CN103173488A - Method for quickly screening paddy transgenes by novel fusion tag - Google Patents
Method for quickly screening paddy transgenes by novel fusion tag Download PDFInfo
- Publication number
- CN103173488A CN103173488A CN2013100826680A CN201310082668A CN103173488A CN 103173488 A CN103173488 A CN 103173488A CN 2013100826680 A CN2013100826680 A CN 2013100826680A CN 201310082668 A CN201310082668 A CN 201310082668A CN 103173488 A CN103173488 A CN 103173488A
- Authority
- CN
- China
- Prior art keywords
- plant
- callus
- carrier
- fluorescence
- transformed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a transformation vector of plant transgenes with a novel fusion tag. The vector can quickly and effectively screen and identify transgenic positive plants. In addition, the invention further provides a novel screening method of plant transgenes and a transgenic method of plants and the like.
Description
Technical field
The invention belongs to field of plant breeding, particularly, the present invention relates to the plant transgene conversion carrier of fusion tag and use the screening method etc. of its plant transgene.
Background technology
In plant (especially paddy rice) transgenic technology, the most loaded down with trivial details step is the screening of later stage transformant (strain).Mainly by marker gene screening transformant, wherein, marker gene mainly is divided into 2 classes: Select gene and reporter gene at present.
Select gene mainly comprises antibiotics resistance gene (as the HPT gene, Gent gene etc.) and anti-herbicide gene.Yet, use the serve as a mark screening method of gene of Select gene to have part false positive plant, also need further to extract Plant Genome, detect by methods such as PCR.
Reporter gene commonly used is beta-glucosiduronatase gene (β-glucuronidase gene, gus), gfp etc.These genes can carry out visual screening, it is larger that but subject matter is them, cause the T-DNA conversion carrier to become large, transformation efficiency reduces, and has to design open reading frame (ORF) under different promoters and/or terminator are controlled in order to improve transformation efficiency.
More difficult is, transgenic plant often background are complicated, might import repeatedly foreign gene, due to plant transgene promotor commonly used with the terminator type is limited and homology is higher, the homology of goal gene is also higher in addition, if reuse identical promotor and terminator, genetic recombination occurs in the time of may causing transforming, especially kept label and lost the homologous recombination of goal gene, brought larger difficulty for expensive screening of later stage, and to design different promoters and/or terminator control, more be difficult to operate in practice.
For this reason, the inventor is through long-term and arduous research, rely on some fortune, invented new fusion tag, have the function of Select gene and reporter gene concurrently, can have resistance to Totomycin, visual characteristic is arranged again, callus screening and transfer-gen plant growth phase in the rice transformation process can be observed, and significantly improve the screening exactness; And this label is less, and only needs a promotor and a terminator to control, and need not to design a plurality of promotors and/or terminator.Especially, the inventor has also done new optimization in selection and the sequence of promotor and terminator, be different from prior art, coordinate fusion tag of the present invention to use, the conversion carrier that is built into is not easy to occur homologous recombination, is not easy to occur the only homologous recombination of Hold sticker, thereby makes screening itself stable, screening and identification transgenic positive plant, especially rice plant more fast and effectively.
Summary of the invention
The technical problem to be solved in the present invention is the plant transgene conversion carrier with fusion tag that provides new, its label is less, thereby be convenient to just can control the conversion of larger goal gene under a promotor and a terminator, and adopted visual label, be more convenient for screening, coordinate promotor and terminator, screening and identification transgenic positive plant more fast and effectively.In addition, the present invention also provides the screening method of new plant transgene and method of plant transgene etc.
Particularly, in first aspect, the invention provides the plant transgene conversion carrier with fusion tag, its nucleotide sequence is as shown in SEQ ID NO:1.
This carrier is annular carrier, and namely the Nucleotide of head and the tail is connected, and connects into annular.
The multiple clone site of this carrier has SacI, KpnI, SmaI, XmaI, Acc65I and BamHI etc., enough satisfies the use as plant conversion carrier.These polyclone carriers have been contained commonly used and the low restriction endonuclease of cost, and are corresponding with the restriction enzyme site of the cloning vector of commonly using, for providing convenience to the Plant Transformation goal gene.
