CN103173488B - Method for quickly screening paddy transgenes by novel fusion tag - Google Patents

Abstract

The invention discloses a transformation vector of plant transgenes with a novel fusion tag. The vector can quickly and effectively screen and identify transgenic positive plants. In addition, the invention further provides a novel screening method of plant transgenes and a transgenic method of plants and the like.

Description

New fusion tag carries out the method for Transgenic Rice rapid screening

Technical field

The invention belongs to field of plant breeding, particularly, the present invention relates to the plant transgene conversion carrier of fusion tag and use the screening method etc. of its plant transgene.

Background technology

In plant (especially paddy rice) transgenic technology, the most loaded down with trivial details step is the screening of later stage transformant (strain).Mainly by marker gene screening transformant, wherein, marker gene is mainly divided into 2 classes: Select gene and reporter gene at present.

Select gene mainly comprises antibiotics resistance gene (as HPT gene, Gent gene etc.) and anti-herbicide gene.Yet, use the serve as a mark screening method of gene of Select gene to have part false positive plant, also need further to extract Plant Genome, by methods such as PCR, detect.

Conventional reporter gene is beta-glucosiduronatase gene (β-glucuronidase gene, gus), gfp etc.These genes can carry out visual screening, it is larger that but subject matter is them, cause T-DNA conversion carrier to become large, transformation efficiency reduces, and has to design the open reading frame (ORF) under different promoters and/or terminator control in order to improve transformation efficiency.

More difficult is, transgenic plant often background are complicated, likely imported repeatedly foreign gene, due to the conventional promotor of plant transgene with terminator type is limited and homology is higher, in addition the homology of goal gene is also higher, if reuse identical promotor and terminator, in the time of may causing transforming, there is genetic recombination, especially retained label and lost the homologous recombination of goal gene, brought larger difficulty to expensive screening of later stage, and to design different promoters and/or terminator control, be more difficult to operate in practice.

For this reason, the inventor is through long-term and arduous research, rely on some fortune, invented new fusion tag, have the function of Select gene and reporter gene concurrently, can there is resistance to Totomycin, have again visual characteristic, callus screening and transfer-gen plant growth phase in rice transformation process can be observed, and significantly improve screening exactness; And this label is less, and only need a promotor and a terminator to control, without a plurality of promotors of design and/or terminator.Especially, the inventor has also done new optimization in selection and the sequence of promotor and terminator, be different from prior art, coordinate fusion tag of the present invention to use, the conversion carrier being built into is not easy to occur homologous recombination, is not easy to occur the only homologous recombination of Hold sticker, thereby makes screening itself stable, screening and identification transgenic positive plant, especially rice plant more fast and effectively.

Summary of the invention

The technical problem to be solved in the present invention is the plant transgene conversion carrier with fusion tag that provides new, its label is less, thereby be convenient to just can control the conversion of larger goal gene under a promotor and a terminator, and adopted visual label, be more convenient for screening, coordinate promotor and terminator, more fast and effectively screening and identification transgenic positive plant.In addition, the present invention also provides the new screening method of plant transgene and method of plant transgene etc.

Particularly, in first aspect, the invention provides the plant transgene conversion carrier with fusion tag, its nucleotide sequence is as shown in SEQ ID NO:1.

This carrier is annular carrier, and the Nucleotide of head and the tail is connected, and connects into annular.

The multiple clone site of this carrier has SacI, KpnI, SmaI, XmaI, Acc65I and BamHI etc., enough meets the use as plant conversion carrier.These polyclone carriers have been contained the conventional and low restriction endonuclease of cost, corresponding with the restriction enzyme site of conventional cloning vector, for providing convenience to Plant Transformation goal gene.

In second aspect, the invention provides the method for identifying in bacterial body with the carrier described in first aspect present invention, it uses polymerase chain reaction (PCR) bacterial body that directly increases, and wherein PCR primer pair is as follows:

Tttccttcctcttttctacagt, and

gtaatgcagaagaagaccatgg。

In the process that carrier described in first aspect present invention is cloned in thalline, while especially becoming the state of linearization, have from situation about connecting and occur, need to identify for this reason; But, become rear just not the having from connecting situation of annular and occur.Except expensive methods such as order-checkings, adopt the method for second aspect present invention to identify, be the low and means easily and efficiently of cost.

