CN110195067B - Method for cultivating glufosinate-ammonium-resistant rape - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for cultivating glufosinate-resistant rape, which is characterized in that glufosinate-resistant gene Syn1-Rep is introduced into a genome of a cabbage type rape receptor, exogenous genes can be stably inherited in offspring and keep the corresponding glufosinate-resistant herbicide characteristics, so that labor resources can be saved, the rape planting benefit can be improved, and the method is environment-friendly.

Description

Method for cultivating glufosinate-ammonium-resistant rape

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for cultivating glufosinate-resistant rape.

Background

Rape is an important economic crop in China, and the weed damage is one of the main factors restricting the production and development of rape (Brassica napus) in China. The method for removing the weeds in the rape field mainly comprises artificial weeding and chemical herbicide application. The manual weeding consumes long time and large amount of labor, obviously increases the field operation cost, reduces the benefits of farmers, and restricts the mechanized large-scale planting of the rapes. The chemical weeding has low cost, is quick and efficient, and becomes an important matched cultivation measure for mechanized direct seeding.

Glufosinate is a non-selective herbicide, firstly causes damage to plant leaves, and can effectively control the growth of perennial grass weeds and broadleaf weeds in the field. The herbicide has weak systemic action and is mainly conducted on xylem through transpiration of plants. Glufosinate has an inhibitory effect on Glutamine Synthetase (GS), inactivation of glutamine synthetase disturbs nitrogen metabolism in plants, the efficiency of conversion of inorganic nitrogen into organic nitrogen is reduced, toxic ammonia and glyoxylic acid rapidly accumulate in plants, photosynthesis of plants is finally inhibited, leaf tissue and plant yellowing necrosis (Jalaludin, a., Yu, q., Zoellner, p., Beffa, r.and Powles, S.B. (2017), chartacteriodicine of photosynthesis metabolism in Eleusine index.pest.man. sci; emerald, 2018) is finally observed.

Therefore, the development of the rape with the glufosinate-ammonium resistance has important significance for the industrial development of the rape industry in China. Firstly, the annual weed generation area of China is close to 0.97 hundred million hectares, which is equivalent to 80% of the crop planting area, the weed damage is one of the obstacles influencing the high yield and high quality of the rape, and the weed damage can cause the annual yield reduction of the rape to 15-20%. Secondly, in the Yangtze river basin winter rape area (which occupies more than 85% of the area of rape in China) in the main production area of the rape in China, dicotyledonous weeds are mainly used, and because the rape is extremely sensitive to herbicides for preventing and removing the dicotyledonous weeds, no ideal herbicide for the broad leaf weeds of the gemini leaves is available at present. Third, glufosinate and its metabolites are harmless to animals and microbes in the soil, and at the same time, are easily degradable in the soil, do not affect the soil structure, and do not remain in the soil to affect the succeeding crops. Fourthly, through large-scale screening, a resistance gene resource for effectively controlling the weeds in the rapes is not found at present. Therefore, the transgenic breeding of glufosinate-resistant rape is the most effective way to solve the above problems.

At present, 27 glufosinate-resistant transgenic brassica napus lines are used for commercial production all over the world, and the glufosinate-resistant genes are pat, pat (sy) and bar. However, both these resistant lines and the resistance genes have patent and promotional rights by foreign companies.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a method for cultivating glufosinate-resistant rape.

The invention is realized in such a way that the cultivation method of the glufosinate-resistant rape comprises the following steps:

s1: obtaining a foreign gene Syn1-Rep fragment, wherein the nucleotide sequence of the foreign gene Syn1-Rep is shown in SEQ ID NO: 1;

s2: constructing an expression vector, and connecting the expression vector with a foreign gene to obtain a recombinant vector;

s3, introducing the recombinant vector into Escherichia coli DH5 α for verification;

s4: extracting the successfully verified plasmid, and introducing the plasmid into an agrobacterium strain to obtain a transformation engineering bacterium;

s5: introducing the transformed engineering bacteria into plant tissues by utilizing an agrobacterium-mediated genetic transformation method;

s6: and (5) detecting the transgenic plants.

Further, step S6 is followed by step S7: and (4) performing phenotype identification on the transgenic plant.

Further, the expression vector used in step S2 is a pCAMBIA1300 vector.

Further, in step S3, the recombinant vector was introduced into E.coli DH5 α by heat shock.

Further, in step S4, the agrobacterium is agrobacterium GV 3101.

Further, in step S4, the plasmid is introduced into the Agrobacterium strain by electrical transformation.

Further, in step S5, the plant tissue is the mature seed of brassica napus variety a177 sown with hypocotyls cultured in the dark.

Further, in step S6, the transgenic plant is detected by PCR method and/or Southern hybridization technique.

Further, in the step S6, in the process of detecting the transgenic plants by adopting the PCR method, primers for amplifying the Syn1-Rep gene are respectively F: 5'-TCCGAACTTTCTTCCCAC-3', and the sequences are shown in SEQ ID NO: 5'-CACAATCCCACTATCCTTC-3', and the sequence is shown in SEQ ID NO: 4.

furthermore, the insertion position of the exogenous gene Syn1-Rep is 870188 of the rape genome A04random chromosome.

In summary, the advantages and positive effects of the invention are: the invention optimizes the carrier structure and codon of the gene, and introduces glufosinate-resistant gene Syn1-Rep into receptor rape A177 by adopting agrobacterium-mediated cabbage rape genetic transformation method. Detecting the positive rate of the transformed plants by a PCR method, determining the copy number by Southern hybridization, separating by a reverse PCR method to obtain flanking sequences, determining the resistance of the transgenic rape to glufosinate by RT-PCR determined expression and glufosinate resistance identification test, and finally obtaining the glufosinate rape strain OV40 which has single copy and is integrated in an intergenic region, has normal high resistance expressed by the Syn1-Rep gene and has no obvious difference in agronomic characters and original varieties.

