of recombinant expression Strain WB800N (pHT43-Amp0279) containing aminopeptidase Amp0279 Gene

The successfully verified recombinant plasmid of example 6, pHT43-amp0279, was transformed into WB800N competent cells by chemical transformation. The method comprises the following specific steps:

WB800N was prepared chemically competent according to the prior art method. Taking 500 mu L of competence; taking about 1 mu g of plasmid to be put in competent cells, and keeping the temperature at 37 ℃ and 100rpm for 1 h; 37 ℃, 220rpm, 2 h; after centrifugation, about 200. mu.L of the resuspended suspension was spread on Cm25 (25. mu.g/mL Cm) plates and single colonies were grown at 37 ℃ for 1-2 d.

Example 8: detecting the secretory expression condition of Amp0279 in recombinant strain WB800N (pHT43-Amp0279)

The recombinant strain was inoculated into 5mL LB (100. mu.g/mL Amp, 25. mu.g/mL Cm), and cultured overnight at 37 ℃ and 220rpm to obtain a seed solution. Adding the seed solution into fresh LB culture medium (100. mu.g/mL Amp, 25. mu.g/mL Cm) at a ratio of 1:100, and culturing for about 3h to OD₆₀₀When the concentration is 0.6 to 0.8, IPTG (final concentration of 1mM) is added to the mixture, and the mixture is slowly induced at a low temperature (25 ℃ C., 160rpm) for about 5 hours. 5mL samples were taken before and after induction, and after centrifugation, the supernatant and the pellet were retained. Preparing supernatant protein by using a TCA precipitation method, and preparing samples of the supernatant protein and the thallus precipitate respectively. Western blot assays were performed using antiserum raised from mice immunized with Amp0279 protein expressed and purified from BL21(pET28-Amp0279-BL 21). The results showed that clear expression hybridization signals were detected in the supernatant of WB800N (pHT43-amp0279) medium (FIG. 10). In the figure, M: prestained Protein Ladder 26616; +: amp0279 protein expressed from BL21(pET28-Amp0279-BL21) and purified; 1 and 2 experimental groups, which are intracellular proteins of thalli and proteins secreted to supernatant respectively; 3 and 4 are negative controls, pHT43-WB800N, which are intracellular proteins and proteins secreted to the supernatant, respectively.

Example 9: detecting the activity of the supernatant enzyme of the culture medium of the recombinant bacteria WB800N (pHT43-amp0279)

The enzyme activity of the aminopeptidase is detected by a p-nitroaniline method, and the used substrate is Leu-pNA. And (4) centrifuging the bacterial culture solution, measuring the wet weight of the bacterial precipitate, collecting the supernatant, and performing enzyme activity detection. 1mM substrate Leu-pNA, 100. mu.M Co ²⁺200 mul of supernatant and reaction buffer are prepared into 800 mul of reaction liquid, the reaction liquid is placed at 50 ℃ and pH8.0 for 1h, 200 mul of 40% (v/v) glacial acetic acid is added to stop the reaction, and the absorbance at the wavelength of 405nm is detected to indicate the hydrolysis condition of the substrate and the capability of enzyme to hydrolyze the substrate. The unit μ M/g is defined as the μ M value of Leu-pNA hydrolyzed by wet weight per gram of bacteria. As a result, it was revealed that, without concentration and purification, the activity of the enzyme (the amount of pNA released per g wet weight of the cells in the reaction system was 20 to 40. mu.M) was detected from the culture supernatant of the recombinant bacteria (FIG. 11), in which the black column was a Bacillus subtilis budDetecting the activity of Amp0279 crude enzyme secreted and expressed by Bacillus subtilis WB800N (pHT43-Amp 0279).

It is also noted that in pHT43-amp0279 sequence SEQ ID NO 4, the sequence in capital letters is the sequence of amp0279 inserted in pHT43