In second aspect, the invention provides and identify in bacterial body with the method at the described carrier of first aspect present invention, it uses polymerase chain reaction (PCR) bacterial body that directly increases, and wherein the PCR primer pair is as follows:
Tttccttcctcttttctacagt, and
gtaatgcagaagaagaccatgg。
In the process that the described carrier of first aspect present invention is cloned in thalline, when especially becoming the state of linearization, have from the situation generation that connects, need to identify for this reason; But, become rear just not the having from connecting situation of annular and occur.Except expensive methods such as order-checkings, adopt the method for second aspect present invention to identify, be the low and means easily and efficiently of cost.
Certainly, the method for preferred second aspect present invention, it also further comprises the process that carrier checks order in the thalline that bacterial body is positive that directly increases to PCR.
In the third aspect, the invention provides the screening method of plant transgene, it comprises,
(1) gene clone that needs is changed over to plant enters the described carrier of first aspect present invention;
(2) be transformed into Agrobacterium;
(3) plant callus is transformed;
(4) culturing plants callus in containing the substratum of Totomycin; With
(5) detect the fluorescence that plant callus sends.
Correspondingly, in fourth aspect, the present invention also provides the method for plant transgene, and it comprises,
(1) gene clone that needs is changed over to plant enters the described carrier of first aspect present invention;
(2) be transformed into Agrobacterium;
(3) plant callus is transformed;
(4) culturing plants callus in containing the substratum of Totomycin; With
(5) detect the fluorescence that plant callus sends, keep and detect positive callus.
Preferred the present invention the 3rd or the described method of fourth aspect, the fluorescence that its plantling that comprises further that also the detection plant callus develops into sends.So further initial stage in plant cultivation stage, at time, manpower, place and reagent cost before all larger stage arrives, make as far as possible the accuracy (inventor's the method according to this invention that guarantees conversion, do not find that also false-positive result produces), thereby prevent from flogging a dead horse in the larger stage of cost, result in greater loss.
In preferred the present invention the 3rd or the described method of fourth aspect, plant is paddy rice.
In preferred the present invention the 3rd or the described method of fourth aspect, fluorescence is red fluorescence.Like this, in the described method of third aspect present invention, the positive plant callus of screening is the callus that sends red fluorescence; Correspondingly, in the described method of fourth aspect present invention, keep the callus that sends red fluorescence.
The more preferably described method of third aspect present invention, it also further comprises and detects the fluorescence that plantling that plant callus develops into sends, the positive plantling of screening is the plantling that root sends red fluorescence.
Correspondingly, the also more preferably described method of fourth aspect present invention, it also further comprises and detects the fluorescence that plantling that plant callus develops into sends, and keeps the plantling that root sends red fluorescence.
Aspect the 5th, the invention provides primer pair, its nucleotide sequence is as follows:
Tttccttcctcttttctacagt, and
gtaatgcagaagaagaccatgg。
This primer pair can for the identification of in bacterial body whether with at the described carrier of first aspect present invention.
Beneficial effect of the present invention is: reservation has resistance to Totomycin, can visually be convenient to again detect observe; Callus screening and transfer-gen plant growth phase in the Genetic Transformation in Higher Plants process can be observed, and significantly improve the screening accuracy; And this label is less, only needs a promotor and a terminator just can control fully, need not to design the ORF of a plurality of promotors and/or terminator, correspondingly, can change larger goal gene over to plant, and not reduce transformation efficiency; The conversion carrier that is built into is not easy to occur homologous recombination, and more difficult generation is the homologous recombination of Hold sticker only, makes screening itself stable, thus screening and identification transgenic positive plant, especially rice plant more fast and effectively.
For the ease of understanding, below will describe in detail the present invention by specific embodiment and accompanying drawing.It needs to be noted, specific examples is only in order to illustrate, not consist of limitation of the scope of the invention.Obviously those of ordinary skill in the art can illustrate according to this paper, within the scope of the invention the present invention is made various corrections and change, and these corrections and change are also included in scope of the present invention.In addition, the present invention has quoted open source literature, and these documents are also in order more clearly to describe the present invention, and their full text content is all included the present invention in and carried out reference, just look like they full text in specification sheets of the present invention repeated description excessively the same.