(1) According to the invention, the glufosinate-resistant gene Syn1-Rep is introduced into the genome of the recipient brassica napus, and the exogenous gene can be stably inherited in progeny and keep the corresponding glufosinate-resistant herbicide characteristic, so that the labor resources can be saved, the rape planting benefit can be improved, and the method is environment-friendly.

(2) The position of the glufosinate-ammonium gene Syn1-Rep in the rape genome is different from any other glufosinate-ammonium-resistant rape containing similar genes.

(3) The insertion site of the transgene in the rape does not influence the function of other rape genes.

(4) The glufosinate-ammonium-resistant gene transgenic material can transfer the characteristics of exogenous genes and glufosinate-ammonium resistance to other rape varieties in conventional modes such as hybridization and backcross, and further culture a new transgenic glufosinate-ammonium-resistant herbicide strain or a new transgenic glufosinate-ammonium-resistant herbicide variety.

Drawings

FIG. 1 is a map of the starting plasmid pCAMBIA1300 of the present invention;

FIG. 2 is a schematic diagram of the T-DNA region of the transformation vector pTGH-1;

FIG. 3 is a schematic diagram of the transformation process of the pTGH-1 vector;

FIG. 4 shows the PCR amplification result of Syn1-Rep transgenic plants;

FIG. 5 is the Southern hybridization result of transgenic Brassica napus T0 plants;

FIG. 6 is a graph comparing test results of resistance to glufosinate spray for transgenic and non-transgenic brassica napus;

FIG. 7 is an alignment of flanking sequences;

FIG. 8 shows the result of electrophoresis of the foreign gene.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention discloses a method for cultivating glufosinate-resistant rape, which comprises the following steps: the pCAMBIA1300 plasmid is used as an initial plasmid to construct an expression vector pTGH-1 containing a target gene Syn 1-Rep. Meanwhile, after the cabbage type canola A177 seeds are disinfected, dark light culture is carried out on a seeding culture medium; then, infecting agrobacterium of an expression vector pTGH-1 containing a target gene Syn1-Rep and hypocotyls of the brassica napus after tissue culture by engineering bacteria liquid (infection liquid) prepared by the agrobacterium, then performing co-culture on a co-culture medium, and screening on a callus induction medium containing glufosinate (glufosinate) to obtain resistant callus; transferring the resistant callus to a differentiation medium for induced differentiation, cutting off the primary roots on the explant when the differentiated explant regenerates complete buds, and placing the explant on a rooting medium for rooting culture; when the new roots grow to about 3cm, the new roots are transferred to a greenhouse for strong seedling and then planted in the field. These regenerated seedlings are T₀Transgenic plants are generated. At T₀During the growth of the generation plant, extracting leaf genome DNA by a CTAB method, and identifying the copy number of the gene by Southern hybridization; and carrying out a glufosinate resistance test to investigate the agronomic characters. The vector plasmids and the like used in the present invention are known and commonly used unless otherwise specified.

The following examples are specific.

EXAMPLE 1 acquisition of foreign Gene Syn1-Rep and construction of expression vector

The glufosinate-ammonium resistance gene Syn1-Rep used in this study was cloned from a marine strain (Rhodococcus sp. strain YM12) by Wu soldier, university of agriculture in Huazhong, and the original sequence of the glufosinate-ammonium resistance gene Syn1-Rep was cloned and provided by the subject group of professor Liu bell, institute of Life science and technology, university of agriculture in Huazhong. The foreign gene RePAT is subjected to codon optimization on the basis of not changing an amino acid sequence, and a target gene Syn1-Rep is obtained by artificial synthesis, wherein the nucleotide sequence is shown in SEQ ID NO: 1. the Syn1-Rep gene is 492bp long and codes 162 amino acids.

The RePAT gene has 99.629% identity with the gene sequence of Rhodococcus equi through sequence alignment, so that the strain is identified to be derived from the Rhodococcus and has extremely high glufosinate-ammonium resistance when expressed in Escherichia coli (E. The protease expressed therein maintained a considerable activity at pH8.0, with an optimum temperature of 35 ℃ and, interestingly, it had an enzymatic activity of more than 50% at a temperature of 0 to 10 ℃. Based on the BLASTP amino acid alignment results, Syn1-Rep was classified as an N-acetyltransferase (GNAT) family related to GCN5 (PF00583) with only 37% identity to the amino acid sequence of the pat, pat (sy) and bar genes that have enjoyed patent protection.

The invention takes pCAMBIA1300 plasmid as an initial plasmid to construct an expression vector pTGH-1 containing a target gene Syn 1-Rep. The map of pCAMBIA1300 plasmid is shown in figure 1, and the plasmid is used as a skeleton to construct an expression vector; a schematic diagram of the T-DNA region of the transformation vector pTGH-1 is shown in FIG. 2.

The specific construction process of the expression vector comprises the following steps: the vector pCAMBIA1300 plasmid is connected with a target gene Syn1-Rep fragment to obtain a recombinant vector OV40, namely an expression vector pTGH-1, wherein the connection experimental scheme adopts a standard program known in the field, the T4DNA ligase is used for connection, then escherichia coli competent cells are transformed, a kan resistant plate is coated, monoclonal shake bacteria are selected, positive clones are identified, and the detailed process is not repeated. The nucleotide sequence of the recombinant vector OV40 is shown in SEQ ID NO: 2.

subsequently, the recombinant vector is introduced into escherichia coli DH5 α by a heat shock mode for verification, plasmids which are verified to be positive are extracted, the plasmids are electrically transferred into agrobacterium strain GV3101 to prepare transformation engineering bacteria, and the transformation engineering bacteria are frozen and stored in a refrigerator at the temperature of 80 ℃ below zero for later use.