ttaagttattggtatgactggttttaagcgcaaaaaaagttgctttttcgtacctattaatgtatcgttttagaaaaccgactgtaaaaagtacagtcggcattatctcatattataaaagccagtcattaggcctatctgacaattcctgaatagagttcataaacaatcctgcatgataaccatcacaaacagaatgatgtacctgtaaagatagcggtaaatatattgaattacctttattaatgaattttcctgctgtaataatgggtagaaggtaattactattattattgatatttaagttaaacccagtaaatgaagtccatggaataatagaaagagaaaaagcattttcaggtataggtgttttgggaaacaatttccccgaaccattatatttctctacatcagaaaggtataaatcataaaactctttgaagtcattctttacaggagtccaaataccagagaatgttttagatacaccatcaaaaattgtataaagtggctctaacttatcccaataacctaactctccgtcgctattgtaaccagttctaaaagctgtatttgagtttatcacccttgtcactaagaaaataaatgcagggtaaaatttatatccttcttgttttatgtttcggtataaaacactaatatcaatttctgtggttatactaaaagtcgtttgttggttcaaataatgattaaatatctcttttctcttccaattgtctaaatcaattttattaaagttcatttgatatgcctcctaaatttttatctaaagtgaatttaggaggcttacttgtctgctttcttcattagaatcaatccttttttaaaagtcaatattactgtaacataaatatatattttaaaaatatcccactttatccaattttcgtttgttgaactaatgggtgctttagttgaagaataaagaccacattaaaaaatgtggtcttttgtgtttttttaaaggatttgagcgtagcgaaaaatccttttctttcttatcttgataataagggtaactattgccgatcgtccattccgacagcatcgccagtcactatggcgtgctgctagcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcaggccttaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttgacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcatcaaaatcgtctccctccgtttgaatatttgattgatcgtaaccagatgaagcactctttccactatccctacagtgttatggcttgaacaatcacgaaacaataattggtacgtacgatctttcagccgactcaaacatcaaatcttacaaatgtagtctttgaaagtattacatatgtaagatttaaatgcaaccgttttttcggaaggaaatgatgacctcgtttccaccggaattagcttggtaccagctattgtaacataatcggtacgggggtgaaaaagctaacggaaaagggagcggaaaagaatgatgtaagcgtgaaaaattttttatcttatcacttgaaattggaagggagattctttattataagaattgtggaattgtgagcggataacaattcccaattaaaggaggaaggatcaatgattcaaaaacgaaagcggacagtttcgttcagacttgtgcttatgtgcacgctgttatttgtcagtttgccgattacaaaaacatcagccgtaggatccATGACGTTTGAAGAAAAATTACAGGCATACGCGGAACTTGCAGTAAAAGTTGGGGTAAACATTCAACCAGGTCAATATTTGTTAGTCAACACATCAGTTGAGGCTTTAGATTTTGCTCGTTTAGTCGTTAAAGAGGCGTATAAGGCTGGGGCAGGGCGTGTCCATGTTAATTTTTCTGACGATGAAATGGATCGTGCCTATTTTGAACATGCCTCTGATGAAGAATTTAACCGTTTCCCCGAATGGGTCGTACAAATGCGTGATGAACTCATTGAACGTAAAGGGGCATTATTATGGATAGATGCCGCAGATCCTGATAAATTAACAGGAATCTCGGCTGATCGATTAGCTACTCATCAAAAGGTATCAGGAGCTGCGTTGAAAAACTATCGTAATGCAGTTATGAAGGATTTGATTGCGTGGTCCATTATTGCAGTACCTTCGCCAAAGTGGGCGGCAAAGGTATTCCCTCAATTGACAGCAGACGAGCAAGTACCTGCTTTATGGGAAGCTATCTTTAAAACAGTTCATATCGGAGAAGGTAACGCAGTTGAAAATTGGCATCAGCATGTAACGAATTTAGAATCTCGGGCAGAACTTTTAAATAATAAAAAGTATGCGAAGCTACACTATACTGCACCTGGAACAGATTTAACGATTGCTTTAGCTCCACAGCATAAATGGGTAACTGGTGGCAGTAAAACGCCTGAAGGCCATGTTTTTATCGCCAATATGCCAACAGAAGAAGTCTATACACTTCCTATGAAGCAAGGTGTAGACGGTTATGTTAGTAATTCAAAGCCTTTAGTATATCAGGGCAATATCATTGATGGCTTTAAATTAACATTTAAAGAAGGAAAAATCATTAAAGCAGAAGCTGAAGTAGGTCAAGATTTACTACAGGAGCTTATTCAAGTAGATGAGGGTTCTAGTTATTTAGGTGAAGTAGCACTTGTCCCGCATGAGTCACCAATTTCAGCATCAGGGATTTTATACTTTAATACACTATTCGATGAGAATGCTTCGAACCATTTAGCGATTGGAGAAGCATACCCGACATGCTTAGAGGGTGGTAGAGACTTGGAAAACGGTCAACTAGAAGCATTAGGTGCGAATATTTCTGTAACCCATGAAGACTTTATGGTTGGTAACGGTGAAATGGACATTGATGGTATATTACCAGATGGAACTATAGAGCCTATATTCCGTAAAGGTAGCTGGGCTTTCTAAcccggggcagcccgcctaatgagcgggcttttttcacgtcacgcgtccatggagatctttgtctgcaactgaaaagtttataccttacctggaacaaatggttgaaacatacgaggctaatatcggcttattaggaatagtccctgtactaataaaatcaggtggatcagttgatcagtatattttggacgaagctcggaaagaatttggagatgacttgcttaattccacaattaaattaagggaaagaataaagcgatttgatgttcaaggaatcacggaagaagatactcatgataaagaagctctaaaactattcaataaccttacaatggaattgatcgaaagggtggaaggttaatggtacgaaaattaggggatctacctagaaagccacaaggcgataggtcaagcttaaagaacccttacatggatcttacagattctgaaagtaaagaaacaacagaggttaaacaaacagaaccaaaaagaaaaaaagcattgttgaaaacaatgaaagttgatgtttcaatccataataagattaaatcgctgcacgaaattctggcagcatccgaagggaattcatattacttagaggatactattgagagagctattgataagatggttgagacattacctgagagccaaaaaactttttatgaatatgaattaaaaaaaagaaccaacaaaggctgagacagactccaaacgagtctgtttttttaaaaaaaatattaggagcattgaatatatattagagaattaagaaagacatgggaataaaaatattttaaatccagtaaaaatatgataagattatttcagaatatgaagaactctgtttgtttttgatgaaaaaacaaacaaaaaaaatccacctaacggaatctcaatttaactaacagcggccaaactgagaagttaaatttgagaaggggaaaaggcggatttatacttgtatttaactatctccattttaacattttattaaaccccatacaagtgaaaatcctcttttacactgttcctttaggtgatcgcggagggacattatgagtgaagtaaacctaaaaggaaatacagatgaattagtgtattatcgacagcaaaccactggaaataaaatcgccaggaagagaatcaaaaaagggaaagaagaagtttattatgttgctgaaacggaagagaagatatggacagaagagcaaataaaaaacttttctttagacaaatttggtacgcatataccttacatagaaggtcattatacaatcttaaataattacttctttgatttttggggctattttttaggtgctgaaggaattgcgctctatgctcacctaactcgttatgcatacggcagcaaagacttttgctttcctagtctacaaacaatcgctaaaaaaatggacaagactcctgttacagttagaggctacttgaaactgcttgaaaggtacggttttatttggaaggtaaacgtccgtaataaaaccaaggataacacagaggaatccccgatttttaagattagacgtaaggttcctttgctttcagaagaacttttaaatggaaaccctaatattgaaattccagatgacgaggaagcacatgtaaagaaggctttaaaaaaggaaaaagagggtcttccaaaggttttgaaaaaagagcacgatgaatttgttaaaaaaatgatggatgagtcagaaacaattaatattccagaggccttacaatatgacacaatgtatgaagatatactcagtaaaggagaaattcgaaaagaaatcaaaaaacaaatacctaatcctacaacatcttttgagagtatatcaatgacaactgaagaggaaaaagtcgacagtactttaaaaagcgaaatgcaaaatcgtgtctctaagccttcttttgatacctggtttaaaaacactaagatcaaaattgaaaataaaaattgtttattacttgtaccgagtgaatttgcatttgaatggattaagaaaagatatttagaaacaattaaaacagtccttgaagaagctggatatgttttcgaaaaaatcgaactaagaaaagtgcaataaactgctgaagtatttcagcagttttttttatttagaaatagtgaaaaaaatataatcagggaggtatcaatatttaatgagtactgatttaaatttatttagactggaattaataattaacacgtagactaattaaaatttaatgagggataaagaggatacaaaaatattaatttcaatccctattaaattttaacaagggggggattaaaatttaattagaggtttatccacaagaaaagaccctaataaaatttttactagggttataacactgattaatttcttaatgggggagggattaaaatttaatgacaaagaaaacaatcttttaagaaaagcttttaaaagataataataaaaagagctttgcgattaagcaaaactctttactttttcattgacattatcaaattcatcgatttcaaattgttgttgtatcataaagttaattctgttttgcacaaccttttcaggaatataaaacacatctgaggcttgttttataaactcagggtcgctaaagtcaatgtaacgtagcatatgatatggtatagcttccacccaagttagcctttctgcttcttctgaatgtttttcatatacttccatgggtatctctaaatgattttcctcatgtagcaaggtatgagcaaaaagtttatggaattgatagttcctctctttttcttcaacttttttatctaaaacaaacactttaacatctgagtcaatgtaagcataagatgtttttccagtcataatttcaatcccaaatcttttagacagaaattctggacgtaaatcttttggtgaaagaatttttttatgtagcaatatatccgatacagcaccttctaaaagcgttggtgaatagggcattttacctatctcctctcattttgtggaataaaaatagtcatattcgtccatctacctatcctattatcgaacagttgaactttttaatcaaggatcagtcctttttttcattattcttaaactgtgctcttaactttaacaactcgatttgtttttccagatctcgagggtaactagcctcgccgatcccgcaagaggcccggcagtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcatgc.