Certainly, the preferred method of second aspect present invention, it also further comprises the process that carrier checks order in the thalline that bacterial body is positive that directly increases to PCR.

In the third aspect, the invention provides the screening method of plant transgene, it comprises,

(1) gene clone that need to proceed to plant enters the carrier described in first aspect present invention;

(2) be transformed into Agrobacterium;

(3) plant callus is transformed;

(4) culturing plants callus in containing the substratum of Totomycin; With

(5) detect the fluorescence that plant callus sends.

Correspondingly, in fourth aspect, the present invention also provides the method for plant transgene, and it comprises,

(1) gene clone that need to proceed to plant enters the carrier described in first aspect present invention;

(2) be transformed into Agrobacterium;

(3) plant callus is transformed;

(4) culturing plants callus in containing the substratum of Totomycin; With

(5) detect the fluorescence that plant callus sends, retain and detect positive callus.

Method described in preferred the present invention the 3rd or fourth aspect, the fluorescence that its plantling that also further comprises that detection plant callus develops into sends.So further initial stage in plant cultivation stage, at time, manpower, place and reagent cost before all larger stage arrives, make as far as possible to guarantee accuracy (inventor's the method according to this invention of conversion, also do not find that false-positive result produces), thereby prevent from flogging a dead horse in the larger stage of cost, result in greater loss.

Preferably, in the method described in the present invention the 3rd or fourth aspect, plant is paddy rice.

Preferably, in the method described in the present invention the 3rd or fourth aspect, fluorescence is red fluorescence.Like this, in the method described in third aspect present invention, screening positive plant callus is the callus that sends red fluorescence; Correspondingly, in the method described in fourth aspect present invention, retain the callus that sends red fluorescence.

More preferably the method described in third aspect present invention, it also further comprises and detects the fluorescence that plantling that plant callus develops into sends, screening positive plantling is the plantling that root sends red fluorescence.

Correspondingly, the also more preferably method described in fourth aspect present invention, it also further comprises and detects the fluorescence that plantling that plant callus develops into sends, and retains the plantling that root sends red fluorescence.

Aspect the 5th, the invention provides primer pair, its nucleotide sequence is as follows:

Tttccttcctcttttctacagt, and

gtaatgcagaagaagaccatgg。

This primer pair can for the identification of in bacterial body whether with the carrier described in first aspect present invention.

Beneficial effect of the present invention is: retain Totomycin is had to resistance, can visually be convenient to again detect and observe; Callus screening and transfer-gen plant growth phase in Genetic Transformation in Higher Plants process can be observed, and significantly improve screening accuracy; And this label is less, only need a promotor and a terminator just can control completely, the ORF without a plurality of promotors of design and/or terminator, correspondingly, can proceed to plant by larger goal gene, and not reduce transformation efficiency; The conversion carrier being built into is not easy to occur homologous recombination, and more difficult generation is the homologous recombination of Hold sticker only, makes screening itself stable, thus screening and identification transgenic positive plant, especially rice plant more fast and effectively.

For the ease of understanding, below will to the present invention, be described in detail by specific embodiment and accompanying drawing.It needs to be noted, specific examples is only in order to illustrate, does not form limitation of the scope of the invention.Obviously those of ordinary skill in the art can make various corrections and change to the present invention within the scope of the invention according to explanation herein, and these corrections and change are also included in scope of the present invention.In addition, the present invention has quoted open source literature, and these documents are also in order more clearly to describe the present invention, and their full text content is all included the present invention in and carried out reference, just look like they full text in specification sheets of the present invention repeated description excessively the same.

Accompanying drawing explanation

Fig. 1 is the qualification result figure of transgenic paddy rice, and wherein (a) is for selecting to cultivate the transgenic calli of 20 days; (b) select to cultivate the genetically modified callus of 30 days; (c) T germinateing 7 days ₁for transfer-gen plant; (d) transgenic paddy rice T ₁the root of Dai Miao, wherein every group of left side is to take under natural light, the right is the photo that fluorescence irradiates screening.