Example 2 Agrobacterium-mediated genetic transformation

The transformation receptor used in this example was the mature seed of Brassica napus variety A177 sown with hypocotyls cultured in the dark. The gene-transformed receptor variety cabbage type rape A177 is a granule pure line, the applicant names the variety cabbage type rape A177, and the cabbage type rape A177 is delivered to China, Wuhan university China type culture Collection (CCTCC) for preservation at 11/20 th 2009, and the preservation number is CCTCC NO: p200908. The agrobacterium-mediated genetic transformation method refers to a common method in professor Zhouyangming laboratories in the national center of crop genetic improvement of university of agriculture in Huazhong, and specifically comprises the following steps:

mature seeds of Brassica napus variety A177 are sterilized and inoculated into a seeding medium (i.e., M)₀Culture medium) and culturing in the dark for 7 days, germinating hypocotyls from the seeds, cutting the hypocotyls into 0.8-1.2 cm pieces, infecting (infection solution, i.e., DM solution) the hypocotyl explants with an engineering bacteria solution of Agrobacterium containing transformation vector pTGH-1 for 10-15min, co-culturing at 28 deg.C in the dark (co-culture medium, i.e., M₁Culture Medium) 2d later in callus induction culture Medium (i.e., M)₂Culture medium supplemented with 25mg/L glufosinate ammonium), after about 20 days, the explant was seen to have enlarged incisions at both ends, and transferred to a differentiation medium (i.e., M) for inducing shoot regeneration₃Culture medium), green buds can appear in about 30 days; cutting off the primary roots from the explants, placing the differentiated regenerated shoots in a rooting medium (i.e., M)₄Culture medium) for about 15 days, a large number of root systems grow, seedlings forming the large number of root systems have independent growth capacity, can survive and grow normally when transplanted to a greenhouse, and the transformation process of the pTGH-1 vector is shown in figure 3, wherein A in figure 3: sowing; panel B in fig. 3: culturing hypocotyls; panel C in fig. 3: co-culturing; graph D in fig. 3: resistance callus induction; panels E and F in fig. 3: differentiation induced adventitious buds.

In a transformation test, 1400 hypocotyl explants and engineering bacteria liquid of a pTGH-1 transformation vector are co-cultured, and the final seedling is 128 strains, the differentiation efficiency is 9.14%, which is shown in Table 1.

TABLE 1 Agrobacterium-mediated genetic transformation results

The main steps of genetic transformation, the culture medium and the preparation method thereof of the invention are as follows:

(1) reagent and solution abbreviations

The names and abbreviations of the main reagents involved in the preparation of the medium according to the present invention are as follows: sucrose; glucose (Glucose); mannitol (Mannitol); agar (Agar powder); xylose (xylose); MES (2- (N-morpholine) ethanesulfonic acid; KT (Kinetin ), IAA (Indole-3-acetic acid, indoleacetic acid), 2,4-D (2,4-D ichlorophenoxyacetic acid, 2, 4-dichlorophenoxyacetic acid), AS (Acetosyringone ), TMT (Timentin, Timentin), DMSO (Dimethyl sulfoxide), MS (MS medium), ZT (zeatin), NaCl (sodium chloride), Tryptone, Yeast (Yeast powder), Glyphosate (glufosinate)

(2) Preparation method of main solution and culture medium

1)M₀Medium (seeding medium): m₀(500mL) 1/2MS 1.1g, sucrose 15g, distilled water to 500mL, pH5.84-5.88, adding sucrose 3.5 g.

2)M₁Medium (co-cultivation medium): m1(500mL) of MS2.2g, sucrose 15g, mannitol L9g, 2, 4-D500. mu.L and KT 500. mu.L, adding distilled water to 500mL, keeping pH at 5.84-5.88, and adding agar powder 3.5 g; when in use, 500u of acetosyringone is added in a quick cooling state;

3) DM liquid (staining solution): DM (100 mL): MS 0.44g, sucrose 3g, distilled water to 500mL, pH5.84-5.88, adding 100u acetosyringone when sterilizing;

4)M₂culture medium (callus induction medium): m₂(500mL) MS2.2g, sucrose 15g, mannitol 9g, 2, 4-D500. mu.L, kinetin 500 mu L, adding 3.5g of agar powder into the mixture, wherein the volume is constant to 500mL by using distilled water, the pH value is 5.84-5.88; when used after sterilization, 75. mu.L of STS, 500. mu.L of timentin and 500. mu.L of Glufosinate (Glufosinate) were added.

5)M₃Medium (differentiation medium): m₃(500mL) 2.2g of MS, 5g of glucose, 0.125g of xylose and 3.3 g of MES, and the volume is adjusted to 500mL by using distilled water, the pH value is 5.84-5.88, and 3.5g of agar powder; adding the following components when in use after sterilization: zeatin (ZT)500 μ L, indoleacetic acid (IAA)100 μ L, TMT 500 μ L, AgNO₃75 μ L of Glufosinate (Glufosinate)500 μ L.

6)M₄Medium (rooting medium): m₄1/2MS 1.1g, sucrose 15g, distilled water to 500mL, adjusting p to 5.84-5.88, agar powder 3.5g, adding TMT 500 μ L when sterilizing. Description of the drawings: the MS is a commonly used MS culture medium.

7) LB medium (inoculation medium): liquid LB (500mL) medium: 5g of NaCl, 5g of Tryptone (Tryptone) and 2.5g of Yeast powder (Yeast), wherein the volume is adjusted to 500mL by using distilled water, and the mixture is sterilized by high-pressure steam at 121 ℃ for 30 min. Solid LB (500mL) medium: 5g of NaCl, 5g of Tryptone, 2.5g of Yeast and 5 g; adding distilled water to 500mL, and sterilizing with high pressure steam at 121 deg.C for 30 min.

The above medium reagents were dissolved at room temperature and the volume was determined by distilled water.

The preparation method of the related antibiotics and the tissue culture reagent comprises the following steps:

1) preparation of auxin analogue (2,4-D) stock solution (1 mg/mL): weighing 2,4-D250mg, dissolving with 1mL of 1M potassium hydroxide for 5 minutes, adding 10mL of distilled water to dissolve completely, diluting to 250mL, and storing at 4 ℃ for later use.