Sequence listing

<110> university of the south China nationality

<120> aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41, and recombinant strain and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1230

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgacgtttg aagaaaaatt acaggcatac gcggaacttg cagtaaaagt tggggtaaac 60

attcaaccag gtcaatattt gttagtcaac acatcagttg aggctttaga ttttgctcgt 120

ttagtcgtta aagaggcgta taaggctggg gcagggcgtg tccatgttaa tttttctgac 180

gatgaaatgg atcgtgccta ttttgaacat gcctctgatg aagaatttaa ccgtttcccc 240

gaatgggtcg tacaaatgcg tgatgaactc attgaacgta aaggggcatt attatggata 300

gatgccgcag atcctgataa attaacagga atctcggctg atcgattagc tactcatcaa 360

aaggtatcag gagctgcgtt gaaaaactat cgtaatgcag ttatgaagga tttgattgcg 420

tggtccatta ttgcagtacc ttcgccaaag tgggcggcaa aggtattccc tcaattgaca 480

gcagacgagc aagtacctgc tttatgggaa gctatcttta aaacagttca tatcggagaa 540

ggtaacgcag ttgaaaattg gcatcagcat gtaacgaatt tagaatctcg ggcagaactt 600

ttaaataata aaaagtatgc gaagctacac tatactgcac ctggaacaga tttaacgatt 660

gctttagctc cacagcataa atgggtaact ggtggcagta aaacgcctga aggccatgtt 720

tttatcgcca atatgccaac agaagaagtc tatacacttc ctatgaagca aggtgtagac 780

ggttatgtta gtaattcaaa gcctttagta tatcagggca atatcattga tggctttaaa 840

ttaacattta aagaaggaaa aatcattaaa gcagaagctg aagtaggtca agatttacta 900

caggagctta ttcaagtaga tgagggttct agttatttag gtgaagtagc acttgtcccg 960

catgagtcac caatttcagc atcagggatt ttatacttta atacactatt cgatgagaat 1020

gcttcgaacc atttagcgat tggagaagca tacccgacat gcttagaggg tggtagagac 1080

ttggaaaacg gtcaactaga agcattaggt gcgaatattt ctgtaaccca tgaagacttt 1140

atggttggta acggtgaaat ggacattgat ggtatattac cagatggaac tatagagcct 1200

atattccgta aaggtagctg ggctttctaa 1230

<210> 2

<211> 409

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Thr Phe Glu Glu Lys Leu Gln Ala Tyr Ala Glu Leu Ala Val Lys