Description of drawings
Fig. 1 is the qualification result figure of transgenic paddy rice, and wherein (a) is for selecting to cultivate the transgenic calli of 20 days; (b) select to cultivate the genetically modified callus of 30 days; (c) T that germinateed 7 days
1For transfer-gen plant; (d) transgenic paddy rice T
1The root of Dai Miao, wherein every group of left side is to take under natural light, the right is the photo of fluorescence irradiation screening.
Embodiment
below describe by specific embodiment, the process that wherein describes in detail especially, material, reagent is well known to the skilled person, can buy or consigned processing from the commercial channel, also can be referring to books or the laboratory manual of molecular cloning and plant tissue culture, as wherein plant culture can be with reference to Pan Sujun etc. nuclear agricultural science is reported .2006, 20 (4): 263-268, screening and the details that transforms can be with reference to Hiei Y, Ohta S, Komari T, Kumashiro T, 1994.Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.Plant Journal6, 271.
Embodiment 1 transformation pCAMBIA1300-UR carrier is used for the T-DNA conversion carrier and builds
We are on the basis of existing carrier pCAMBIA1300, designed new fusion tag, and coordinate with newly-designed promotor and terminator sequence, transformed new pCAMBIA1300-UR carrier (referred to as 1300-UR, its nucleotide sequence is as shown in SEQ ID NO:1, and this Nucleotide is circular series).This transformation process is entrusted the academy of agricultural sciences, Ningbo, carries out with reference to PCR and the point mutation technology of " molecular cloning experiment guide ", then transforms bacillus coli DH 5 alpha.In order to select positive transformant, improve order-checking and hit efficient, especially get rid of carrier from situation about connecting, before transformant checks order, at first need carry out bacterium liquid PCR, wherein need synthesize following two specific detection primers:
PCR detection system and condition are as follows:
The positive transformant that PCR detects checks order again, and is correct through sequence verification, returns, and is used for the transformation experiment of plant transgene.Certainly, according to concrete carrier sequence, can also design other and build route, even in the situation that disregard cost, can de novo synthesis.
The transgenosis that embodiment 2 is agriculture bacillus mediated and authenticate technology
the 1300-UR plasmid that embodiment 1 is obtained transforms by electricity and is transformed into agrobacterium tumefaciens EHA105 strain (available from ATCC), concrete conversion condition is: shock by electricity with 2500V, the YEP substratum (not containing microbiotic) that adds 800 μ l, recovered 2 hours with 250rpm at 28 ℃, then under aseptic condition, getting 100 μ l is coated on the YEP culture plate that contains 50mg/l kantlex and 50mg/l Streptomycin sulphate, cultivated 36 hours for 28 ℃, select transformant, access contains the YEP liquid nutrient medium of 50mg/l kantlex and 50mg/l Streptomycin sulphate, with 28 ℃, 250rpm shaking culture 20-36h to bacterium liquid OD600 be 0.9.Get cultured bacterium liquid 500 μ l in the 1.5ml centrifuge tube, 4000rpm centrifugal 5 minutes, abandons supernatant.Then, resuspended with 30ml AAM sense bacterium liquid (containing 200 μ mol/l As), get agrobacterium suspension.
Get the Rice Callus of diameter 0.5cm, put into agrobacterium suspension and infected 15 minutes.Then, callus is taken out, be placed in aseptic filter paper and drained upper 30 minute, callus is placed in common culture medium (putting a filter paper on substratum) upper with 20 ℃ of dark cultivations three days.Callus is taken out, use sterile water wash 5 times, need ceaselessly vibration therebetween, and then soaked 15 minutes with the sterilized water that contains the 400mg/l Pyocianil, then use sterile water wash 2 times, be placed at last aseptic filter paper and drained upper two hour.