2) Formulation of Indoleacetic acid (IAA) stock solution (1 mg/mL): weighing IAA100mg, dissolving with 1mL of 1M potassium hydroxide for 5 minutes, adding 10mL of distilled water to dissolve completely, diluting to 100mL, and storing at 4 ℃ for later use.

3) Preparation of cytokinin (KT) stock solution (0.3 mg/mL): KT30mg was weighed, dissolved in 1mL of 1M hydrochloric acid for 5 minutes, then dissolved in 10mL of distilled water, and then the volume was adjusted to 100mL with distilled water, and stored at 4 ℃ for further use.

4) Preparation of Acetosyringone (AS) stock solution (100 mM): weighing 0.392g of AS, firstly dissolving in a small amount of methanol, then adding DMSO to a constant volume of 20mL, carrying out suction filtration on an aseptic workbench, subpackaging in an EP tube, and storing at-20 ℃ for later use.

5) Preparation of Zeatin (ZT) stock solution (2 mg/mL): weighing 0.04gZT, dissolving in 1mL of 1M potassium hydroxide, adding distilled water to a constant volume of 20mL, suction-filtering under sterile environment, and subpackaging into 2mL of EP tubes at-20 ℃ for later use.

6) Preparation of timentin (TMT) stock solution (300 mg/mL): the TMT specification is 3.2 g/bottle, 9 bottles are used once, all the bottles are poured into a beaker, a small amount of water is used for washing, water is added for dissolving, distilled water is added for fixing the volume to 96mL after all the bottles are dissolved, the solution is filtered and sterilized in a sterile environment and is subpackaged into 2mL EP tubes for storage at the temperature of minus 20 ℃ for later use.

7) Preparing a 1N potassium hydroxide stock solution: 5.6g of potassium hydroxide is weighed, dissolved by distilled water and added to 100mL of constant volume, and stored at room temperature for later use.

(3) Agrobacterium-mediated genetic transformation procedure

1) Introduction of plasmids into Agrobacterium by electrotransformation

a. Before the experiment, the electric revolving cup is cleaned by 75% alcohol once to see whether the electric revolving cup is damaged or not, and then is rinsed by absolute ethyl alcohol once until the electric revolving cup is volatilized and dried (the operation is carried out on a super clean workbench);

b. pipette 0.5. mu.L of plasmid into about 50. mu.L of Agrobacterium GV3101 competent medium (ice operation), mix well in 1.5mL sterile centrifuge tube and add into the cuvette;

c. covering the electric rotating cups, putting the electric rotating cups into an electric rotating instrument for electric rotating, wherein the voltage is 1800V, pressing a plug button twice, and making a sound, adding 400 mu L of liquid LB culture medium into each electric rotating cup after the electric rotating is finished, sucking by a pipettor, uniformly mixing, and transferring into a 1.5mL sterile centrifuge tube;

d. placing the centrifuge tube on a horizontal shaker, culturing and activating at 28 deg.C and 180rpm for 1h

e. Inoculating the agrobacterium in each centrifugal tube to an LB solid culture medium, wherein the amount of a dish coating reagent is 30-80 mu L, and putting the mixture into an incubator to be cultured for 48h at 28 ℃;

f. selecting a monoclonal on an LB culture medium, carrying out PCR of a bacterial liquid, and using a primer and a positive detection primer;

g. selecting the obtained monoclonal bacterial liquid, performing streak culture, and then performing bacterium shaking and preservation, wherein the bacterium preservation is performed by using 50% glycerol, and the bacterial liquid: 50% glycerin-1: storing at 1-80 deg.C for use.

2) Obtaining hypocotyl

a. Selecting round and plump seeds from mature cabbage type rape A177 seeds, then sequentially treating the seeds for 1 minute by using 75% ethanol and disinfecting the surfaces of the seeds for 4 minutes by using 50% 84 disinfectant;

b. washing the seeds with sterilized water for 3-5 times;

c. placing the seeds on a germination medium (medium as above);

d. and (3) placing the inoculated seeding culture medium in a dark place for culturing for 1 week at the culture temperature of 25 +/-1 ℃.

3) Agrobacterium culture

Agrobacterium GV3101 was precultured on liquid LB medium with the corresponding resistance selection, on a horizontal shaker at 28 ℃ for about 12h at 180 rpm.

4) Infection with Agrobacterium

a. Preparation of Co-culture Medium M₁When the culture medium is cooled rapidly (about 50 ℃), AS (final concentration to 100 mu m) is added, and DM liquid is correspondingly added with AS (final concentration to 100 mu m) for standby;

b. testing OD of Agrobacterium liquid in LB with spectrophotometer₆₀₀About 0.4 is preferred.

c. Preparing bacterial liquid, putting 2mL of cultured bacterial liquid into an aseptic centrifuge tube, centrifuging at 6000rpm for 3min, and removing supernatant; 2mL DM (AS) was added⁺) Suspending, centrifuging at 6000rpm for 3min, and removing supernatant; then 2mL DM (AS) was added⁺) Suspending and standing at 4 ℃ for later use.

d. Add 18mL of DM (AS) to sterile plates⁺) The seedling hypocotyls were cut with sterile scissors into the plate, each explant was 8mm-12mm in length. The explants are cut vertically in one cut as much as possible, and each dish is cultured with approximately 150 minus 200 explants (about 2-3 square seeding boxes).

e. The cut explant dish was added with 2mL of the prepared DM solution (bacterial solution) in a total volume of 20mL for an infection time of 10-15 min.

f. When the infection is carried out for 8min, a liquid DM solution (bacterial solution) is sucked by a liquid moving machine, an explant is clamped on sterile dry filter paper by a sterile forceps and is placed for a moment in order to suck away the redundant bacterial solution on the explant, then the explant is transferred to an M1 co-culture medium, and co-culture is carried out at 24 ℃ in the dark.

g. After the co-culture is carried out for 36-48h, the explants are transferred to a callus induction culture medium M2 for subculture, and the culture time is about 20 d.