1 5 10 15

Val Gly Val Asn Ile Gln Pro Gly Gln Tyr Leu Leu Val Asn Thr Ser

20 25 30

Val Glu Ala Leu Asp Phe Ala Arg Leu Val Val Lys Glu Ala Tyr Lys

35 40 45

Ala Gly Ala Gly Arg Val His Val Asn Phe Ser Asp Asp Glu Met Asp

50 55 60

Arg Ala Tyr Phe Glu His Ala Ser Asp Glu Glu Phe Asn Arg Phe Pro

65 70 75 80

Glu Trp Val Val Gln Met Arg Asp Glu Leu Ile Glu Arg Lys Gly Ala

85 90 95

Leu Leu Trp Ile Asp Ala Ala Asp Pro Asp Lys Leu Thr Gly Ile Ser

100 105 110

Ala Asp Arg Leu Ala Thr His Gln Lys Val Ser Gly Ala Ala Leu Lys

115 120 125

Asn Tyr Arg Asn Ala Val Met Lys Asp Leu Ile Ala Trp Ser Ile Ile

130 135 140

Ala Val Pro Ser Pro Lys Trp Ala Ala Lys Val Phe Pro Gln Leu Thr

145 150 155 160

Ala Asp Glu Gln Val Pro Ala Leu Trp Glu Ala Ile Phe Lys Thr Val

165 170 175

His Ile Gly Glu Gly Asn Ala Val Glu Asn Trp His Gln His Val Thr

180 185 190

Asn Leu Glu Ser Arg Ala Glu Leu Leu Asn Asn Lys Lys Tyr Ala Lys

195 200 205

Leu His Tyr Thr Ala Pro Gly Thr Asp Leu Thr Ile Ala Leu Ala Pro

210 215 220

Gln His Lys Trp Val Thr Gly Gly Ser Lys Thr Pro Glu Gly His Val

225 230 235 240

Phe Ile Ala Asn Met Pro Thr Glu Glu Val Tyr Thr Leu Pro Met Lys

245 250 255

Gln Gly Val Asp Gly Tyr Val Ser Asn Ser Lys Pro Leu Val Tyr Gln

260 265 270

Gly Asn Ile Ile Asp Gly Phe Lys Leu Thr Phe Lys Glu Gly Lys Ile

275 280 285

Ile Lys Ala Glu Ala Glu Val Gly Gln Asp Leu Leu Gln Glu Leu Ile

290 295 300

Gln Val Asp Glu Gly Ser Ser Tyr Leu Gly Glu Val Ala Leu Val Pro

305 310 315 320

His Glu Ser Pro Ile Ser Ala Ser Gly Ile Leu Tyr Phe Asn Thr Leu

325 330 335

Phe Asp Glu Asn Ala Ser Asn His Leu Ala Ile Gly Glu Ala Tyr Pro

340 345 350

Thr Cys Leu Glu Gly Gly Arg Asp Leu Glu Asn Gly Gln Leu Glu Ala

355 360 365

Leu Gly Ala Asn Ile Ser Val Thr His Glu Asp Phe Met Val Gly Asn

370 375 380

Gly Glu Met Asp Ile Asp Gly Ile Leu Pro Asp Gly Thr Ile Glu Pro

385 390 395 400

Ile Phe Arg Lys Gly Ser Trp Ala Phe

405

<210> 3

<211> 6593

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac 5100

agcagcggcc tggtgccgcg cggcagccat atggctagca tgactggtgg acagcaaatg 5160

ggtcgcggat ccatgacgtt tgaagaaaaa ttacaggcat acgcggaact tgcagtaaaa 5220

gttggggtaa acattcaacc aggtcaatat ttgttagtca acacatcagt tgaggcttta 5280

gattttgctc gtttagtcgt taaagaggcg tataaggctg gggcagggcg tgtccatgtt 5340

aatttttctg acgatgaaat ggatcgtgcc tattttgaac atgcctctga tgaagaattt 5400

aaccgtttcc ccgaatgggt cgtacaaatg cgtgatgaac tcattgaacg taaaggggca 5460

ttattatgga tagatgccgc agatcctgat aaattaacag gaatctcggc tgatcgatta 5520

gctactcatc aaaaggtatc aggagctgcg ttgaaaaact atcgtaatgc agttatgaag 5580

gatttgattg cgtggtccat tattgcagta ccttcgccaa agtgggcggc aaaggtattc 5640

cctcaattga cagcagacga gcaagtacct gctttatggg aagctatctt taaaacagtt 5700

catatcggag aaggtaacgc agttgaaaat tggcatcagc atgtaacgaa tttagaatct 5760

cgggcagaac ttttaaataa taaaaagtat gcgaagctac actatactgc acctggaaca 5820

gatttaacga ttgctttagc tccacagcat aaatgggtaa ctggtggcag taaaacgcct 5880

gaaggccatg tttttatcgc caatatgcca acagaagaag tctatacact tcctatgaag 5940

caaggtgtag acggttatgt tagtaattca aagcctttag tatatcaggg caatatcatt 6000

gatggcttta aattaacatt taaagaagga aaaatcatta aagcagaagc tgaagtaggt 6060

caagatttac tacaggagct tattcaagta gatgagggtt ctagttattt aggtgaagta 6120

gcacttgtcc cgcatgagtc accaatttca gcatcaggga ttttatactt taatacacta 6180

ttcgatgaga atgcttcgaa ccatttagcg attggagaag catacccgac atgcttagag 6240

ggtggtagag acttggaaaa cggtcaacta gaagcattag gtgcgaatat ttctgtaacc 6300

catgaagact ttatggttgg taacggtgaa atggacattg atggtatatt accagatgga 6360

actatagagc ctatattccg taaaggtagc tgggctttct aagagctccg tcgacaagct 6420

tgcggccgca ctcgagcacc accaccacca ccactgagat ccggctgcta acaaagcccg 6480

aaaggaagct gagttggctg ctgccaccgc tgagcaataa ctagcataac cccttggggc 6540

ctctaaacgg gtcttgaggg gttttttgct gaaaggagga actatatccg gat 6593

<210> 4

<211> 9272

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttaagttatt ggtatgactg gttttaagcg caaaaaaagt tgctttttcg tacctattaa 60

