CN110878323B - Application of protoplast of arabidopsis mutant in analysis of signal transduction pathway - Google Patents

Abstract

The invention discloses application of protoplasts of arabidopsis mutants in analyzing signal transduction pathways. The steps for analyzing the signal transduction pathway are: (1) constructing a protein fusion reporter gene expression vector, an effect vector and an internal control vector; expressing the fusion protein containing the protein label A by using a protein fusion reporter gene expression vector; the fusion protein consists of a target protein A and firefly luciferase; expressing a target protein B containing a protein label B by using the effector vector; the internal control vector expresses renilla luciferase; (2) the protein fusion reporter gene expression vector, the effector vector and the internal control vector were transiently expressed in protoplasts of arabidopsis mutants, and then signal transduction pathways were analyzed. The invention provides a new strategy for reconstruction and research of a plant hormone signal channel in an arabidopsis protoplast, and has important application value.

Description

Application of protoplast of arabidopsis mutant in analysis of signal transduction pathway

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of protoplasts of an arabidopsis mutant in analysis of signal transduction pathways.

Background

Plants are constantly subjected to various environmental stresses during their growth, which stresses negatively affect the growth and yield of the plants. In order to cope with different environmental stresses, plant evolution has created a specific signal network to coordinate its growth and development and environmental adaptation. Understanding the molecular mechanisms of these signal transduction pathways is important for the development of plants that are tolerant to environmental stresses. Due to its complexity, the study of plant signal transduction pathways is very time consuming and laborious. Moreover, most plants do not have genomic sequences, transgenic methods or mutant libraries, etc., and the study of signaling pathways is more challenging. Currently, the JA Jasmonate (JA) signaling pathway is relatively well studied in only a few model plants (e.g., arabidopsis, rice, tobacco, and tomato).

The plant hormone Jasmonic Acid (JA) is derived from fatty acids and is involved in regulating many plant developmental and environmental stress responses. JA binds isoleucine catalyzed by jasmonic monoacyl-L-amino acid synthetase to form the major biologically active JA derivative, jasmonic monoacyl-L-isoleucine (JA-Ile). Over the past few decades, the combination of genetic, biochemical and protein structural analysis methods has identified the core components of JA signal transduction in the model plant arabidopsis thaliana. JA-Ile promotes the interaction between the F-box protein CORONATE INSENSIVE 1(COI1) and JASMONATE-ZIM DOMAIN (JAZ) transcription repressor protein, and the two proteins act as JA receptors cooperatively. COI1 functions as an E3 ubiquitin ligase, ubiquitinating the JAZ protein and subsequent degradation by the 26S proteasome. In the absence of JA-Ile, JAZ recruits transcriptional co-repressors by interacting with Novel Interactor of JAZ (NINJA) proteins, thereby repressing the MYC2 transcription factor. There are 12 members of the arabidopsis JAZ protein family. All JAZ proteins contain two conserved sequence motifs: ZIM-motif mediating NINJA interactions (also known as TIFY-motif) and Jas-motif mediating COI1 interactions. After the COI1-JAZ receptor complex senses JA, the degradation of a transcription inhibitor JAZ is caused, MYC2 transcription factor activity is never released, and MYC2 activates the expression of a JA regulatory gene.

Protoplasts freshly isolated from plant tissue retain the original cellular characteristics and differentiation status. Mesophyll protoplasts isolated from plant leaves exhibit biological perception and physiological responses to exogenous hormones, heterologous chemicals and environmental stimuli, similar to that of intact tissues and internal cells in plants. The protoplast transient gene expression system provides a valuable method for researching subcellular protein localization, transcriptional regulation, genome editing and plant synthetic biology, and has become an attractive Swiss army knife in the field of molecular biology research due to flexibility and convenience, and the protoplast transient gene expression system is used for analyzing various plant signal transduction mechanisms and further researching signal pathways.

Disclosure of Invention

The object of the present invention is to study signal transduction pathways, such as components, interactions, regulatory substances, etc. of signal transduction pathways.

The invention firstly protects a method for analyzing a signal transduction pathway, which can be used for analyzing the signal transduction pathway by using protoplasts of an arabidopsis mutant.

In the above method, the step of "analyzing signal transduction pathway using protoplast of Arabidopsis mutant" may be as follows:

(1) constructing a protein fusion reporter gene expression vector, an effect vector and an internal control vector;

the protein fusion reporter gene expression vector contains an expression box A, and the expression box A sequentially comprises a promoter A, a nucleotide sequence for encoding a protein tag A, an encoding gene of a target protein A and an encoding gene of firefly luciferase from 5 'to 3'; expressing the fusion protein containing the protein label A by using a protein fusion reporter gene expression vector; the fusion protein consists of a target protein A and firefly luciferase;

the effect vector contains an expression cassette B, and the expression cassette B sequentially comprises a promoter B, a nucleotide sequence of a coding protein tag B and a coding gene of a target protein B from 5 'to 3'; expressing a target protein B containing a protein label B by using the effector vector;

the internal control vector contains an expression cassette C, and the expression cassette C sequentially comprises a promoter C and coding genes of renilla luciferase from 5 'to 3'; the internal control vector expresses renilla luciferase;

(2) after step (1) was completed, the protein fusion reporter gene expression vector, the effector vector and the internal control vector were transiently expressed in protoplasts of arabidopsis mutants, and then the signal transduction pathway was analyzed.

The expression cassette A from 5 'to 3' can be composed of a promoter A, a nucleotide sequence for coding the protein tag A, a coding gene of the target protein A and a coding gene of firefly luciferase.

The expression cassette B from 5 'to 3' can be composed of a promoter B, a nucleotide sequence for coding a protein tag B and a coding gene for the target protein B.

The expression cassette C from 5 'to 3' can be composed of a promoter C and a coding gene of renilla luciferase.

The promoter A, the promoter B and the promoter C can be the same or different.

The protein tag A and the protein tag B can be the same or different.