5) Differentiation: transferring the resistant callus to a differentiation medium; subcultured with fresh differentiation medium every three weeks or so. The regeneration bud needs to grow for about 30 days.

6) Rooting: cutting off the primary explant during differentiation, and subculturing the regeneration bud into a rooting culture medium, wherein the rooting needs 15 days.

7) Transplanting: washing off residual culture medium on roots, transferring seedling with good root system into greenhouse, maintaining moisture for the first few days, and culturing T₀Transgenic plants are generated.

Example 3 detection of transgenic Positive plants Using PCR method

Extraction of T by extraction of small amounts of genomic DNA₀PCR analysis is carried out on the genome DNA of the generation transgenic leaf, primers for amplifying Syn1-Rep genes are F: 5'-TCCGAACTTTCTTCCCAC-3' respectively, and the sequences are shown in SEQ ID NO: 5'-CACAATCCCACTATCCTTC-3', and the sequence is shown in SEQ ID NO: 4, the size of the amplified product is 582 bp.

And (3) PCR reaction system: the overall reaction was 20 μ L, where: 30-50ng of DNA template, 10 XBuffer 32.0 uL, 10mM dNTP0.4 uL, 10uM primers 0.5 uL respectively, 1U of Taq enzyme, and sterilized ddH₂O to 20. mu.L.

PCR reaction procedure: denaturation at 94 deg.C for 4 min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, and extension at 72 ℃ for 30s, for 32 cycles; extension at 72 ℃ for 10 min.

And (3) detecting a PCR product: the amplification products were electrophoresed on a 1% agarose gel, stained with EB, visualized with an ultraviolet gel image analyzer and photographed.

The extraction method of the genome DNA of the small leaf comprises the following steps: transferring a proper amount of tender leaves into a 2mL centrifuge tube, and adding 800 mu L of 2Grinding with xCTAB, and transferring into a 2mL centrifuge tube; water bath at 65 deg.C for 30 min; 800. mu.L of chloroform/isoamyl alcohol (24: 1 by volume) were added and inverted several times (about 15min) until the lower liquid phase was dark green. Centrifuge at 12000r/min at room temperature for 10 min. Taking 500 mu L of supernatant, putting the supernatant into a new 1.5mL centrifuge tube, adding 1mL of precooled 95% ethanol, uniformly mixing, and then placing at-20 ℃ for processing for 30 min; then centrifuging at 12000r/min at room temperature for 10min, removing supernatant, washing precipitate with 75% ethanol, and naturally drying. Add 100. mu. LddH₂Dissolving O for later use.

Because the seedlings differentiated from the resistant callus are not all positive transformants, the invention extracts the transgenic T₀Genomic DNA of the plants was subjected to PCR analysis. 251 strains are detected in total, wherein the positive strains are 27 strains, the positive rate is 10.7%, the PCR amplification result of the Syn1-Rep transgenic plant is shown in figure 4, wherein a lane M: 3kb DNA ladder; lane N: non-transgenic (wild-type) controls; lane P: a plasmid.

Example 4T₀Southern hybridization detection of transgenic plants

(1) Enzyme digestion, electrophoresis and membrane transfer: extracting total DNA of cabbage type rape leaf, namely genome DNA, by using a conventional CTAB method, measuring the concentration, and adjusting the concentration to 1 mu g/mu L by using double distilled water for later use. When in hybridization, 30 mu g of rape genome DNA, 4 mu L of 10 xMb buffer, HindIII 30U and supplement ddH are selected₂O to 40 μ L; the enzyme was cleaved at 37 ℃ for 16 h. Meanwhile, the DNA of leaves of brassica napus which are not transgenic is used as a control. After the enzyme digestion is completed, 0.8% agarose gel is prepared by TAE, and the enzyme digestion product is electrophoresed for 16h under the voltage of 30V. The enzyme digestion product after electrophoresis is blotted on a nylon membrane by a capillary method, and then hybridization is carried out by using a probe made of a corresponding plasmid. The detailed procedure is described in Liu et al (LiuKD, WangJ, LiHB, XuCG, Zhang gQF. Agenome-side analysis of side-compatible biolysinrices and dtheprepiselococciton, S5locusinth mole. Larmap. Theor applied Genet,1997,95:809 814).

(2) Preparing a probe: extracting plasmid containing Syn1-Rep gene, double enzyme cutting with Hind III and EcoR I, recovering target gene segment, and labeling with probe by random primer method.

(3) And (3) hybridization: putting the nylon membrane into a hybridization bag, adding 20mL of hybridization solution, sealing after removing bubbles, placing in a shaking table at 65 ℃ for oscillation, and pre-hybridizing for 16 h. The method comprises the following specific steps:

1) add 12. mu. LddH to a centrifuge tube₂O, 1. mu.L of probe DNA (ca. 100ng), 1. mu.L of lambda DNA (ca. 6ng) and 2. mu.L of random primer.

2) Dry-bath denaturing the system at 95 deg.C for 5min, immediately cooling on ice for 5 min; centrifuge at 3.8000r/min for 1min, add 2.5. mu. Lbuffer, 2.5. mu. LdNTP and 1. mu. Lklenow Fragment enzyme.

3) 3 μ L of α -32P-dCTP was added to the isotope bench and treated in a 37 ℃ water bath for 30 min.

4) Adding 500. mu.L of hybridization solution into the reaction system, opening the tube cover, and performing dry bath denaturation at 100 ℃ for 10 min.

5) The denatured probe was added to the hybridization bag, sealed and hybridized in a shaker at 65 ℃. After hybridization for 16h, the nylon membrane was removed, first washed cold with 1 XSSC and 0.1% SDS for 10min, and then washed hot with 1 XSSC and 0.1% SDS at 65 ℃ until the membrane signal intensity was reduced to 500-1000 cpm. Wrapping nylon film with preservative film, and developing in phosphorus screen.