Above-mentioned cultivation and the callus that drains are changed over to carry out the first round on the screening culture medium that contains Cephradine and Totomycin and select, culture condition is 28 ℃, 3000lux illumination cultivation 14 days; Then transfer to and carry out second on fresh screening culture medium and take turns selection: 28 ℃, 3000lux illumination cultivation, until the callus of graininess grows.During this time, namely can utilize BLS lamp formula fluorimetric detector irradiation callus, if send red fluorescence, be and transform positive callus and keep, this selects with respect to Totomycin, has significantly improved the screening exactness more than 30%, significantly reduces cost and the efficient of later stage screening.
At last, select the callus of positive graininess, move into and be equipped with in the differentiation tank of division culture medium, with 28 ℃, 5000lux in the constant temperature culture chamber, seedling differentiation after 15-30 days.Treat that seedling grows to the 5cm left and right, move in root media, with 28 ℃, natural lighting 14 days strong sprouts in the constant temperature culture chamber, utilize during this time Leica fluorescence Stereo microscope, under the 587nm exciting light, also can observe the red fluorescence (red fluorescence of root more easily judge) that the root of the 7th day seedling age and more ripe paddy rice sends, with the additional identification of means as necessity, otherwise false positive results in earlier stage will greatly consume the cost in later stage plant planting process.
Embodiment 3 comparative experimentss
Get and adopt carrier that embodiment 1 builds and pCAMBIA1300 carrier (can available from Australian CAMBIA), (its sequence is as shown in No. NM_001185683, Genbank with a transcription factor gene respectively, size is 3129bp) according to conventional molecular cloning method clone and Introduced into Rice, wherein conversion and screening process are with reference to plant transgenic methods such as embodiment 2, find to adopt the carrier of embodiment 1 structure, positive rate improves 30%, and the PCR by goal gene identifies, finds the laggard only Hold sticker of restructuring and loses the phenomenon of goal gene; Adopt the experiment of pCAMBIA1300, find 2 routine Hold stickers and lose the phenomenon of goal gene, estimate to cause because its 35S promoter drives).
Sequence table
<110〉Zhejiang Academy of Agricultural Science
<120〉new fusion tag carries out the method for Transgenic Rice rapid screening
<130>CN
<160>1
<170>PatentIn version3.5
<210>1
<211>12330
<212>DNA
<213>Artificial Sequence
<220>
<223〉annular carrier
<400>1
aattgggctg cagtgcagcg tgacccggtc gtgcccctct ctagagataa tgagcattgc 60
atgtctaagt tataaaaaat taccacatat tttttttgtc acacttgttt gaagtgcagt 120
ttatctatct ttatacatat atttaaactt tactctacga ataatataat ctatagtact 180
acaataatat cagtgtttta gagaatcata taaatgaaca gttagacatg gtctaaagga 240
caattgagta ttttgacaac aggactctac agttttatct ttttagtgtg catgtgttct 300
cctttttttt tgcaaatagc ttcacctata taatacttca tccattttat tagtacatcc 360
atttagggtt tagggttaat ggtttttata gactaatttt tttagtacat ctattttatt 420
ctattttagc ctctaaatta agaaaactaa aactctattt tagttttttt atttaataat 480
ttagatataa aatagaataa aataaagtga ctaaaaatta aacaaatacc ctttaagaaa 540
ttaaaaaaac taaggaaaca tttttcttgt ttcgagtaga taatgccagc ctgttaaacg 600
ccgtcgacga gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc gggccaagcg 660
aagcagacgg cacggcatct ctgtcgctgc ctctggaccc ctctcgagag ttccgctcca 720
ccgttggact tgctccgctg tcggcatcca gaaattgcgt ggcggagcgg cagacgtgag 780
ccggcacggc aggcggcctc ctcctcctct cacggcacgg cagctacggg ggattccttt 840
cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac cccctccaca 900
ccctctttcc ccaacctcgt gttgttcgga gcgcacacac acacaaccag atctccccca 960
aatccacccg tcggcacctc cgcttcaagg tacgccgctc gtcctccccc cccccccctc 1020
tctaccttct ctagatcggc gttccggtcc atggttaggg cccggtagtt ctacttctgt 1080
tcatgtttgt gttagatccg tgtttgtgtt agatccgtgc tgctagcgtt cgtacacgga 1140
tgcgacctgt acgtcagaca cgttctgatt gctaacttgc cagtgtttct ctttggggaa 1200
tcctgggatg gctctagccg ttccgcagac gggatcgatt tcatgatttt ttttgtttcg 1260
ttgcataggg tttggtttgc ccttttcctt tatttcaata tatgccgtgc acttgtttgt 1320
cgggtcatct tttcatgctt ttttttgtct tggttgtgat gatgtggtct ggttgggcgg 1380
tcgttctaga tcggagtaga attctgtttc aaactacctg gtggatttat taattttgga 1440
tctgtatgtg tgtgccatac atattcatag ttacgaattg aagatgatgg atggaaatat 1500