Embodiment

By specific embodiment, describe below, the process wherein not describing in detail especially, material, reagent is well known to the skilled person, can buy or consigned processing from commercial channel, also can be referring to books or the laboratory manual of molecular cloning and plant tissue culture, as wherein plant culture can be with reference to Pan Sujun etc. nuclear agricultural science is reported .2006, 20 (4): 263-268, screening and the details transforming can be with reference to Hiei Y, Ohta S, Komari T, Kumashiro T, 1994.Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.Plant Journal6, 271.

Embodiment 1 transformation pCAMBIA1300-UR carrier builds for T-DNA conversion carrier

We are on the basis of existing carrier pCAMBIA1300, designed new fusion tag, and coordinate with newly-designed promotor and terminator sequence, transformed new pCAMBIA1300-UR carrier (referred to as 1300-UR, its nucleotide sequence is as shown in SEQ ID NO:1, and this Nucleotide is circular series).This transformation process is entrusted academy of agricultural sciences, Ningbo, with reference to PCR and the point mutation technology of < < molecular cloning experiment guide > >, carries out, and then transforms bacillus coli DH 5 alpha.In order to select positive transformant, improve order-checking and hit efficiency, especially get rid of carrier from situation about connecting, before transformant checks order, first need to carry out bacterium liquid PCR, wherein need synthetic following two specific detection primers:

PCR detection system and condition are as follows:

The positive transformant that PCR detects checks order again, correct through sequence verification, returns, for the transformation experiment of plant transgene.Certainly, according to concrete carrier sequence, can also design other and build route, even in the situation that disregarding cost, can de novo synthesis.

The transgenosis that embodiment 2 is agriculture bacillus mediated and authenticate technology

The 1300-UR plasmid that embodiment 1 is obtained is transformed and is transformed into agrobacterium tumefaciens EHA105 strain (purchased from ATCC) by electricity, concrete conversion condition is: with 2500V, shock by electricity, the YEP substratum (not containing microbiotic) that adds 800 μ l, at 28 ℃, with 250rpm, recover 2 hours, then under aseptic condition, getting 100 μ l is coated on the YEP culture plate that contains 50mg/l kantlex and 50mg/l Streptomycin sulphate, cultivate 36 hours for 28 ℃, select transformant, the YEP liquid nutrient medium that access contains 50mg/l kantlex and 50mg/l Streptomycin sulphate, with 28 ℃, 250rpm shaking culture 20-36h to bacterium liquid OD600 be 0.9.Get cultured bacterium liquid 500 μ l in 1.5ml centrifuge tube, 4000rpm, centrifugal 5 minutes, abandons supernatant.Then, resuspended with 30ml AAM sense bacterium liquid (containing 200 μ mol/l As), obtain agrobacterium suspension.

Get the Rice Callus of diameter 0.5cm, put into agrobacterium suspension and infect 15 minutes.Then, callus is taken out, be placed in aseptic filter paper and drained upper 30 minute, callus is placed in to common culture medium (putting a filter paper on substratum) upper with 20 ℃ of dark cultivations three days.Callus is taken out, use sterile water wash 5 times, need therebetween ceaselessly to vibrate, and then soak 15 minutes with the sterilized water containing 400mg/l Pyocianil, then use sterile water wash 2 times, be finally placed in aseptic filter paper and drained upper two hour.

Above-mentioned cultivation the callus that drains are proceeded to containing carrying out first round selection in the screening culture medium of Cephradine and Totomycin, and culture condition is 28 ℃, 3000lux illumination cultivation 14 days; Then transfer to and in fresh screening culture medium, carry out second and take turns selection: 28 ℃, 3000lux illumination cultivation, until the callus of graininess grows.During this time, can utilize BLS lamp formula fluorimetric detector to irradiate callus, if send red fluorescence, be and transform positive callus and retain, this selects with respect to Totomycin, has significantly improved screening exactness more than 30%, significantly reduces cost and the efficiency of later stage screening.

Finally, select the callus of positive graininess, move into and to be equipped with in the differentiation tank of division culture medium, with 28 ℃, 5000lux in constant temperature culture chamber, seedling differentiation after 15-30 days.Treat that seedling grows to 5cm left and right, move in root media, with 28 ℃, natural lighting 14 days strong sprouts in constant temperature culture chamber, utilize during this time Leica fluorescence Stereo microscope, under 587nm exciting light, also can observe the red fluorescence (red fluorescence of root more easily judges) that the root of the 7th day seedling age and more ripe paddy rice sends, using as necessary supplementary identification of means, otherwise the false positive results in early stage be by the cost greatly consuming in later stage plant planting process.