tgtatcgttt tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa 120

gccagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat cctgcatgat 180

aaccatcaca aacagaatga tgtacctgta aagatagcgg taaatatatt gaattacctt 240

tattaatgaa ttttcctgct gtaataatgg gtagaaggta attactatta ttattgatat 300

ttaagttaaa cccagtaaat gaagtccatg gaataataga aagagaaaaa gcattttcag 360

gtataggtgt tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt 420

ataaatcata aaactctttg aagtcattct ttacaggagt ccaaatacca gagaatgttt 480

tagatacacc atcaaaaatt gtataaagtg gctctaactt atcccaataa cctaactctc 540

cgtcgctatt gtaaccagtt ctaaaagctg tatttgagtt tatcaccctt gtcactaaga 600

aaataaatgc agggtaaaat ttatatcctt cttgttttat gtttcggtat aaaacactaa 660

tatcaatttc tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct 720

cttttctctt ccaattgtct aaatcaattt tattaaagtt catttgatat gcctcctaaa 780

tttttatcta aagtgaattt aggaggctta cttgtctgct ttcttcatta gaatcaatcc 840

ttttttaaaa gtcaatatta ctgtaacata aatatatatt ttaaaaatat cccactttat 900

ccaattttcg tttgttgaac taatgggtgc tttagttgaa gaataaagac cacattaaaa 960

aatgtggtct tttgtgtttt tttaaaggat ttgagcgtag cgaaaaatcc ttttctttct 1020

tatcttgata ataagggtaa ctattgccga tcgtccattc cgacagcatc gccagtcact 1080

atggcgtgct gctagcgcca ttcgccattc aggctgcgca actgttggga agggcgatcg 1140

gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc aaggcgatta 1200

agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc cagtgaattc 1260

gagctcaggc cttaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 1320

aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 1380

attgggcgcc agggtggttt ttcttttcac cagtgagacg ggcaacagct gattgccctt 1440

caccgcctgg ccctgagaga gttgcagcaa gcggtccacg ctggtttgcc ccagcaggcg 1500

aaaatcctgt ttgatggtgg ttgacggcgg gatataacat gagctgtctt cggtatcgtc 1560

gtatcccact accgagatat ccgcaccaac gcgcagcccg gactcggtaa tggcgcgcat 1620

tgcgcccagc gccatctgat cgttggcaac cagcatcgca gtgggaacga tgccctcatt 1680

cagcatttgc atggtttgtt gaaaaccgga catggcactc cagtcgcctt cccgttccgc 1740

tatcggctga atttgattgc gagtgagata tttatgccag ccagccagac gcagacgcgc 1800

cgagacagaa cttaatgggc ccgctaacag cgcgatttgc tggtgaccca atgcgaccag 1860

atgctccacg cccagtcgcg taccgtcttc atgggagaaa ataatactgt tgatgggtgt 1920

ctggtcagag acatcaagaa ataacgccgg aacattagtg caggcagctt ccacagcaat 1980

ggcatcctgg tcatccagcg gatagttaat gatcagccca ctgacgcgtt gcgcgagaag 2040

attgtgcacc gccgctttac aggcttcgac gccgcttcgt tctaccatcg acaccaccac 2100

gctggcaccc agttgatcgg cgcgagattt aatcgccgcg acaatttgcg acggcgcgtg 2160

cagggccaga ctggaggtgg caacgccaat cagcaacgac tgtttgcccg ccagttgttg 2220

tgccacgcgg ttgggaatgt aattcagctc cgccatcgcc gcttccactt tttcccgcgt 2280

tttcgcagaa acgtggctgg cctggttcac cacgcgggaa acggtctgat aagagacacc 2340

ggcatactct gcgacatcgt ataacgttac tggtttcatc aaaatcgtct ccctccgttt 2400

gaatatttga ttgatcgtaa ccagatgaag cactctttcc actatcccta cagtgttatg 2460

gcttgaacaa tcacgaaaca ataattggta cgtacgatct ttcagccgac tcaaacatca 2520

aatcttacaa atgtagtctt tgaaagtatt acatatgtaa gatttaaatg caaccgtttt 2580

ttcggaagga aatgatgacc tcgtttccac cggaattagc ttggtaccag ctattgtaac 2640

ataatcggta cgggggtgaa aaagctaacg gaaaagggag cggaaaagaa tgatgtaagc 2700

gtgaaaaatt ttttatctta tcacttgaaa ttggaaggga gattctttat tataagaatt 2760

gtggaattgt gagcggataa caattcccaa ttaaaggagg aaggatcaat gattcaaaaa 2820

cgaaagcgga cagtttcgtt cagacttgtg cttatgtgca cgctgttatt tgtcagtttg 2880

ccgattacaa aaacatcagc cgtaggatcc atgacgtttg aagaaaaatt acaggcatac 2940

gcggaacttg cagtaaaagt tggggtaaac attcaaccag gtcaatattt gttagtcaac 3000

acatcagttg aggctttaga ttttgctcgt ttagtcgtta aagaggcgta taaggctggg 3060

gcagggcgtg tccatgttaa tttttctgac gatgaaatgg atcgtgccta ttttgaacat 3120

gcctctgatg aagaatttaa ccgtttcccc gaatgggtcg tacaaatgcg tgatgaactc 3180

attgaacgta aaggggcatt attatggata gatgccgcag atcctgataa attaacagga 3240

atctcggctg atcgattagc tactcatcaa aaggtatcag gagctgcgtt gaaaaactat 3300

cgtaatgcag ttatgaagga tttgattgcg tggtccatta ttgcagtacc ttcgccaaag 3360

tgggcggcaa aggtattccc tcaattgaca gcagacgagc aagtacctgc tttatgggaa 3420

gctatcttta aaacagttca tatcggagaa ggtaacgcag ttgaaaattg gcatcagcat 3480