The promoter A, the promoter B or the promoter C can be UBQ10 promoter.

The protein tag A or the protein tag B can be an HA protein tag, a Flag protein tag, a Myc protein tag or a His protein tag.

The protein of interest a and the protein of interest b may be components of a signal transduction pathway.

The internal control vector may in particular be the internal control vector UBQ10pro rLuc (Uhrig, J.F.; Huang, L. -J.; Barghahn, S.; Willmer, M.; Thunow, C.; Gatz, C.CC-type grapple acids recovery the transport co-compressor TOPLESS to TGA-dependent target promoters in antibodies approach. Biochim Biophys Acta Gene Regul Mech 1867, 1860, 218-226.).

The invention also provides a kit, which comprises at least one of the protein fusion reporter gene expression vector, the effector vector and the internal control vector; the use of the kit may be for the analysis of signal transduction pathways.

The kit can specifically comprise any one of the protein fusion reporter gene expression vectors, any one of the effector vectors and any one of the internal control vectors.

The kit may also contain protoplasts of an arabidopsis mutant.

The kit can specifically comprise any one of the protein fusion reporter gene expression vectors, any one of the effect vectors, any one of the internal control vectors and protoplasts of arabidopsis thaliana mutants.

The invention also protects the protoplast of the arabidopsis mutant transfected with any one of the protein fusion reporter gene expression vector, any one of the effect vector and any one of the internal control vector.

The invention also protects a1) or a2) or a3) or a 4).

a1) Use of protoplasts of an Arabidopsis mutant for analysis of a signal transduction pathway.

a2) Use of any of the protein fusion reporter gene expression vectors described above, any of the effector vectors described above, and any of the internal control vectors described above in the analysis of signal transduction pathways.

a3) Use of any of the kits described above in the analysis of a signal transduction pathway.

a4) The use of an Arabidopsis mutant transfected with any of the protein fusion reporter gene expression vectors described above, any of the effector vectors described above, and any of the internal control vectors described above, in the analysis of signal transduction pathways.

Any of the signal transduction pathways described above may be a hormone signal transduction pathway. The hormone signaling pathway may be a plant hormone (e.g., auxin, ABA, ethylene, etc.) signaling pathway. The hormone signal transduction pathway may specifically be a jasmonic acid signal transduction pathway.

When any one of the signal transduction pathways is a hormone signal transduction pathway, the arabidopsis mutants can be arabidopsis mutants with key genes of the hormone synthesis pathway deleted, arabidopsis mutants with key genes of the hormone signal transduction pathway deleted or arabidopsis mutants with key genes of the hormone synthesis pathway or signal transduction pathways simultaneously deleted.

When any of the signal transduction pathways described above is a jasmonate signal transduction pathway, the Arabidopsis thaliana mutant may be a mutant in which a key gene of the JA synthetic pathway is deleted (e.g., aos mutant), a mutant in which a key gene of the JA signal transduction pathway is deleted (e.g., coi1 mutant), or a "mutant in which both the JA synthetic pathway and the signal transduction pathway are deleted (e.g., aos coi1 double mutant)".

Any of the above-described assay signal transduction pathways may be at least one of d1) through d3) as follows:

d1) analyzing components of a signal transduction pathway;

d2) analyzing the interaction of components in the signal transduction pathway;

d3) analyzing or screening for substances that modulate signal transduction pathways.

Experiments prove that the JAZ1 protein (namely the target protein A) is continuously degraded in protoplasts of wild arabidopsis (non-mutant) and cannot embody the functions of hormone and the COI1 protein (namely the target protein B). In protoplasts of Arabidopsis mutants (e.g., aos mutant) in which key genes in the JA synthetic pathway are deleted, JAZ1 protein degradation can only be caused by adding JA. A mutant (such as COI1 mutant) protoplast with deletion of key genes in JA signal transduction pathway can only cause the JAZ1 protein to be degraded by adding COI1 protein. A mutant (such as an aos COI1 double mutant) protoplast with simultaneous deletion of JA synthesis pathway and signal transduction pathway can only cause the degradation of target protein A by adding JA and COI1 protein at the same time.

The inventors of the present invention reconstructed the JA signaling pathway by transiently expressing the signal component in isolated arabidopsis protoplasts. The perception of the JA signal by the COI1-JAZ1 receptor complex, which leads to the degradation of JAZ1 protein and the release of MYC2 transcription factor from the transcription co-suppression complex, is gradually reestablished by a vat theory method, thereby activating the expression of target genes. The invention provides a new strategy for reconstruction and research of a plant hormone signal path in plant protoplast cells, and has important application value.

Drawings

FIG. 1 is COI 1-mediated degradation of JAZ1 protein in Arabidopsis protoplasts.

FIG. 2 shows that jasmonic acid is required for COI 1-mediated degradation of JAZ1 protein in protoplasts.

FIG. 3 shows that COI1 releases MYC2 transcriptional activity by degrading JAZ 1.

FIG. 4 shows that the JAZ1 promoter activity in protoplasts was activated by COI 1.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

Wild type Arabidopsis thaliana (Arabidopsis thaliana) (Columbia-0 subtype) is described in the following references: kim H, Hyun Y, Park J, Park M, Kim M, Kim H, Lee M, Moon J, Lee I, Kim J.A genetic link between colored responses and flowing time through FVE in Arabidopsis thaliana. Nature genetics.2004,36: 167-.

aos mutant (described in von Malek, B.; van der Graaff, E.; Schneitz, K.; Keller, B.the Arabidopsis large-stereo mutant dde2-2 is defective in the ALLENE OXIDE SYNTHESE gene encoding one of the key enzymes of the jasmic acid biosynthes pathway 2002, 216, 187-) 192.) seeds were given by Beat Keller (from the university of Soviet, Switzerland).

COI1 mutant (described in Mosblech, A.; Thunow, C.; Gatz, C.; Feussner, I.; Heilmann, I. Jasmic acid duration by COI 1. involves inhibitor polyphosphates in Arabidopsis thaliana. plant J.2011, 65, 949-.