PCR positive T₀The generation plants extract total DNA in the seedling stage for Southern blot analysis, and the result shows that: the gene of interest has been integrated into the genome of the recipient material. The southern blot results of OV40 material are shown in FIG. 5, in which lane M is DNAmarker; lane NT: non-transgenic controls, i.e., wild-type; a: 35S promoter, EcoR I enzyme digestion B: 35S promoter, Hind III enzyme C: syn1-Rep gene, EcoR I enzyme D: syn1-Rep gene, Hind III enzyme.

Example 5: phenotypic characterization of transgenic plants

According to the use instruction of 18% guarantha glufosinate herbicide produced by Bayer company in America, the dosage of the herbicide per mu is 150-250mL, and the water is added for 30-40L per mu, namely 0.225-0.375 mL of herbicide per square meter and 45-60mL of water are added. In the test, glufosinate-ammonium with different concentrations is applied to plants in different growth periods, and the glufosinate resistance level of the transgenic positive plants is detected. Respectively spraying 200 mL/mu and 300 mL/mu of guarantha glufosinate at the 7-8 leaf stage of the cabbage type rape; 600 mL/mu of glufosinate-ammonium is sprayed at the beginning of rape flowering. Phenotypic changes were recorded by taking pictures periodically at the time of spraying, and the results were obtained as described in fig. 6, with the control variety brassica napus a 177. The first row is A, B, C from left to right, the second row is D, E, F from left to right, and the third row is G, H, I from left to right. FIG. A: the spraying concentration of glufosinate-ammonium is 200 mL/mu on the 1 st day; and B: the 3 rd day when the glufosinate-ammonium spraying concentration is 200 mL/mu; and (C) figure: the 6 th day of the spraying concentration of the glufosinate-ammonium is 200 mL/mu; FIG. D: the 21 st day of the glufosinate spraying concentration is 200 mL/mu; FIG. E: the 6 th day of the spraying concentration of the glufosinate-ammonium is 300 mL/mu; FIG. F: the 13 th day with the spraying concentration of glufosinate-ammonium of 300 mL/mu; and (G) in the figure: the spraying concentration of glufosinate-ammonium is 600 mL/mu on the 1 st day; FIG. H: the spraying concentration of glufosinate-ammonium is 600 mL/mu on the 3 rd day; FIG. I: the spraying concentration of glufosinate-ammonium is 600 mL/mu on the 7 th day. From the above results, it can be seen that the rape seed produced by the present invention has better resistance to glufosinate-ammonium.

Example 6 analysis of flanking sequences

The flanking sequences of the transgene insertion site adopt an inverse PCR technology and a Tail-PCR technology. The principle of reverse PCR is to digest DNA with restriction enzyme, then self-ligate it into loops with ligase, and finally amplify the self-ligated product as a template with a reverse primer designed according to a known sequence to obtain a flanking unknown sequence. The flanking sequences are obtained by analyzing, comparing and separating related biological information websites such as Brassica Database and the like, and the result shows that the insertion position of the exogenous gene is 870188 on A04random chromosome, and the specific position is shown in figure 7.

Reverse PCR loading procedure was as follows:

HindIII enzyme restriction enzymes were selected based on Southern hybridization results. Mu.g of the total DNA obtained in example 4 was digested with 30-40U of restriction enzyme in a 50. mu.L reaction system for 16 hours, and purified after safety of digestion was checked. The purification method comprises the following specific steps:

(1) supplementing 150 mu LddH into the enzyme digestion reaction system₂O, adding 200. mu.L of chloroform/isoamyl alcohol (volume ratio is 24:1), and oscillating for 5 min.

(2) Centrifuge at 12000r/min for 5min, aspirate 180. mu.L of supernatant and transfer to a new centrifuge tube.

(3) Adding 20 μ L of 3M NaAc and 400 μ L of frozen anhydrous ethanol, mixing, and standing at-20 deg.C for 30 min.

(4) At 12000r/min, the mixture was frozen and centrifuged for 20min, and the supernatant was decanted.

(5) Add 500. mu.L 75% ethanol for washing, then at 12000r/min, centrifuge for 5min, and pour off the supernatant.

(6) Naturally drying, adding 50 μ LddH₂And dissolving the O.

All purified products were self-ligated with 10U of T4DNALigase (available from Promega, USA), and fractions could be removed for self-ligation if electrophoresis detection revealed higher concentrations of purified products. The reaction system was 100. mu.L, ligated at 16 ℃ for 16 h. Then, taking the self-ligation product as a template, and carrying out reverse PCR first round amplification, wherein primers are P1 and REVP 2; the second round of amplification was templated by the products of the first round, with primers P3 and SP 3. The position and sequence of the primers in the T-DNA region are shown in Table 6.

First round PCR reaction System: the total volume was 40. mu.L, including 4. mu.L of 10 XBuffer and 3. mu.L of 25mM MgCl₂3 μ L of 2mM dNTP, 0.5 μ L of 10uM left and right primers, 2 units of Taq DNA polymerase and 2 μ L of template. PCR reaction procedure: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 55 ℃ for 1min, extension at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 32 cycles. The second round of PCR reaction system is the same as the first round, and the reaction program is pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 57 ℃ for 1min, extension at 72 ℃ for 2min, and extension at 72 ℃ for 5min after 30 cycles.

The amplified products were detected by electrophoresis on a 1% agarose gel using 0.5 XTBE, the target fragments were excised and recovered and cloned into T-vector for sequencing. And comparing the sequencing result with a sequence on a bioinformatics website such as NCBI, Genoscope and the like of the Internet, determining the integration position of the transgene, and inquiring the gene annotation information of the segment on the website.