cgatctagga taggtataca tgttgatgcg ggttttactg atgcatatac agagatgctt 1560
tttgttcgct tggttgtgat gatgtggtgt ggttgggcgg tcgttcattc gttctagatc 1620
ggagtagaat actgtttcaa actacctggt gtatttatta attttggaac tgtatgtgtg 1680
tgtcatacat cttcatagtt acgagtttaa gatggatgga aatatcgatc taggataggt 1740
atacatgttg atgtgggttt tactgatgca tatacatgat ggcatatgca gcatctattc 1800
atatgctcta accttgagta cctatctatt ataataaaca agtatgtttt ataattattt 1860
tgatcttgat atacttggat gatggcatat gcagcagcta tatgtggatt tttttagccc 1920
tgccttcata cgctatttat ttgcttggta ctgtttcttt tgtcgatgct caccctgttg 1980
tttggtgtta cttctgcagg aattcgatat caagctattc gagctcggta cccggggatc 2040
ctctagagtc gacctgcaga gctttcgttc gtatcatcgg tttcgacaac gttcgtcaag 2100
ttcaatgcat cagtttcatt gcgcacacac cagaatccta ctgagtttga gtattatggc 2160
attgggaaaa ctgtttttct tgtaccattt gttgtgcttg taatttactg tgttttttat 2220
tcggttttcg ctatcgaact gtgaaatgga aatggatgga gaagagttaa tgaatgatat 2280
ggtccttttg ttcattctca aattaatatt atttgttttt tctcttattt gttgtgtgtt 2340
gaatttgaaa ttataagaga tatgcaaaca ttttgttttg agtaaaaatg tgtcaaatcg 2400
tggcctctaa tgaccgaagt taatatgagg agtaaaacac ttgtagttgt accattatgc 2460
ttattcacta ggcaacaaat atattttcag acctagaaaa gctgcaaatg ttactgaata 2520
caagtatgtc ctcttgtgtt ttagacattt atgaactttc ctttatgtaa ttttccagaa 2580
tccttgtcag attctaatca ttgctttata attatagtta tactcatgga tttgtagttg 2640
agtatgaaaa tattttttaa tgcattttat gacttgccaa ttgattgaca acatgcatca 2700
agcttggcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 2760
cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 2820
accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgctagag cagcttgagc 2880
ttggatcaga ttgtcgtttc ccgccttcag tttaaactat cagtgtttga caggatatat 2940
tggcgggtaa acctaagaga aaagagcgtt tattagaata atcggatatt taaaagggcg 3000
tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg 3060
gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca 3120
gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc 3180
gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact 3240
tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc 3300
tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg 3360
gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag 3420
ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac 3480
cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc 3540
gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg 3600
gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc 3660
cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc 3720
accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa 3780
gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc 3840
gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc 3900
gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc 3960
accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg 4020
cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc 4080
tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa 4140
ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg 4200
tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt 4260
tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc 4320
ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag 4380
tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg 4440
cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg 4500
agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat 4560
tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa 4620
gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat 4680
caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat 4740
tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac 4800
cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga 4860
aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac 4920
acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg 4980
gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag 5040
ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc 5100
gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa 5160
aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg 5220
tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg 5280
cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac 5340
aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc 5400
agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc 5460
gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc 5520
ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg 5580
atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg 5640
gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg 5700
gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat 5760
ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg 5820
ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg 5880
tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca 5940
agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg 6000
taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc 6060
gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga 6120
tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag 6180
aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga 6240
agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga 6300
aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg 6360
gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag 6420
gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc 6480
cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt 6540
cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt 6600
taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca 6660
cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg 6720
cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca 6780
atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag 6840
gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg 6900
gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg 6960
tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga 7020
gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc 7080
ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt 7140
cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 7200
caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 7260
caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 7320
ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 7380
cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 7440
ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 7500
tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 7560
gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 7620
ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 7680
ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 7740
gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 7800
aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 7860
tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 7920
ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt 7980
ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct 8040
tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga 8100
tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat 8160
caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt 8220
gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg 8280
gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat 8340
tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg 8400
atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag 8460
ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca 8520
gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt 8580
ccagccatag catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc 8640
tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag 8700
gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg 8760
gtgatattct cattttagcc atttattatt tccttcctct tttctacagt atttaaagat 8820
accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa 8880
ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt 8940
atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta 9000
caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc 9060
gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg 9120
ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc 9180
cggtcgggga gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg 9240
cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta 9300
attcggggga tctggatttt agtactggat tttggtttta ggaattagaa attttattga 9360
tagaagtatt ttacaaatac aaatacatac taagggtttc ttatatgctc aacacatgag 9420
cgaaacccta taggaaccct aattccctta tctgggaact actcacacat tattatggag 9480
aaactcgagc ttgtcgatcg acagatcccg gtcggcatct actctattac ttgtacagct 9540
cgtccatgcc gccggtggag tggcggccct cggcgcgttc gtactgttcc acgatggtgt 9600
agtcctcgtt gtgggaggtg atgtccaact tgatgttgac gttgtaggcg ccgggcagct 9660
gcacgggctt cttggccttg taggtggtct tgacctcagc gtcgtagtgg ccgccgtcct 9720
tcagcttcag cctctgcttg atctcgccct tcagggcgcc gtcctcgggg tacatccgct 9780
cggaggaggc ctcccagccc atggtcttct tctgcattac ggggccgtcg gaggggaagt 9840
tggtgccgcg cagcttcacc ttgtagatga actcgccgtc ctgcagggag gagtcctggg 9900