Embodiment 3 comparative experimentss

Get and adopt carrier that embodiment 1 builds and pCAMBIA1300 carrier (can purchased from Australian CAMBIA), by a transcription factor gene, (its sequence is as shown in No. NM_001185683, Genbank respectively, size is 3129bp) according to conventional molecular cloning method clone Introduced into Rice, wherein conversion and screening process are with reference to plant transgenic methods such as embodiment 2, find the carrier that adopts embodiment 1 to build, positive rate improves 30%, and identify by the PCR of goal gene, find the laggard only Hold sticker of restructuring and lose the phenomenon of goal gene; Adopt the experiment of pCAMBIA1300, find 2 routine Hold stickers and lose the phenomenon of goal gene, estimate to cause because its 35S promoter drives).

Sequence table

<110> Zhejiang Academy of Agricultural Science

The fusion tag that <120> is new carries out the method for Transgenic Rice rapid screening

<130>CN

<160>1

<170>PatentIn version3.5

<210>1

<211>12330

<212>DNA

<213>Artificial Sequence

<220>

<223> annular carrier

<400>1

aattgggctg cagtgcagcg tgacccggtc gtgcccctct ctagagataa tgagcattgc 60

atgtctaagt tataaaaaat taccacatat tttttttgtc acacttgttt gaagtgcagt 120

ttatctatct ttatacatat atttaaactt tactctacga ataatataat ctatagtact 180

acaataatat cagtgtttta gagaatcata taaatgaaca gttagacatg gtctaaagga 240

caattgagta ttttgacaac aggactctac agttttatct ttttagtgtg catgtgttct 300

cctttttttt tgcaaatagc ttcacctata taatacttca tccattttat tagtacatcc 360

atttagggtt tagggttaat ggtttttata gactaatttt tttagtacat ctattttatt 420

ctattttagc ctctaaatta agaaaactaa aactctattt tagttttttt atttaataat 480

ttagatataa aatagaataa aataaagtga ctaaaaatta aacaaatacc ctttaagaaa 540

ttaaaaaaac taaggaaaca tttttcttgt ttcgagtaga taatgccagc ctgttaaacg 600

ccgtcgacga gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc gggccaagcg 660

aagcagacgg cacggcatct ctgtcgctgc ctctggaccc ctctcgagag ttccgctcca 720

ccgttggact tgctccgctg tcggcatcca gaaattgcgt ggcggagcgg cagacgtgag 780

ccggcacggc aggcggcctc ctcctcctct cacggcacgg cagctacggg ggattccttt 840

cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca 900

ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca 960

aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc cccccccctc 1020

tctaccttct ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt 1080

tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga 1140

tgcgacctgt acgtcagaca cgttctgatt gctaacttgc cagtgtttct ctttggggaa 1200

tcctgggatg gctctagccg ttccgcagac gggatcgatt tcatgatttt ttttgtttcg 1260

ttgcataggg tttggtttgc ccttttcctt tatttcaata tatgccgtgc acttgtttgt 1320

cgggtcatct tttcatgctt ttttttgtct tggttgtgat gatgtggtct ggttgggcgg 1380

tcgttctaga tcggagtaga attctgtttc aaactacctg gtggatttat taattttgga 1440

tctgtatgtg tgtgccatac atattcatag ttacgaattg aagatgatgg atggaaatat 1500

cgatctagga taggtataca tgttgatgcg ggttttactg atgcatatac agagatgctt 1560

tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg tcgttcattc gttctagatc 1620