A plurality of fragments are obtained by carrying out a first round of reverse PCR by taking a self-ligation product obtained after the total DNA enzyme digestion of the strain OV 4018-1 as a template. The second round of reverse PCR amplification enriches the concentration of the large fragment, and the sequencing result shows that the fragment is 900bp, wherein 151bp is derived from a T-DNA region. The remaining 749bp of the target fragment is located on the A04random chromosome of the rape genome by sequence alignment, and is positioned in a non-coding region.

Verification of foreign gene insertion position as follows:

combining the insertion position determined by the flanking sequence separation result and the sequence of the T region of the exogenous gene, designing a specific primer for verification, wherein the primer design principle is as follows: designing a primer P1 on the T region according to the insertion position and the direction of the T region, designing a primer A04-2 according to the genome sequence at the combination position, and carrying out specific amplification, wherein the size of an amplification product is 793 bp.

And (3) PCR reaction system: the reaction total is 20. mu.L, including 30-50ng of DNA template, 10 XBuffer 32.0. mu.L, 10mM dNTP 0.4. mu.L, 0.5. mu.L each of 10. mu.M primers (left primer F/right primer R), Taq enzyme 1U, sterilized ddH₂O to 20. mu.L.

PCR reaction procedure: denaturation at 94 deg.C for 4 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 50s, and 32 cycles; extension at 72 ℃ for 10 min.

And (3) detecting a PCR product: the amplification products were electrophoresed on a 1% agarose gel, stained with EB, visualized with an ultraviolet gel imager and photographed.

Primer sequences

P1: ctctagccaatacgcaaaccgcc, see SEQ ID NO 6;

a04-2: gccacgtgtcgttcttatcct, see SEQ ID NO 9.

The gel electrophoresis pattern of the PCR product is shown in FIG. 8.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> cultivation method of glufosinate-resistant rape

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>492

<212>DNA

<213> glufosinate-ammonium resistance gene Syn1-Rep (Syn 1-Rep)

<400>1

atgcttatca gagatgctgt tcctggtgat cttcctggaa tccttgagat ccacaacgag 60

gctattgcta actctactgc catctgggat gagactcctg ctgaccttga tgagagaagg 120

agatggttcg atgacaggag agctaacgga ttccctgtgc tcgttgctga tgttgacgga 180

gtggttgctg gatacgcttc ttacggagtg tggagagcta agtcatctta cagacatact 240

gttgagaact ctgtttacgt gcatgttgat catcacagga gaggaattgc tactgcactc 300

atgactgagc ttatcgagag agctagagct ggaggaatcc atgtgatcgt tgcttctgtg 360

gagtctacta acgctacttc tgtggctctt catgagagat tcggattcag gattgttgct 420

cacatgcctg aggtgggaag aaagttcgga agatggcttg atatgactta ccttcagctc 480

actctttagt aa 492

<210>2

<211>8383

<212>DNA

<213> expression vector pTGH-1(pTGH-1)