tcacggtcac cacgccgccg tcctcgaagt tcatcacgcg ctcccacttg aagccctcgg 9960
ggaaggacag cttcaagtag tcggggatgt cggcggggtg cttcacgtag gccttggagc 10020
cgtacatgaa ctgaggggac aggatgtccc aggcgaaggg cagggggcca cccttggtca 10080
ccttcagctt ggcggtctgg gtgccctcgt aggggcggcc ctcgccctcg ccctcgatct 10140
cgaactcgtg gccgttcacg gagccctcca tgtgcacctt gaagcgcatg aactccttga 10200
tgatggccat gttatcctcc tcgcccttgc tcaccattcc accgcctcct ttctttgccc 10260
tcggacgagt gctggggcgt cggtttccac tatcggcgag tacttctaca cagccatcgg 10320
tccagacggc cgcgcttctg cgggcgattt gtgtacgccc gacagtcccg gctccggatc 10380
ggacgattgc gtcgcatcga ccctgcgccc aagctgcatc atcgaaattg ccgtcaacca 10440
agctctgata gagttggtca agaccaatgc ggagcatata cgcccggagt cgtggcgatc 10500
ctgcaagctc cggatgcctc cgctcgaagt agcgcgtctg ctgctccata caagccaacc 10560
acggcctcca gaagaagatg ttggcgacct cgtattggga atccccgaac atcgcctcgc 10620
tccagtcaat gaccgctgtt atgcggccat tgtccgtcag gacattgttg gagccgaaat 10680
ccgcgtgcac gaggtgccgg acttcggggc agtcctcggc ccaaagcatc agctcatcga 10740
gagcctgcgc gacggacgca ctgacggtgt cgtccatcac agtttgccag tgatacacat 10800
ggggatcagc aatcgcgcat atgaaatcac gccatgtagt gtattgaccg attccttgcg 10860
gtccgaatgg gccgaacccg ctcgtctggc taagatcggc cgcagcgatc gcatccatag 10920
cctccgcgac cggttgtaga acagcgggca gttcggtttc aggcaggtct tgcaacgtga 10980
caccctgtga acggcgggag atgcaatagg tcaggctctc gctaaactcc ccaatgtcaa 11040
gcacttccgg aatcgggagc gcggccgatg caaagtgccg ataaacataa cgatctttgt 11100
agaaaccatc ggcgcagcta tttacccgca ggacatatcc acgccctcct acatcgaagc 11160
tgaaagcacg agattcttcg ccctccgaga gctgcatcag gtcggagacg ctgtcgaact 11220
tttcgatcag aaacttctcg acagacgtcg cggtgagttc aggctttttc atatctcatt 11280
gcccccccgg atctgcgaaa gctcgagaga gatagatttg tagagagaga ctggtgattt 11340
cagcgtgtcc tctccaaatg aaatgaactt ccttatatag aggaagggtc ttgcgaagga 11400
tagtgggatt gtgcgtcatc ccttacgtca gtggagatat cacatcaatc cacttgcttt 11460
gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct 11520
ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg 11580
catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca gatagctggg 11640
caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctt 11700
tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc 11760
atgttcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 11820
gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat 11880
agcctttcct ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct 11940
tttgatgaag tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct 12000
ttgttgaaaa gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga 12060
gtagacgaga gtgtcgtgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg 12120
cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 12180
aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 12240
gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 12300
cacacaggaa acagctatga catgattacg 12330
Claims (10)
1. with the plant transgene conversion carrier of fusion tag, its nucleotide sequence is as shown in SEQ ID NO:1.
2. carrier claimed in claim 1, it is annular carrier.
3. carrier claimed in claim 1, its multiple clone site has SacI, KpnI, SmaI, XmaI, Acc65I and BamHI.
In the evaluation bacterial body with the method for arbitrary described carrier of claim 1-3, it uses polymerase chain reaction (PCR) bacterial body that directly increases, wherein the PCR primer pair is as follows:
Tttccttcctcttttctacagt, and
gtaatgcagaagaagaccatgg。
5. the screening method of plant transgene, it comprises,
(1) gene clone that needs is changed over to plant enters the arbitrary described carrier of claim 1-3;
(2) be transformed into Agrobacterium;
(3) plant callus is transformed;
(4) culturing plants callus in containing the substratum of Totomycin; With
(5) detect the fluorescence that plant callus sends.
6. the method for plant transgene, it comprises,
(1) gene clone that needs is changed over to plant enters the arbitrary described carrier of claim 1-3;
(2) be transformed into Agrobacterium;
(3) plant callus is transformed;
(4) culturing plants callus in containing the substratum of Totomycin; With
(5) detect the fluorescence that plant callus sends, keep and detect positive callus.
7. the described method of claim 5 or 6, it also further comprises and detects the fluorescence that plantling that plant callus develops into sends.
8. the described method of claim 5 or 6, wherein plant is paddy rice.
9. the described method of claim 5 or 6, wherein fluorescence is red fluorescence.