The aos coi1 double mutant (described in:

j.; thurow, c.; kruse, k.; meier, a.; iv, t.; feussner, i.; plant physiol.2012, 159, 391-402.) seeds are awarded to ChristianeGatz (from university of gothic root).

MeJA is a product of Sigma-Aldrich, Germany. The MS solid medium is a product of Duchefa company in the Netherlands.

Performing light-dark alternate culture, namely alternately performing 12h of illumination culture and 12h of dark culture; the illumination intensity of illumination culture is 80-100 mu mol photons m^-2s^-1. The humidity of the light-dark alternate culture was 60%.

Internal control vectors UBQ10pro rLuc (hereinafter referred to as internal control vector) and UBQ10pro: HA-GW vectors are all described in the following documents: uhrig, j.f.; huang, L. -J.; barghahn, s.; willmer, m.; thurow, c.; gatz, C.CC-type glutamates recovering the transcriptional co-compressor TOPLESS to TGA-dependent target promoters in Arabidopsis thaliana Biochim Biophys Acta Gene Regul Mech 2017, 1860, 218 Ach 226. internal control vector was used for normalization. In the internal control vector, the arabidopsis UBQ10 promoter was located upstream of the renilla luciferase gene (rLuc).

The pBGWLL 7.0 vector is described in the following documents: karimi, m.; de Meyer, b.; hilson, P.Modular cloning in Plant cells.trends Plant Sci.2005, 10, 103-105.

In the following examples, the primers and their nucleotide sequences are shown in Table 1.

TABLE 1

Primer name	Nucleotide sequence of primer (5 '-3')
		JAZ1-gw-d1	GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGTCGAGTTCTATGGAATG
JAZ1ohnestop-gw-r1	GGGGACCACTTTGTACAAGAAAGCTGGGTGATATTTCAGCTGCTAAACCG
		JAZ1mitstop-gw-r1	GGGGACCACTTTGTACAAGAAAGCTGGGTGATCATATTTCAGCTGCTAAACCG
mJAZ1-d1	ACTTCCTATTGCTGCAGCAGCTTCAC
		mJAZ1-r1	GTGAAGTGAAGCTGCTGCAGCAATAG
COI1-gw-d1	GGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGAGGATCCTGATATCAAGAGGTGT
		COI1mitstop-gw-r1	GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATATTGGCTCCTTCAGGACTC
mCOI1-d1	AGCTAGAATCGGTTCTCTACTTCTGCTCAGATATAACTAACGAATCTCTTGAAAG
		mCOI1-r1	CTGAGCAGAAGTAGAGAACCGATTCTAGCTCCTGGCAGCCCTGAG
JAZ1pro-gw-d1	GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGCATAACAACAAAAACGTGG
		JAZ1pro-gw-r1	GGGGACCACTTTGTACAAGAAAGCTGGGTGACATCTTTAACAATTAAAACTTTCAAAC
SeqL1	TCGCGTTAACGCTAGCATGGATCTC
		SeqL2	GTAACATCAGAGATTTTGAGACAC

In the following examples, the inventors of the present invention used the constructed transient gene expression system of protoplasts to analyze the correlation between the respective components and thereby reconstruct the JA signal transduction pathway in the protoplasts.

Example 1 COI 1-mediated degradation of JAZ1 protein in Arabidopsis protoplast cells

Construction of recombinant plasmid

1. Construction of protein fusion reporter Gene vector (i.e., recombinant plasmid UBQ10pro: HA-JAZ1-fLuc)

(1) The pBGWL7.0 vector was digested with restriction enzymes HindIII and XmaI, and an about 2303bp DNA fragment 1 was recovered. The DNA fragment 1 contains a gene encoding firefly luciferase.

(2) UBQ10pro was digested with the restriction enzymes HindIII and XmaI: HA-GW vector, about 10152bp of vector backbone 1 was recovered.

(3) Connecting the DNA fragment 1 with a vector framework 1 to obtain a recombinant plasmid UBQ10pro: HA-GW-fLuc.

Recombinant plasmid UBQ10pro: the nucleotide sequence of HA-GW-fLuc is shown as SEQ ID No: 1 is shown.

(4) Taking genome DNA of wild arabidopsis as a template, and carrying out PCR amplification by adopting a primer pair consisting of JAZ1-gw-d1 and JAZ1ohnestop-gw-r1 to obtain a DNA fragment containing attB.

(5) BP reaction was performed on the attB DNA fragment and the vector pDONR207(Invitrogen), to obtain an intermediate vector pDONR207-JAZ1 ohnestop.

(6) The intermediate vector pDONR207-JAZ1ohnestop and the recombinant plasmid UBQ10pro: performing LR reaction on HA-GW-fLuc to obtain a recombinant plasmid UBQ10pro: HA-JAZ 1-fLuc.

2. Construction of protein fusion reporter Gene vector (i.e., recombinant plasmid UBQ10pro: HA-mJAZ1-fLuc)

(1) And carrying out PCR amplification by using an intermediate vector pDONR207-JAZ1ohnestop as a template and a primer pair consisting of SeqL1 and mJAZ1-r1 to obtain a DNA fragment SeqL1 of about 760 bp.

(2) And carrying out PCR amplification by using an intermediate vector pDONR207-JAZ1ohnestop as a template and a primer pair consisting of mJAZ1-d1 and SeqL2 to obtain a DNA fragment SeqL2 of about 309 bp.

(3) The DNA fragment SeqL1 and the DNA fragment SeqL2 were mixed and used as a template, and PCR amplification was performed using a primer pair consisting of SeqL1 and SeqL2 to obtain an mJAZ1 fragment of about 1041 bp.

(4) Mixing the mJAZ1 fragment and the recombinant plasmid UBQ10pro obtained in the step 1 (3): HA-GW-fLuc is recombined to obtain a recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc.