gtaacgaatt tagaatctcg ggcagaactt ttaaataata aaaagtatgc gaagctacac 3540

tatactgcac ctggaacaga tttaacgatt gctttagctc cacagcataa atgggtaact 3600

ggtggcagta aaacgcctga aggccatgtt tttatcgcca atatgccaac agaagaagtc 3660

tatacacttc ctatgaagca aggtgtagac ggttatgtta gtaattcaaa gcctttagta 3720

tatcagggca atatcattga tggctttaaa ttaacattta aagaaggaaa aatcattaaa 3780

gcagaagctg aagtaggtca agatttacta caggagctta ttcaagtaga tgagggttct 3840

agttatttag gtgaagtagc acttgtcccg catgagtcac caatttcagc atcagggatt 3900

ttatacttta atacactatt cgatgagaat gcttcgaacc atttagcgat tggagaagca 3960

tacccgacat gcttagaggg tggtagagac ttggaaaacg gtcaactaga agcattaggt 4020

gcgaatattt ctgtaaccca tgaagacttt atggttggta acggtgaaat ggacattgat 4080

ggtatattac cagatggaac tatagagcct atattccgta aaggtagctg ggctttctaa 4140

cccggggcag cccgcctaat gagcgggctt ttttcacgtc acgcgtccat ggagatcttt 4200

gtctgcaact gaaaagttta taccttacct ggaacaaatg gttgaaacat acgaggctaa 4260

tatcggctta ttaggaatag tccctgtact aataaaatca ggtggatcag ttgatcagta 4320

tattttggac gaagctcgga aagaatttgg agatgacttg cttaattcca caattaaatt 4380

aagggaaaga ataaagcgat ttgatgttca aggaatcacg gaagaagata ctcatgataa 4440

agaagctcta aaactattca ataaccttac aatggaattg atcgaaaggg tggaaggtta 4500

atggtacgaa aattagggga tctacctaga aagccacaag gcgataggtc aagcttaaag 4560

aacccttaca tggatcttac agattctgaa agtaaagaaa caacagaggt taaacaaaca 4620

gaaccaaaaa gaaaaaaagc attgttgaaa acaatgaaag ttgatgtttc aatccataat 4680

aagattaaat cgctgcacga aattctggca gcatccgaag ggaattcata ttacttagag 4740

gatactattg agagagctat tgataagatg gttgagacat tacctgagag ccaaaaaact 4800

ttttatgaat atgaattaaa aaaaagaacc aacaaaggct gagacagact ccaaacgagt 4860

ctgttttttt aaaaaaaata ttaggagcat tgaatatata ttagagaatt aagaaagaca 4920

tgggaataaa aatattttaa atccagtaaa aatatgataa gattatttca gaatatgaag 4980

aactctgttt gtttttgatg aaaaaacaaa caaaaaaaat ccacctaacg gaatctcaat 5040

ttaactaaca gcggccaaac tgagaagtta aatttgagaa ggggaaaagg cggatttata 5100

cttgtattta actatctcca ttttaacatt ttattaaacc ccatacaagt gaaaatcctc 5160

ttttacactg ttcctttagg tgatcgcgga gggacattat gagtgaagta aacctaaaag 5220

gaaatacaga tgaattagtg tattatcgac agcaaaccac tggaaataaa atcgccagga 5280

agagaatcaa aaaagggaaa gaagaagttt attatgttgc tgaaacggaa gagaagatat 5340

ggacagaaga gcaaataaaa aacttttctt tagacaaatt tggtacgcat ataccttaca 5400

tagaaggtca ttatacaatc ttaaataatt acttctttga tttttggggc tattttttag 5460

gtgctgaagg aattgcgctc tatgctcacc taactcgtta tgcatacggc agcaaagact 5520

tttgctttcc tagtctacaa acaatcgcta aaaaaatgga caagactcct gttacagtta 5580

gaggctactt gaaactgctt gaaaggtacg gttttatttg gaaggtaaac gtccgtaata 5640

aaaccaagga taacacagag gaatccccga tttttaagat tagacgtaag gttcctttgc 5700

tttcagaaga acttttaaat ggaaacccta atattgaaat tccagatgac gaggaagcac 5760

atgtaaagaa ggctttaaaa aaggaaaaag agggtcttcc aaaggttttg aaaaaagagc 5820

acgatgaatt tgttaaaaaa atgatggatg agtcagaaac aattaatatt ccagaggcct 5880

tacaatatga cacaatgtat gaagatatac tcagtaaagg agaaattcga aaagaaatca 5940

aaaaacaaat acctaatcct acaacatctt ttgagagtat atcaatgaca actgaagagg 6000

aaaaagtcga cagtacttta aaaagcgaaa tgcaaaatcg tgtctctaag ccttcttttg 6060

atacctggtt taaaaacact aagatcaaaa ttgaaaataa aaattgttta ttacttgtac 6120

cgagtgaatt tgcatttgaa tggattaaga aaagatattt agaaacaatt aaaacagtcc 6180

ttgaagaagc tggatatgtt ttcgaaaaaa tcgaactaag aaaagtgcaa taaactgctg 6240

aagtatttca gcagtttttt ttatttagaa atagtgaaaa aaatataatc agggaggtat 6300

caatatttaa tgagtactga tttaaattta tttagactgg aattaataat taacacgtag 6360

actaattaaa atttaatgag ggataaagag gatacaaaaa tattaatttc aatccctatt 6420

aaattttaac aaggggggga ttaaaattta attagaggtt tatccacaag aaaagaccct 6480

aataaaattt ttactagggt tataacactg attaatttct taatggggga gggattaaaa 6540

tttaatgaca aagaaaacaa tcttttaaga aaagctttta aaagataata ataaaaagag 6600

ctttgcgatt aagcaaaact ctttactttt tcattgacat tatcaaattc atcgatttca 6660

aattgttgtt gtatcataaa gttaattctg ttttgcacaa ccttttcagg aatataaaac 6720

acatctgagg cttgttttat aaactcaggg tcgctaaagt caatgtaacg tagcatatga 6780

tatggtatag cttccaccca agttagcctt tctgcttctt ctgaatgttt ttcatatact 6840