10. primer pair, its nucleotide sequence is as follows:
Tttccttcctcttttctacagt, and
gtaatgcagaagaagaccatgg。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310082668.0A CN103173488B (en) | 2013-03-14 | 2013-03-14 | Method for quickly screening paddy transgenes by novel fusion tag |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310082668.0A CN103173488B (en) | 2013-03-14 | 2013-03-14 | Method for quickly screening paddy transgenes by novel fusion tag |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103173488A true CN103173488A (en) | 2013-06-26 |
CN103173488B CN103173488B (en) | 2014-09-03 |
Family
ID=48633676
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310082668.0A Expired - Fee Related CN103173488B (en) | 2013-03-14 | 2013-03-14 | Method for quickly screening paddy transgenes by novel fusion tag |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103173488B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112075343A (en) * | 2020-09-22 | 2020-12-15 | 云南中烟工业有限责任公司 | Method for simply, conveniently and effectively detecting existence of label in tobacco gene editing material |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995016031A1 (en) * | 1993-12-08 | 1995-06-15 | Japan Tobacco Inc. | Method of transforming plant and vector therefor |
WO1998056923A1 (en) * | 1997-06-12 | 1998-12-17 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
-
2013
- 2013-03-14 CN CN201310082668.0A patent/CN103173488B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995016031A1 (en) * | 1993-12-08 | 1995-06-15 | Japan Tobacco Inc. | Method of transforming plant and vector therefor |
WO1998056923A1 (en) * | 1997-06-12 | 1998-12-17 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
Non-Patent Citations (1)
Title |
---|
李亚丽等: "转mCherry基因水稻的遗传分析及T-DNA整合位点的研究", 《分子植物育种》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112075343A (en) * | 2020-09-22 | 2020-12-15 | 云南中烟工业有限责任公司 | Method for simply, conveniently and effectively detecting existence of label in tobacco gene editing material |
Also Published As
Publication number | Publication date |
---|---|
CN103173488B (en) | 2014-09-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111378679B (en) | Gene expression assembly, cloning vector constructed by same and application of cloning vector | |
CN111394369B (en) | Glyphosate-resistant EPSPS mutant gene, plant genetic transformation screening vector containing glyphosate-resistant EPSPS mutant gene and application of glyphosate-resistant EPSPS mutant gene | |
CN113430225A (en) | Vector for analyzing expression specificity of plant promoter, preparation method and application thereof | |
CN110951736B (en) | Nuclear localization signal F4NLS and application thereof in improving base editing efficiency and expanding editable base range | |
CN103173488B (en) | Method for quickly screening paddy transgenes by novel fusion tag | |
CN110982818B (en) | Application of nuclear localization signal F4NLS in efficient creation of rice herbicide resistant material | |
CN110951773B (en) | Application of FNLS-sABE system in creating rice herbicide resistant material | |
CN101892259B (en) | SiRNA plant gene expression vector and construction method and application thereof | |
CN110964742B (en) | Preparation method of herbicide-resistant rice | |
KR101835852B1 (en) | Method for Genetic Engineering of Deinococcus Microorganisms Using Cre-lox System | |
CN107988226A (en) | A kind of identification and application of the special High-expression promoter of Rice Callus | |
CN110484560B (en) | Method for producing barren-resistant rice containing HVUL2H20083.2 gene | |
CN110878323B (en) | Application of protoplast of arabidopsis mutant in analysis of signal transduction pathway | |
KR102181720B1 (en) | Mutant strain having increased lycopene productivity | |
CN111961126B (en) | Application of TaVQ25 gene in regulation and control of resistance of wheat to powdery mildew and banded sclerotial blight | |
KR101927892B1 (en) | Manufacturing method of mutant strain having increased phytoene productivity and mutant strain manufactured same | |
CN111961684B (en) | Method for improving disease resistance of wheat by inhibiting expression of TaVQ5 gene in wheat | |
KR102281973B1 (en) | Polycistronic Expression System for Plants | |
CN112280799B (en) | Method for site-directed mutagenesis of hevea brasiliensis or dandelion gene by using CRISPR/Cas9 system | |
CN112538477B (en) | Application of xCas9 gene editing system in genome editing | |
CN110195067B (en) | Method for cultivating glufosinate-ammonium-resistant rape | |
CN110904143A (en) | Multifunctional glyphosate-resistant rice transformation vector pCDMAR-epsps and construction method and application thereof | |
CN113684224A (en) | Method for efficient genetic transformation of arabidopsis thaliana | |
CN111896506A (en) | Method for rapidly identifying transgenic arabidopsis positive plants | |
CN113462697B (en) | Degradable glyphosate-resistant gene, plant expression vector, cultivation method of degradable glyphosate-resistant transgenic rice and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140903 Termination date: 20150314 |
|
EXPY | Termination of patent right or utility model |