3. Construction of the Effector vector (i.e.recombinant plasmid UBQ10pro: HA-COI1)

(1) The genome DNA of wild arabidopsis is used as a template, and PCR amplification is carried out by adopting a primer pair consisting of COI1-gw-d1 and COI1mitstop-gw-r1 to obtain a DNA fragment A with about 1832 bp. DNA fragment A is COI1 gene.

(2) And (3) carrying out BP reaction on the DNA fragment A and the vector pDONR207 to obtain an intermediate vector pDONR207-COI 1.

(3) Intermediate vectors pDONR207-COI1 and UBQ10pro: and (3) carrying out LR reaction on the HA-GW vector to obtain a recombinant plasmid UBQ10pro: HA-COI 1.

Preparation and transfection of Arabidopsis protoplasts

1. Preparation of Arabidopsis protoplasts

Wild-type Arabidopsis protoplasts and coi1 mutant protoplasts were prepared as described in the references (Yoo, S. -D.; Cho, Y. -H.; Screen, J.Arabidopsis lysophyl protoplasts: a versatile cell system for a transformed gene expression analysis. Nat Protoc 2007, 2, 1565-.

The method comprises the following specific steps:

(1) the lower surface of the leaf of Arabidopsis thaliana (wild type Arabidopsis thaliana or coi1 mutant) grown in soil to 4 weeks of age was gently scraped with a razor, and then placed in a petri dish containing 10mL of an enzyme solution, and moved to 12/12 light for overnight incubation to obtain a digested solution.

The enzyme solution was an aqueous solution containing 1.5% cellulose R10(Sigma-Aldrich), 0.4% macrocezyme R10(SERVA, Germany) and 400mM mannitol.

(2) After the step (1) is finished, taking the digested solution, filtering the digested solution by adopting a 75-micrometer sieve pore, and discarding filtrate; then, the mixture was centrifuged at 780rpm for 2min to collect precipitates. The precipitate is the arabidopsis protoplast.

2. Transfection of Arabidopsis protoplasts

The method described in the reference (Li, N.; Muthreich, M.; Huang, L. -J.; Thunow, C.; Sun, T.; Zhang, Y.; Gatz, C.TGACG-BINDING FACTORS (TGAs) and TGA-interacting CC-type viral growth in Arabidopsis thaliana. New Phytol.2019, 221, 1906-. Four replicates were prepared for each transfection and all experiments were independently repeated at least three times. The method comprises the following specific steps:

(1) the Arabidopsis protoplast prepared in step 1 was extracted with W5 solution (containing 154mM NaCl and 125mM CaCl)₂And 5mM KCl, pH5.7, 2mM MES-KOH buffer) was washed 2 times with 10mL each; then resuspended in W5 solution and incubated on ice.

(2) After completion of step (1), the W5 solution covering the Arabidopsis protoplasts was carefully removed, and the Arabidopsis protoplasts were treated with MMG solution (containing 400mM mannitol and 15mM MgCl₂pH5.7, 4mM MES-KOH buffer) to obtain a protoplast suspension.

(3) Taking an e-tube with the specification of 2mL, adding 220 mu L of 40% (w/v) PEG aqueous solution and 20 mu L of plasmid DNA mixture, and uniformly mixing; then 200. mu.L of protoplast suspension was added, mixed gently and incubated for 30min at room temperature.

The plasmid DNA mixture is formed by mixing a protein fusion reporter gene vector, an effector vector and an internal control vector. Mu.l of plasmid DNA mixture contained 5.0. mu.g of the effector vector, 5.0. mu.g of the protein fusion reporter vector and 1.0. mu.g of the internal control vector. The protein fusion reporter gene vector is a recombinant plasmid UBQ10pro: HA-JAZ1-fLuc or recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc.

(4) After completion of step (3), 800. mu. L W5 buffer (containing 154mM NaCl, 125mM CaCl) was added₂And 5mM KCl, pH5.7, 2mM MES-KOH buffer, mix gently by inverting the tube; then, the mixture was centrifuged at 780rpm for 2min, and the precipitate was collected.

(5) The pellet collected in step (4) was resuspended in 300. mu.L of WI solution (containing 500mM mannitol and 20mM KCl in pH5.7, 4mM MES-KOH buffer), gently mixed to give transfected protoplasts, and cultured under 12/12 light.

(6) Replacing the plasmid DNA mixture with a plasmid DNA control mixture according to the above steps (1) to (5), and leaving the other steps unchanged to obtain protoplasts of the untransfected effector vector. The plasmid DNA control mixture is formed by mixing a protein fusion reporter gene vector and an internal control vector. mu.L of the plasmid DNA control mixture contained 5.0. mu.g of protein fusion reporter vector and 1.0. mu.g of internal control vector. The protein fusion reporter gene vector is a recombinant plasmid UBQ10pro: HA-JAZ1-fLuc or recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc.

Triple, dual luciferase reporter assay

After completion of step two, luciferase activity was determined according to the method described in the literature (Li, N.; Muthreich, M.; Huang, L. -J.; Thunow, C.; Sun, T.; Zhang, Y.; Gatz, C.TGACG-BINDING FACTORS (TGAs) and TGA-interacting CC-type fluorescent oxides modified growth in Arabidopsis thaliana.New Phytol.2019, 221, 1906-. Luciferase activity was measured specifically using a Centro XS3 LB 960 microplate luminometer (Berthold Technologies, Germany) and a dual luciferase reporter kit (Promega, Germany). The pasivlyssisbuffer, LARII and Stop & Glo are all components of a dual luciferase reporter kit.

1. After completion of step two, the WI solution was removed and the arabidopsis protoplasts were snap frozen in liquid nitrogen.

2. After completion of step 1, the frozen arabidopsis protoplasts were dissolved in 20 μ L pasivlyssisbuffer and placed on ice to give a lysate.