tccatgggta tctctaaatg attttcctca tgtagcaagg tatgagcaaa aagtttatgg 6900

aattgatagt tcctctcttt ttcttcaact tttttatcta aaacaaacac tttaacatct 6960

gagtcaatgt aagcataaga tgtttttcca gtcataattt caatcccaaa tcttttagac 7020

agaaattctg gacgtaaatc ttttggtgaa agaatttttt tatgtagcaa tatatccgat 7080

acagcacctt ctaaaagcgt tggtgaatag ggcattttac ctatctcctc tcattttgtg 7140

gaataaaaat agtcatattc gtccatctac ctatcctatt atcgaacagt tgaacttttt 7200

aatcaaggat cagtcctttt tttcattatt cttaaactgt gctcttaact ttaacaactc 7260

gatttgtttt tccagatctc gagggtaact agcctcgccg atcccgcaag aggcccggca 7320

gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat 7380

acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg 7440

aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc 7500

attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga 7560

tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga 7620

gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg 7680

cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc 7740

tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac 7800

agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact 7860

tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca 7920

tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg 7980

tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact 8040

acttactcta gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg 8100

accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg 8160

tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat 8220

cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc 8280

tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat 8340

actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt 8400

tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc 8460

cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt 8520

gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac 8580

tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt 8640

gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct 8700

gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga 8760

ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac 8820

acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg 8880

agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt 8940

cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc 9000

tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg 9060

gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc 9120

ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc 9180

ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag 9240

cgaggaagcg gaagagcgcc caatacgcat gc 9272

Claims (9)

1. An aminopeptidase Amp0279 derived from Bacillus sphaericus C3-41, which is characterized in that: the nucleic acid sequence of the coding gene is shown as SEQ ID NO. 1.

2. The spherical lysine bacillus C3-41-derived aminopeptidase Amp0279 according to claim 1, wherein: the amino acid sequence is shown as SEQ ID NO. 2.

3. A recombinant plasmid pHT43-Amp0279 comprising the aminopeptidase Amp0279 coding sequence of claim 1, wherein: the nucleic acid sequence of the recombinant plasmid pHT43-amp0279 is shown in SEQ ID NO: 4.

4. A recombinant strain comprising the recombinant plasmid pHT43-amp0279 of claim 3.

5. The recombinant strain of claim 4, wherein: the recombinant strain is Bacillus subtilis WB800N (pHT43-amp0279), and is preserved in China center for type culture Collection with the address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211237, taxonomic nomenclature Bacillus subtilis.

6. Use of a recombinant strain according to claim 5 for expressing the product aminopeptidase Amp 0279.

7. The expression product aminopeptidase Amp0279 of claim 6 for use in feed, food, brewing, or medicine.

8. A recombinant plasmid pET28a-Amp0279 comprising the aminopeptidase Amp0279 coding sequence of claim 1, wherein: the nucleic acid sequence of the recombinant plasmid pET28a-amp0279 is shown in SEQ ID NO 3.

9. A recombinant strain of Escherichia coli BL21(pET28a-amp0279) comprising the recombinant plasmid pET28a-amp0279 of claim 8.

Images