ggagtagaat actgtttcaa actacctggt gtatttatta attttggaac tgtatgtgtg 1680

tgtcatacat cttcatagtt acgagtttaa gatggatgga aatatcgatc taggataggt 1740

atacatgttg atgtgggttt tactgatgca tatacatgat ggcatatgca gcatctattc 1800

atatgctcta accttgagta cctatctatt ataataaaca agtatgtttt ataattattt 1860

tgatcttgat atacttggat gatggcatat gcagcagcta tatgtggatt tttttagccc 1920

tgccttcata cgctatttat ttgcttggta ctgtttcttt tgtcgatgct caccctgttg 1980

tttggtgtta cttctgcagg aattcgatat caagctattc gagctcggta cccggggatc 2040

ctctagagtc gacctgcaga gctttcgttc gtatcatcgg tttcgacaac gttcgtcaag 2100

ttcaatgcat cagtttcatt gcgcacacac cagaatccta ctgagtttga gtattatggc 2160

attgggaaaa ctgtttttct tgtaccattt gttgtgcttg taatttactg tgttttttat 2220

tcggttttcg ctatcgaact gtgaaatgga aatggatgga gaagagttaa tgaatgatat 2280

ggtccttttg ttcattctca aattaatatt atttgttttt tctcttattt gttgtgtgtt 2340

gaatttgaaa ttataagaga tatgcaaaca ttttgttttg agtaaaaatg tgtcaaatcg 2400

tggcctctaa tgaccgaagt taatatgagg agtaaaacac ttgtagttgt accattatgc 2460

ttattcacta ggcaacaaat atattttcag acctagaaaa gctgcaaatg ttactgaata 2520

caagtatgtc ctcttgtgtt ttagacattt atgaactttc ctttatgtaa ttttccagaa 2580

tccttgtcag attctaatca ttgctttata attatagtta tactcatgga tttgtagttg 2640

agtatgaaaa tattttttaa tgcattttat gacttgccaa ttgattgaca acatgcatca 2700

agcttggcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 2760

cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 2820

accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgctagag cagcttgagc 2880

ttggatcaga ttgtcgtttc ccgccttcag tttaaactat cagtgtttga caggatatat 2940

tggcgggtaa acctaagaga aaagagcgtt tattagaata atcggatatt taaaagggcg 3000

tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg 3060

gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca 3120

gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc 3180

gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact 3240

tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc 3300

tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg 3360

gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag 3420

ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac 3480

cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc 3540

gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg 3600

gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc 3660

cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc 3720

accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa 3780

gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc 3840

gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc 3900

gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc 3960

accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg 4020

cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc 4080

tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa 4140

ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg 4200

tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt 4260

tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc 4320

ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag 4380

tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg 4440

cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg 4500

agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat 4560

tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa 4620

gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat 4680

caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat 4740

tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac 4800

cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga 4860

aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac 4920

acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg 4980

gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag 5040

ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc 5100

gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa 5160

aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg 5220

tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg 5280

cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac 5340

aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc 5400

agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc 5460

gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc 5520

ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg 5580

atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg 5640

gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg 5700

gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat 5760

ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg 5820

ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg 5880

tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca 5940

agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg 6000

taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc 6060

gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga 6120

tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag 6180

aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga 6240

agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga 6300

aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg 6360

gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag 6420

gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc 6480

cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt 6540

cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt 6600

taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca 6660

cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg 6720

cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca 6780

atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag 6840

gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg 6900

gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg 6960

tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga 7020

gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc 7080

ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt 7140

cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 7200

caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 7260

caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 7320

ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 7380

cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 7440

ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 7500

tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 7560

gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 7620

ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 7680

ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 7740

gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 7800

aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 7860

tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 7920

ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt 7980

ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct 8040

tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga 8100

tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat 8160

caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt 8220

gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg 8280

gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat 8340

tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg 8400

atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag 8460

ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca 8520

gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt 8580

ccagccatag catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc 8640

tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag 8700

gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg 8760

gtgatattct cattttagcc atttattatt tccttcctct tttctacagt atttaaagat 8820

accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa 8880

ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt 8940

atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta 9000

caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc 9060

gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg 9120

ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc 9180

cggtcgggga gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg 9240

cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta 9300

attcggggga tctggatttt agtactggat tttggtttta ggaattagaa attttattga 9360

tagaagtatt ttacaaatac aaatacatac taagggtttc ttatatgctc aacacatgag 9420

cgaaacccta taggaaccct aattccctta tctgggaact actcacacat tattatggag 9480

aaactcgagc ttgtcgatcg acagatcccg gtcggcatct actctattac ttgtacagct 9540

cgtccatgcc gccggtggag tggcggccct cggcgcgttc gtactgttcc acgatggtgt 9600

agtcctcgtt gtgggaggtg atgtccaact tgatgttgac gttgtaggcg ccgggcagct 9660

gcacgggctt cttggccttg taggtggtct tgacctcagc gtcgtagtgg ccgccgtcct 9720

tcagcttcag cctctgcttg atctcgccct tcagggcgcc gtcctcgggg tacatccgct 9780

cggaggaggc ctcccagccc atggtcttct tctgcattac ggggccgtcg gaggggaagt 9840

tggtgccgcg cagcttcacc ttgtagatga actcgccgtc ctgcagggag gagtcctggg 9900

tcacggtcac cacgccgccg tcctcgaagt tcatcacgcg ctcccacttg aagccctcgg 9960

ggaaggacag cttcaagtag tcggggatgt cggcggggtg cttcacgtag gccttggagc 10020

cgtacatgaa ctgaggggac aggatgtccc aggcgaaggg cagggggcca cccttggtca 10080

ccttcagctt ggcggtctgg gtgccctcgt aggggcggcc ctcgccctcg ccctcgatct 10140

cgaactcgtg gccgttcacg gagccctcca tgtgcacctt gaagcgcatg aactccttga 10200

tgatggccat gttatcctcc tcgcccttgc tcaccattcc accgcctcct ttctttgccc 10260

tcggacgagt gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg 10320

tccagacggc cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc 10380

ggacgattgc gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca 10440

agctctgata gagttggtca agaccaatgc ggagcatata cgcccggagt cgtggcgatc 10500

ctgcaagctc cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc 10560

acggcctcca gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc 10620

tccagtcaat gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat 10680

ccgcgtgcac gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga 10740

gagcctgcgc gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat 10800

ggggatcagc aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg 10860

gtccgaatgg gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatag 10920

cctccgcgac cggttgtaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga 10980

caccctgtga acggcgggag atgcaatagg tcaggctctc gctaaactcc ccaatgtcaa 11040

gcacttccgg aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt 11100

agaaaccatc ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc 11160

tgaaagcacg agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact 11220

tttcgatcag aaacttctcg acagacgtcg cggtgagttc aggctttttc atatctcatt 11280

gcccccccgg atctgcgaaa gctcgagaga gatagatttg tagagagaga ctggtgattt 11340

cagcgtgtcc tctccaaatg aaatgaactt ccttatatag aggaagggtc ttgcgaagga 11400

tagtgggatt gtgcgtcatc ccttacgtca gtggagatat cacatcaatc cacttgcttt 11460

gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct 11520

ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg 11580

catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca gatagctggg 11640

caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctt 11700

tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc 11760

atgttcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 11820

gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat 11880

agcctttcct ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct 11940

tttgatgaag tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct 12000

ttgttgaaaa gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga 12060

gtagacgaga gtgtcgtgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg 12120

cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 12180

aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 12240

gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 12300

cacacaggaa acagctatga catgattacg 12330

Claims (4)

1. with the plant transgene conversion carrier of fusion tag, it is annular carrier, and its nucleotide sequence is as follows:

aattgggctg cagtgcagcg tgacccggtc gtgcccctct ctagagataa tgagcattgc

atgtctaagt tataaaaaat taccacatat tttttttgtc acacttgttt gaagtgcagt

ttatctatct ttatacatat atttaaactt tactctacga ataatataat ctatagtact

acaataatat cagtgtttta gagaatcata taaatgaaca gttagacatg gtctaaagga

caattgagta ttttgacaac aggactctac agttttatct ttttagtgtg catgtgttct

cctttttttt tgcaaatagc ttcacctata taatacttca tccattttat tagtacatcc

atttagggtt tagggttaat ggtttttata gactaatttt tttagtacat ctattttatt

ctattttagc ctctaaatta agaaaactaa aactctattt tagttttttt atttaataat

ttagatataa aatagaataa aataaagtga ctaaaaatta aacaaatacc ctttaagaaa

ttaaaaaaac taaggaaaca tttttcttgt ttcgagtaga taatgccagc ctgttaaacg

ccgtcgacga gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc gggccaagcg

aagcagacgg cacggcatct ctgtcgctgc ctctggaccc ctctcgagag ttccgctcca

ccgttggact tgctccgctg tcggcatcca gaaattgcgt ggcggagcgg cagacgtgag

ccggcacggc aggcggcctc ctcctcctct cacggcacgg cagctacggg ggattccttt

cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca

ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca

aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc cccccccctc

tctaccttct ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt

tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga

tgcgacctgt acgtcagaca cgttctgatt gctaacttgc cagtgtttct ctttggggaa

tcctgggatg gctctagccg ttccgcagac gggatcgatt tcatgatttt ttttgtttcg

ttgcataggg tttggtttgc ccttttcctt tatttcaata tatgccgtgc acttgtttgt

cgggtcatct tttcatgctt ttttttgtct tggttgtgat gatgtggtct ggttgggcgg

tcgttctaga tcggagtaga attctgtttc aaactacctg gtggatttat taattttgga

tctgtatgtg tgtgccatac atattcatag ttacgaattg aagatgatgg atggaaatat

cgatctagga taggtataca tgttgatgcg ggttttactg atgcatatac agagatgctt

tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg tcgttcattc gttctagatc

ggagtagaat actgtttcaa actacctggt gtatttatta attttggaac tgtatgtgtg

tgtcatacat cttcatagtt acgagtttaa gatggatgga aatatcgatc taggataggt

atacatgttg atgtgggttt tactgatgca tatacatgat ggcatatgca gcatctattc

atatgctcta accttgagta cctatctatt ataataaaca agtatgtttt ataattattt

tgatcttgat atacttggat gatggcatat gcagcagcta tatgtggatt tttttagccc

tgccttcata cgctatttat ttgcttggta ctgtttcttt tgtcgatgct caccctgttg

tttggtgtta cttctgcagg aattcgatat caagctattc gagctcggta cccggggatc

ctctagagtc gacctgcaga gctttcgttc gtatcatcgg tttcgacaac gttcgtcaag

ttcaatgcat cagtttcatt gcgcacacac cagaatccta ctgagtttga gtattatggc

attgggaaaa ctgtttttct tgtaccattt gttgtgcttg taatttactg tgttttttat

tcggttttcg ctatcgaact gtgaaatgga aatggatgga gaagagttaa tgaatgatat

ggtccttttg ttcattctca aattaatatt atttgttttt tctcttattt gttgtgtgtt

gaatttgaaa ttataagaga tatgcaaaca ttttgttttg agtaaaaatg tgtcaaatcg

tggcctctaa tgaccgaagt taatatgagg agtaaaacac ttgtagttgt accattatgc

ttattcacta ggcaacaaat atattttcag acctagaaaa gctgcaaatg ttactgaata

caagtatgtc ctcttgtgtt ttagacattt atgaactttc ctttatgtaa ttttccagaa

tccttgtcag attctaatca ttgctttata attatagtta tactcatgga tttgtagttg

agtatgaaaa tattttttaa tgcattttat gacttgccaa ttgattgaca acatgcatca

agcttggcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa

cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc

accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgctagag cagcttgagc

ttggatcaga ttgtcgtttc ccgccttcag tttaaactat cagtgtttga caggatatat

tggcgggtaa acctaagaga aaagagcgtt tattagaata atcggatatt taaaagggcg

tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg

gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca

gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc

gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact

tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc

tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg

gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag

ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac

cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc

gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg

gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc

cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc

accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa

gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc

gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc

gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc

accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg

cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc

tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa

ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg

tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt

tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc

ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag

tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg

cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg

agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat

tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa

gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat

caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat

tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac

cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga

aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac

acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg

gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag

ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc

gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa

aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg

tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg

cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac

aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc

agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc

gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc

ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg

atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg

gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg

gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat

ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg

ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg

tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca

agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg

taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc

gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga

tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag

aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga

agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga

aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg

gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag

gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc

cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt

cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt

taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca

cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg

cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca

atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag

gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg

gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg

tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga

gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc

ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt

cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact

caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag

caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata

ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc

cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg

ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc

tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg

gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc

ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga

ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg

gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa

aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg

tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt

ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt

ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct

tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga

tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat

caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt

gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg

gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat

tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg

atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag

ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca

gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt

ccagccatag catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc

tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag

gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg

gtgatattct cattttagcc atttattatt tccttcctct tttctacagt atttaaagat

accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa

ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt

atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta

caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc

gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg

ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc

cggtcgggga gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg

cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta

attcggggga tctggatttt agtactggat tttggtttta ggaattagaa attttattga

tagaagtatt ttacaaatac aaatacatac taagggtttc ttatatgctc aacacatgag

cgaaacccta taggaaccct aattccctta tctgggaact actcacacat tattatggag

aaactcgagc ttgtcgatcg acagatcccg gtcggcatct actctattac ttgtacagct

cgtccatgcc gccggtggag tggcggccct cggcgcgttc gtactgttcc acgatggtgt

agtcctcgtt gtgggaggtg atgtccaact tgatgttgac gttgtaggcg ccgggcagct

gcacgggctt cttggccttg taggtggtct tgacctcagc gtcgtagtgg ccgccgtcct

tcagcttcag cctctgcttg atctcgccct tcagggcgcc gtcctcgggg tacatccgct

cggaggaggc ctcccagccc atggtcttct tctgcattac ggggccgtcg gaggggaagt

tggtgccgcg cagcttcacc ttgtagatga actcgccgtc ctgcagggag gagtcctggg

tcacggtcac cacgccgccg tcctcgaagt tcatcacgcg ctcccacttg aagccctcgg

ggaaggacag cttcaagtag tcggggatgt cggcggggtg cttcacgtag gccttggagc

cgtacatgaa ctgaggggac aggatgtccc aggcgaaggg cagggggcca cccttggtca

ccttcagctt ggcggtctgg gtgccctcgt aggggcggcc ctcgccctcg ccctcgatct

cgaactcgtg gccgttcacg gagccctcca tgtgcacctt gaagcgcatg aactccttga

tgatggccat gttatcctcc tcgcccttgc tcaccattcc accgcctcct ttctttgccc

tcggacgagt gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg

tccagacggc cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc

ggacgattgc gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca

agctctgata gagttggtca agaccaatgc ggagcatata cgcccggagt cgtggcgatc

ctgcaagctc cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc

acggcctcca gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc

tccagtcaat gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat

ccgcgtgcac gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga

gagcctgcgc gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat

ggggatcagc aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg

gtccgaatgg gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatag

cctccgcgac cggttgtaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga

caccctgtga acggcgggag atgcaatagg tcaggctctc gctaaactcc ccaatgtcaa

gcacttccgg aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt

agaaaccatc ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc

tgaaagcacg agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact

tttcgatcag aaacttctcg acagacgtcg cggtgagttc aggctttttc atatctcatt

gcccccccgg atctgcgaaa gctcgagaga gatagatttg tagagagaga ctggtgattt

cagcgtgtcc tctccaaatg aaatgaactt ccttatatag aggaagggtc ttgcgaagga

tagtgggatt gtgcgtcatc ccttacgtca gtggagatat cacatcaatc cacttgcttt

gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct

ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg

catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca gatagctggg

caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctt

tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc

atgttcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat

gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat

agcctttcct ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct

tttgatgaag tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct

ttgttgaaaa gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga

gtagacgaga gtgtcgtgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg

cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg

aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag

gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt

cacacaggaa acagctatga catgattacg

。

2. identify in bacterial body the method with carrier claimed in claim 1, it uses polymerase chain reaction bacterial body that directly increases, and wherein PCR primer pair is as follows:

Tttccttcctcttttctacagt, and

gtaatgcagaagaagaccatgg。

3. the screening method of plant transgene, wherein plant is paddy rice, it comprises,

(1) gene clone that need to proceed to plant enters carrier claimed in claim 1, and wherein gene order is as shown in No. NM_001185683, Genbank;

(2) be transformed into Agrobacterium;

(3) plant callus is transformed;

(4) culturing plants callus in containing the substratum of Totomycin; With

(5) detect the red fluorescence that plant callus sends, and detect the red fluorescence that plantling that plant callus develops into sends.

4. the method for plant transgene, wherein plant is paddy rice, it comprises,

(1) gene clone that need to proceed to plant enters carrier claimed in claim 1, and wherein gene order is as shown in No. NM_001185683, Genbank;

(2) be transformed into Agrobacterium;

(3) plant callus is transformed;

(4) culturing plants callus in containing the substratum of Totomycin; With

(5) detect the red fluorescence that plant callus sends, retain and detect positive callus, and detect the red fluorescence that plantling that plant callus develops into sends.