3. After completion of step 2, 348 well plates (SARSTEDT, Germany) were taken and 3. mu.L of lysate was added to each well and assayed using a Centro XS3 LB 960 microplate luminometer. The assay parameters for each well were: waiting for 30s, injecting 15 μ L LARII, waiting for 5s, and measuring fLuc activity for 5 s; mu.L of Stop & Glo was injected, waiting 5s, and rLuc activity was measured for 5 s.

Untransfected effector vector and protein fusion reporter gene vector are recombinant plasmid UBQ10pro: the relative activity of the protoplasts of HA-JAZ1-fLuc (the ratio of firefly luciferase (fLuc) activity to Renilla luciferase (rLuc) activity) was set to 1, and the relative activities of other protoplasts were counted.

The results of the relative activity assays of protoplasts prepared from wild type Arabidopsis are shown in FIG. 1 (A) (WT is wild type Arabidopsis, COI1 is transfected effect vector, "-" is untransfected effect vector, JAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro: HA-JAZ1-fLuc, and mJAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc).

The results of the relative activity assays of protoplasts prepared using the Coi1 mutant are shown in FIG. 1 (B) (Coi1 is Coi1 mutant, COI1 is transfected effector vector, "-" is untransfected effector vector, JAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro: HA-JAZ1-fLuc, and mJAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc).

In FIGS. 1 (A) and (B), each value represents the mean (. + -. SE) of four independently transformed protoplast batches; NS showed no significance by t-test,. P < 0.01).

The Jas-module of the JAZ protein is an essential requirement for interaction with COI 1. Truncated JAZ1 lacking the entire Jas-motif exhibited JA insensitivity. The two positively charged residues of JAZ1 Jas-motif (R205 and R206) play a key role in mediating the JA-dependent COI1-JAZ1 interaction, and alanine mutations at these residues disrupt the COI1-JAZ1 interaction. The result shows that the JAZ1-fLuc luciferase activity in the protoplast of the wild arabidopsis is extremely low and cannot be reduced by adding the COI1 effector protein; the JAZ1 mutant variant (mJAZ1), in which the positively charged R205 and R206 were exchanged for alanine residues, showed significantly higher luciferase activity, and this activity was not responsive to the addition of COI1, in full agreement with the expectation. The fLuc reporter gene provides a specific and sensitive means for reflecting the expression level of the JAZ1-fLuc fusion protein. The advantage of the coi1 mutant was exploited to avoid the promiscuous JA signal. In protoplasts of the coi1 mutant, JAZ1-fLuc luciferase activity was comparable to that of undegraded mJAZ 1-fLuc; after the addition of COI1, only JAZ1-fLuc activity was significantly reduced. Thus, COI1 mediates JAZ1 protein degradation.

Four, Western blot analysis

Since both the protein encoded by the protein fusion reporter vector and the protein encoded by the effector vector comprise HA tags, the expression level of HA-tagged proteins in protoplasts was detected by western blot analysis after detecting Luc activity. The method comprises the following specific steps:

1. after completion of the third step, 20. mu.L of 6 XP buffer (pH 6.8 containing 12% SDS, 60% glycerol, 0.06% bromophenol blue, 600mM DTT, 375mM Tris-HCl buffer) was added to the lysate, mixed well, and incubated at 60 ℃ for 10min to obtain a protein extract.

2. mu.L of the protein extract was taken, separated on an 8% SDS polyacrylamide gel, transferred onto a polyvinylidene fluoride membrane (Carl Roth, Germany), and the labeled protein was detected with anti-HA antibodies (Santa Cruz Biotechnology, USA) and visualized with the SuperSignalTM West Femto (Thermo Fisher Scientific, Germany) Western blot kit.

The Western blot analysis results of the protoplasts prepared from wild type Arabidopsis thaliana are shown in FIG. 1 (C) (COI1 is transfected with the effector vector, "-" is untransfected effector vector, JAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro, HA-JAZ1-fLuc, and mJAZ1-fLuc indicates that the protein fusion reporter vector is recombinant plasmid UBQ10pro, HA-mJAZ 1-fLuc). The results show that JAZ1-fLuc protein is not detected in protoplasts prepared from wild Arabidopsis; however, the protein fusion reporter gene vector is a recombinant plasmid UBQ10pro: when HA-mJAZ1-fLuc was detected, mJAZ1-fLuc protein was detected in protoplasts prepared from wild type Arabidopsis thaliana. It follows that the JA biosynthesis and/or signal transduction pathways may have been activated in protoplasts due to damage and cell wall digestion during the preparation of the protoplasts. The activated JA signaling pathway leads to the degradation of JAZ1-fLuc protein in protoplasts of wild-type Arabidopsis thaliana. That is, the JAZ1-fLuc protein synthesized in protoplasts of wild type Arabidopsis thaliana was degraded by the protoplast-derived COI 1.

COI1 protoplasts prepared by the mutant were analyzed by Western blotting, and the results are shown in FIG. 1 (D) (COI1 was transfected with effector vector, "-" was untransfected effector vector, JAZ1-fLuc indicated that the reporter gene vector for protein fusion was recombinant plasmid UBQ10pro: HA-JAZ1-fLuc, and mJAZ1-fLuc indicated that the reporter gene vector for protein fusion was recombinant plasmid UBQ10pro: HA-mJAZ 1-fLuc). The results show that JAZ1-fLuc protein accumulates when COI1 is not transfected, and JAZ1-fLuc protein degrades when COI1 is transfected.

Example 2 COI1 mediated degradation of JAZ1 protein in protoplasts requires jasmonic acid

In Arabidopsis, an endogenous JA molecule mediates the interaction between COI1 and JAZ. To determine whether COI1 caused JAZ 1-ffluc proteolysis in protoplasts was JA-dependent, the inventors of the present invention performed JA complementation experiments in protoplasts of the aos mutant. AOS mutant contains AOS gene which codes for one of the key enzymes of JA biosynthetic pathway and thus cannot synthesize JA.