<400>2

aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggca 60

ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 120

cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 180

ccttcccaac agttgcgcag cctgaatggc gaatgctaga gcagcttgag cttggatcag 240

attgtcgttt cccgccttca gtttaaacta tcagtgtttg acaggatata ttggcgggta 300

aacctaagag aaaagagcgt ttattagaat aacggatatt taaaagggcg tgaaaaggtt 360

tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg gatcaaagta 420

ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca gtgcagccgt 480

cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc gccctgccct 540

tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact tgcgactaga 600

accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc tatgcccgcg 660

tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg gccggctgca 720

ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag ctggccagga 780

tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac cgcctggccc 840

gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc gcgggcctgc 900

gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg gtgttgaccg 960

tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc 1020

gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc accccggcac 1080

agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg 1140

cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc gaggaagtga 1200

cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc gaggccgacg 1260

ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc accaggacgg 1320

ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg cggccgggta 1380

cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc tggccggttt 1440

gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa ccgagcgccg 1500

ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta 1560

tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt tatcgctgta 1620

cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc ccgcgccctg 1680

caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag tgcccgcgat 1740

tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt 1800

gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg agcgccccag 1860

gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat tccggtgcag 1920

ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa gcagcgcatt 1980

gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg 2040

cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat tcttgagtcc 2100

cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac cgttcttgaa 2160

tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga aattaaatca 2220

aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg 2280

ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc 2340

cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag ctgaagatgt 2400

acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc gcgcagctac 2460

cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa aggaggcggc 2520

atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg tggaggaacg 2580

ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg cactggaacc 2640

cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac aaatcggcgc 2700

ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc agcggcaacg 2760

catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc gaatccgcaa 2820

agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc ccaagggcga 2880

cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg atagtcgcag 2940

catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg gcgaggtgat 3000

ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg gcatggccag 3060

tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat ccatgaaccg 3120

ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg ttgcggacgt 3180

actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg tagaaacctg 3240

cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca agaacggccg 3300

cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg taaagagcga 3360

aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc gcgagatcac 3420

agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga tcgatcccgg 3480

catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag aagccagatg 3540

gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga agttctgttt 3600

caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga aggaggaggc 3660

ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg gcgaagcatc 3720

cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag gggaaaaagg 3780

tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc cgtacattgg 3840

gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt cacacatgta 3900

agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt taaaacttat 3960

taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca cagccgaaga 4020

gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg cttcgcgtcg 4080

gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca atctaccagg 4140

gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag gcaccctgcc 4200

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 4260

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 4320

ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg 4380

gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat 4440

accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac 4500

tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt 4560

aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca 4620

gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc 4680

ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact 4740

ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct 4800

gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag 4860

ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca 4920

cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa 4980

cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc 5040

gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag 5100

aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg 5160

tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca 5220

gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc 5280

tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt ctaggtacta 5340

aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct tgatccccag 5400

taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga tcgaccggac 5460

gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat caataaagcc 5520

acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt gggaaaagac 5580

aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg gatctttaaa 5640

tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat tcagtaagta 5700

atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg atatgtcgat 5760

ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag ggctttgttc 5820

atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca gattgctcca 5880

gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt ccagccatag 5940

catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc tgtccgtcat 6000

ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag gagacattcc 6060

ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg gtgatattct 6120

cattttagcc atttattatt tccttcctct tttctacagt atttaaagat accccaagaa 6180

gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa ccttaaatac 6240

cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt atcgacggag 6300

ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta caatcaacat 6360

gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc gttcttccga 6420

atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg ctgacgccgt 6480

cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc cggtcgggga 6540

gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg cttagacaac 6600

ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta attcggggga 6660

tctggatttt agtactggat tttggtttta ggaattagaa attttattga tagaagtatt 6720

ttacaaatac aaatacatac taagggtttc ttatatgctc aacacatgag cgaaacccta 6780

taggaaccct aattccctta tctgggaact actcacacat tattatggag aaactcgagt 6840

tactaaagag tgagctgaag gtaagtcata tcaagccatc ttccgaactt tcttcccacc 6900

tcaggcatgt gagcaacaat cctgaatccg aatctctcat gaagagccac agaagtagcg 6960

ttagtagact ccacagaagc aacgatcaca tggattcctc cagctctagc tctctcgata 7020

agctcagtca tgagtgcagt agcaattcct ctcctgtgat gatcaacatg cacgtaaaca 7080

gagttctcaa cagtatgtct gtaagatgac ttagctctcc acactccgta agaagcgtat 7140

ccagcaacca ctccgtcaac atcagcaacg agcacaggga atccgttagc tctcctgtca 7200

tcgaaccatc tccttctctc atcaaggtca gcaggagtct catcccagat ggcagtagag 7260

ttagcaatag cctcgttgtg gatctcaagg attccaggaa gatcaccagg aacagcatct 7320

ctgataagca ttttttgttt tgatgtaata atctcgagag agatagattt gtagagagag 7380

actggtgatt tcagcgtgtc ctctccaaat gaaatgaact tccttatata gaggaaggtc 7440

ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat cacatcaatc 7500

cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg 7560

gggtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc 7620

gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca 7680

gatagctggg caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc 7740

aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc 7800

gtgctccacc atgttatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc 7860

tttttccacg atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc 7920

atcttgaacg atagcctttc ctttatcgca atgatggcat ttgtaggtgc caccttcctt 7980

ttctactgtc cttttgatga agtgacagat agctgggcaa tggaatccga ggaggtttcc 8040

cgatattacc ctttgttgaa aagtctcaat agccctttgg tcttctgaga ctgtatcttt 8100

gatattcttg gagtagacga gagtgtcgtg ctccaccatg ttggcaagct gctctagcca 8160

atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg 8220

tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat 8280

taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 8340

ggataacaat ttcacacagg aaacagctat gaccatgatt acg 8383

<210>3

<211>18

<212>DNA

<213> Artificial sequence (Forward primer)

<400>3

tccgaacttt cttcccac 18

<210>4

<211>19

<212>DNA

<213> Artificial sequence (Reverse primer)

<400>4

cacaatccca ctatccttc 19

<210>5

<211>25

<212>DNA

<213> Artificial sequence (REVP2)

<400>5

atgcctgagg tgggaagaaa gttcg 25

<210>6

<211>23

<212>DNA

<213> Artificial sequence (P1)

<400>6

ctctagccaa tacgcaaacc gcc 23

<210>7

<211>23

<212>DNA

<213> Artificial sequence (SP3)

<400>7

gggtttcgct catgtgttga gca 23

<210>8

<211>23

<212>DNA

<213> Artificial sequence (P3)

<400>8

tgttgtgtgg aattgtgagc gga 23

<210>9

<211>21

<212>DNA

<213> Artificial sequence (A04-2)

<400>9

gccacgtgtc gttcttatcc t 21

Claims (5)

1. The cultivation method of the glufosinate-resistant rape is characterized by comprising the following steps:

s1: obtaining a foreign gene Syn1-Rep fragment, wherein the nucleotide sequence of the foreign gene Syn1-Rep is shown in SEQ ID NO: 1; the nucleotide sequence of the exogenous gene is obtained by codon optimization of an original sequence;

s2: constructing an expression vector, and connecting the expression vector with a foreign gene to obtain a recombinant vector; the expression vector is pCAMBIA1300 vector;

s3, introducing the recombinant vector into escherichia coli DH5 α for verification, and introducing the recombinant vector into escherichia coli DH5 α in a heat shock mode;

s4: extracting the successfully verified plasmid, and introducing the plasmid into an agrobacterium strain to obtain a transformation engineering bacterium; the agrobacterium is agrobacterium GV 3101; introducing the plasmid into agrobacterium tumefaciens strains by adopting an electrical transformation method;

s5: introducing the transformed engineering bacteria into plant tissues by utilizing an agrobacterium-mediated genetic transformation method; the plant tissue is a hypocotyl obtained by sowing mature seeds of a cabbage type rape variety A177 and culturing in dark light;

s6: and (5) detecting the transgenic plants.

2. The method for breeding glufosinate-resistant rape according to claim 1, wherein step S6 is followed by adding step S7: and (4) performing phenotype identification on the transgenic plant.

3. The method for cultivating glufosinate-resistant rape as claimed in claim 1, wherein: in step S6, the transgenic plant is detected by PCR method and/or Southern hybridization technique.

4. The method for cultivating glufosinate-resistant rape as claimed in claim 3, wherein: in the step S6, in the process of detecting the transgenic plants by adopting the PCR method, primers for amplifying the Syn1-Rep gene are respectively F: 5'-TCCGAACTTTCTTCCCAC-3', and the sequences are shown in SEQ ID NO: 5'-CACAATCCCACTATCCTTC-3' and the sequence is shown in SEQ ID NO: 4.

5. the method for cultivating glufosinate-resistant rape as claimed in claim 1, wherein: the insertion position of the exogenous gene Syn1-Rep is 870188 on the rape genome A04random chromosome.

Images