First, JA-Ile triggers specific degradation of JAZ1 in protoplast cells

1. Construction of recombinant plasmid

(1) The construction of the protein fusion reporter vector (i.e., recombinant plasmid UBQ10pro: HA-JAZ1-fLuc) was the same as in step 1 of example 1.

(2) The construction of the protein fusion reporter gene vector (i.e., recombinant plasmid UBQ10pro: HA-mJAZ1-fLuc) was the same as in step one 2 of example 1.

(3) Construction of the Effector COI1 (i.e.recombinant plasmid UBQ10pro: HA-COI1)

The same as 3 in the first step of example 1.

2. Preparation, transfection and chemical treatment of Arabidopsis protoplasts

(1) Preparation of Arabidopsis protoplasts

Aos mutant protoplasts were prepared according to the method in step two, example 1. The Arabidopsis thaliana is specifically the aos mutant.

(2) aos transfection of mutant protoplasts

The Arabidopsis protoplasts were replaced with aos mutant protoplasts according to the method in step two of example 1, and the other steps were not changed to obtain transfected protoplasts.

(3) Chemical treatment

After completion of step (2), the transfected protoplasts were taken, resuspended in WI solution containing 5. mu.M JA-Ile, gently mixed to give treated protoplasts, and incubated overnight under 12/12 light.

After completion of step (2), the transfected protoplasts were resuspended in WI solution, gently mixed to give untreated protoplasts, and incubated under 12/12 light overnight as a control.

3. Dual luciferase reporter assay

The luciferase activity of the treated protoplasts and the untreated protoplasts was assayed according to the method of step three in example 1.

The untreated and protein fusion reporter gene vector was recombinant plasmid UBQ10pro: the relative activity of the protoplasts of HA-JAZ1-fLuc (the ratio of firefly luciferase (fLuc) activity to Renilla luciferase (rLuc) activity) was set to 1, and the relative activities of other protoplasts were counted.

The results of the experiment are shown in FIG. 2 (A) (mock is not treated with JA-Ile, aos is aos mutant; each value represents the mean (. + -. SE) of four independently transformed protoplast batches; NS is not significant by t-test,. + -. P < 0.01). The results show that JAZ1-fLuc and mJAZ1-fLuc show the same Luc activity in the aos mutant protoplast, indicating that JAZ1-fLuc protein is not degraded; incubation of the aos mutant protoplasts with JA-Ile resulted in a significant decrease in JAZ1-fLuc activity, but not mJAZ1-fLuc activity, indicating that JA-Ile triggers specific degradation of JAZ1 in the protoplast cells.

Secondly, in COI1 mutant protoplast, COI1 reduces the expression of JAZ1-fLuc protein

1. Construction of recombinant plasmid

(1) The construction of the protein fusion reporter vector (i.e., recombinant plasmid UBQ10pro: HA-JAZ1-fLuc) was the same as in step 1 of example 1.

(2) The construction of the protein fusion reporter gene vector (i.e., recombinant plasmid UBQ10pro: HA-mJAZ1-fLuc) was the same as in step one 2 of example 1.

(3) Construction of the Effector COI1 (i.e.recombinant plasmid UBQ10pro: HA-COI1)

The same as 3 in the first step of example 1.

(4) Construction of the effector vector mCII 1 (i.e., recombinant plasmid UBQ10pro: HA-mCII 1)

(a) And obtaining the coding fragment of the mCII by a three-step PCR method. Firstly, an intermediate vector pDONR207-COI1 is used as a template, and a primer pair consisting of SeqL1 and mCOI1-r1 is adopted for PCR amplification to obtain a DNA fragment 1. Then, PCR amplification is carried out by using an intermediate vector pDONR207-COI1 as a template and a primer pair consisting of mCIO 1-d1 and SeqL2 to obtain a DNA fragment 2. And finally, carrying out PCR amplification by using the DNA fragment 1 and the DNA fragment 2 as templates and adopting a primer pair consisting of SeqL1 and SeqL2 to obtain an attL-containing mCIO coding fragment.

(b) Coding fragment of mCOI containing attL and UBQ10pro: and (3) carrying out LR reaction on the HA-GW vector to obtain a recombinant plasmid UBQ10pro: HA-mCII 1.

2. coi1 preparation and transfection of mutant protoplasts

(1) coi1 preparation of mutant protoplasts

The same procedure as in step two of example 1.

(2) coi1 transfection of mutant protoplasts

The transfected protoplasts were obtained by replacing the Arabidopsis protoplasts with coi1 mutant protoplasts, replacing the plasmid DNA mixture with plasmid DNA mixture A, and leaving the other steps unchanged, according to the method described in step two of example 1.

Plasmid DNA mixture a was composed of recombinant plasmid UBQ10pro: HA-JAZ1-fLuc, an effector vector and an internal control vector. 20 μ L of plasmid DNA mixture containing 5.0 μ g of effector vector, 5.0 μ g of recombinant plasmid UBQ10pro: HA-JAZ1-fLuc and 1.0. mu.g of internal control vector. The effect vector is recombinant plasmid UBQ10pro: HA-COI1 (i.e. effector vector COI1) or recombinant plasmid UBQ10pro: HA-mCII 1 (i.e., effect carrier mCII 1).

Referring to the method of step 2 of example 1, the Arabidopsis protoplasts were replaced with coi1 mutant protoplasts, the plasmid DNA mixture was replaced with plasmid DNA mixture B, and the other steps were not changed to obtain protoplasts without transfection of the effector vector. Plasmid DNA mixture B was composed of recombinant plasmid UBQ10pro: HA-JAZ1-fLuc and an internal control vector. 20 μ L of plasmid DNA mixture contained 5.0 μ g of recombinant plasmid UBQ10pro: HA-JAZ1-fLuc and 1.0. mu.g of internal control vector.

3. Dual luciferase reporter assay

The luciferase activity of the transfected protoplasts and the protoplasts not transfected with the effector vector was determined as described in step three of example 1.

The relative activity of protoplasts that were not transfected with the effector vector (the ratio of firefly luciferase (fLuc) activity to Renilla luciferase (rLuc) activity) was set to 1, and the relative activities of other protoplasts were counted.

The results of the experiments are shown in FIG. 2 (B) (each value represents the mean (. + -. SE) of four independently transformed protoplast batches; different letters indicate significant differences between the individual effector plasmid combinations by one-way analysis of variance (P < 0.01); "-" indicates protoplasts of untransfected effector vectors). The results showed that in the COI1 mutant protoplasts, COI1 reduced the expression of JAZ1-fLuc protein, but mCOI1 did not reduce the expression of JAZ1-fLuc protein. Protein structure and biochemical data indicate that the true JA receptor in arabidopsis is a complex comprising COI1 and the JAZ protein. The protein tertiary structure of COI1 comprises a hormone binding domain assembled by LRRs, which binds the hormone JA-Ile with high specificity and affinity. To test whether COI1 requires JA to interact with the JAZ protein, the inventors of the present invention constructed a COI1 mutant (mCOI1) in which critical residues of the 13 th LRR motif that bind to JA-Ile were replaced resulting in the inability of mCOI1 to bind to JA-Ile and therefore to degrade JAZ1-fLuc protein in COI1 mutant protoplasts (fig. 2 (B)).

4. Western blot analysis

Referring to the method of step four of example 1, the expression level of HA-labeled protein in the lysate of step 3 was detected by western blot analysis.

The results of the experiment are shown in FIG. 2 (C) ("-" indicates protoplasts not transfected with the effector vector). The results show that the expression levels of the COI1 protein and the mCOI1 protein are similar; in the presence of COI1, JAZ1-fLuc protein decreased.

It can be seen that the presence of JA is required for COI1 mediated degradation of JAZ1 in protoplasts, and that the amount of JA accumulated in the protoplasts is sufficient to trigger this process. By transiently expressing the core JA receptor component in JA biosynthetic or signal transduction mutant protoplasts, a rapid and specific detection method can be established to monitor the JA dependence in the JA signaling pathway and the early process of COI 1-mediated degradation of the JAZ1 protein.

Example 3 COI1 Release of JAZ1 inhibited MYC2 transcriptional Activity

Construction of recombinant plasmid

1. Recombinant plasmid JAZ1 pro: construction of fLuc

(1) The genome DNA of wild arabidopsis thaliana is used as a template, and a primer pair consisting of JAZ1pro-gw-d1 and JAZ1pro-gw-r1 is adopted for PCR amplification to obtain a promoter fragment of about 1267 bp.

(2) And carrying out BP reaction on the promoter fragment and the vector pDONR207 to obtain an intermediate vector pDONR207-JAZ1 pro.

(3) And (3) carrying out LR reaction on the intermediate vector pDONR207-JAZ1pro and the pBGWLL 7.0 vector to obtain a recombinant plasmid JAZ1 pro: fLuc.

Recombinant plasmid JAZ1 pro: in fLuc, the gene encoding firefly luciferase is promoted by the JAZ1 promoter.

2. Recombinant plasmid UBQ10pro: construction of HA-JAZ1 (i.e., Effector vector JAZ1)

(1) And (2) carrying out PCR amplification by using genome DNA of wild arabidopsis as a template and adopting a primer pair consisting of JAZ1-gw-d1 and JAZ1mitstop-gw-r1 to obtain a DNA fragment B. The DNA fragment B is JAZ1 gene.

(2) And (3) carrying out BP reaction on the DNA fragment B and the vector pDONR207 to obtain an intermediate vector pDONR207-JAZ 1.

(3) Intermediate vectors pDONR207-JAZ1 and UBQ10pro: and (3) carrying out LR reaction on the HA-GW vector to obtain a recombinant plasmid UBQ10pro: HA-JAZ 1.

3. Recombinant plasmid UBQ10pro: construction of HA-mJAZ1 (i.e., effector vector mJAZ1)

(a) The mJAZ1 fragment was obtained by a three-step PCR method. Firstly, taking pDONR207-JAZ1 as a template, and carrying out PCR amplification by adopting a primer pair consisting of SeqL1 and mJAZ1-r1 to obtain a DNA fragment SeqL1 of about 760 bp; carrying out PCR amplification by using pDONR207-JAZ1 as a template and a primer pair consisting of mJAZ1-d1 and SeqL2 to obtain a DNA fragment SeqL2 of about 309 bp; the DNA fragment SeqL1 and the DNA fragment SeqL2 were mixed and used as a template, and PCR amplification was performed using a primer pair consisting of SeqL1 and SeqL2 to obtain an mJAZ1 fragment of about 1041 bp.

pDONR207-JAZ1 is described in the following documents: chini, a.; fonseca, s.; fern-ndez, g.; adie, b.; chico, j.m.; lorenzo, o.; garcia-Casado, g.; lo pez-Vidriero, I.; lozano, f.m.; ponce, m.r.; the JAZ family of compression is the missing link in jam signaling Nature 2007, 448, 666-671.

(b) The mJAZ1 fragment and UBQ10pro: and (3) carrying out LR reaction on the HA-GW vector to obtain a recombinant plasmid UBQ10pro: HA-mJAZ 1.

4. Recombinant plasmid UBQ10pro: construction of HA-MYC2 (i.e., Effector vector MYC2)

The intermediate vector pDONR207-MYC2(

J.; thurow, c.; kruse, k.; meier, a.; iv, t.; feussner, i.; gatz, C.Xenobiotic-and jasmonic acid-induced signal transduction pathway having reactive branched CYP81D11 promoter plant Physiol.2012, 159, 391-: and (3) carrying out LR reaction on the HA-GW vector to obtain a recombinant plasmid UBQ10pro: HA-MYC 2.

Preparation and transfection of Arabidopsis protoplasts

1. Preparation of Arabidopsis protoplasts

The same as 1 in step two of example 1.

2. Transfection of Arabidopsis protoplasts

Referring to the method of step two of example 1, the plasmid DNA mixture was replaced with plasmid DNA mixture 1, plasmid DNA mixture 2, plasmid DNA mixture 3, plasmid DNA mixture 4 and plasmid DNA mixture 5, respectively, and the other steps were not changed, to obtain transfected protoplasts.

Referring to the method of step two of example 1, plasmid DNA mixture 6 was replaced with plasmid DNA mixture 6, and the other steps were not changed, to obtain protoplasts (as a control) without transfection of the effector vector.

Plasmid DNA mixture 1, plasmid DNA mixture 2, plasmid DNA mixture 3, plasmid DNA mixture 4, and plasmid DNA mixture 5 are each mixed with a promoter reporter vector, an effector vector, and an internal control vector. 20 μ L of plasmid DNA mixture 1, plasmid DNA mixture 2, plasmid DNA mixture 3, plasmid DNA mixture 4, and plasmid DNA mixture 5 each contained 5.0 μ g of the effector vector, 5.0 μ g of the promoter reporter vector, and 1.0 μ g of the internal control vector. The promoter reporter gene vector is a recombinant plasmid JAZ1 pro: fLuc.

The effector vector in plasmid DNA mixture 1 was the effector vector MYC 2.

The effector vector in plasmid DNA mixture 2 was effector vector MYC2 and effector vector JAZ 1.

The effector vector in the plasmid DNA mixture 3 is an effector vector MYC2 and an effector vector mJAZ 1.

The effector vector in the plasmid DNA mixture 4 is an effector vector MYC2, an effector vector JAZ1 and an effector vector COI 1.

The effector vector in the plasmid DNA mixture 5 is an effector vector MYC2, an effector vector mJAZ1 and an effector vector COI 1.

Plasmid DNA mixture 6 was composed of a promoter reporter vector and an internal control vector. 20 μ L of plasmid DNA mixture 6 contained 5.0 μ g of promoter reporter vector and 1.0 μ g of internal control vector. The promoter reporter gene vector is a recombinant plasmid JAZ1 pro: fLuc.

Triple, dual luciferase reporter assay

The luciferase activity of the transfected protoplasts and the protoplasts not transfected with the effector vector was determined as described in step three of example 1.

The relative activity of protoplasts that were not transfected with the effector vector (the ratio of firefly luciferase (fLuc) activity to Renilla luciferase (rLuc) activity) was set to 1, and the relative activities of other protoplasts were counted.

The results of the relative activity assays of protoplasts prepared from wild type Arabidopsis are shown in FIG. 3 (A) (WT is wild type Arabidopsis, "-" is not containing any effector vector, "MYC 2" is the effector vector MYC2, "MYC 2 JAZ 1" is the effector vector MYC2 and the effector vector JAZ1, and "MYC 2 mJAZ 1" is the effector vector MYC2 and the effector vector mJAZ 1).

The result of the relative activity detection of protoplasts prepared by using the COI1 mutant is shown in fig. 3 (B) (COI1 is COI1 mutant, "-" is free of any effector vector, "MYC 2" is effector vector MYC2, "MYC 2 JAZ 1" is effector vector MYC2 and effector vector JAZ1, "MYC 2 mJAZ 1" is effector vector MYC2 and effector vector mJAZ1, "MYC 2 mJAZ1 COI 1" is effector vector MYC2, effector vector mJAZ1 and effector vector COI1, "MYC 2 JAZ1 COI 1" is effector vector MYC2, effector vector z1 and effector vector COI 1).

In fig. 3 (a) and (B), each value represents the mean (± SE) of four independent transformed protoplast batches; different letters indicate that there is a significant difference between the individual effector plasmid combinations by one-way analysis of variance (P < 0.01).

The results of (a) in fig. 3 show that MYC2 strongly activates JAZ1 promoter activity in wild-type arabidopsis protoplasts, which activity is inhibited by non-degradable mJAZ1 protein, but not by JAZ1 protein; this is consistent with previous data that the JAZ1 protein was indeed degraded in wild-type arabidopsis protoplasts. Therefore, experiments in coi1 mutant protoplasts were required.

The results of (B) in fig. 3 show that, in the coi1 mutant protoplast, MYC 2-activated JAZ1 promoter activity was significantly inhibited by JAZ1 and mJAZ 1; but the inhibition mediated by JAZ1 but not mJAZ1 was alleviated by the addition of COI1, indicating that COI1 specifically degrades JAZ1 but not mJAZ 1.

Example 4 JAZ1 promoter Activity in protoplasts was activated by COI1

The JA signal transduction pathway was analyzed using a reductometry approach whereby COI1 mediated degradation of JAZ1 protein was demonstrated in arabidopsis COI1 mutant and JAZ1 inhibition of MYC2 activity was demonstrated in aos mutant protoplasts. In an attempt to reconstruct the entire JA signal transduction pathway in protoplasts, the inventors of the present invention transiently expressed the core component of the JA signal pathway in protoplasts of the aos coi1 double mutant.

The phytotoxin Coronatine (COR) secreted by the plant pathogenic bacterium Pseudomonas syringae is a structural mimic of JA-Ile, and can functionally replace the function of JA-Ile. COR is more effective than JA-Ile in promoting COI1-JAZ interactions in vivo and in vitro (Katsir, L.; Schimiller, A.L.; Staswick, P.E.; He, S.Y.; Howe, G.A.COI1 is a critical component of a receiver for j-sm and the bacterial virus factor co-simulation. Proc. Natl.Acad. Sci.U.S.A.2008, 105, 7100-.

Activation of the JAZ1 promoter activity requires the addition of both COR and COI1 proteins to the protoplasts of the aos COI1 double mutant. Protoplasts of the aos COI1 double mutant were co-transfected with a reporter plasmid driven by a promoter encoding firefly luciferase under the control of the JAZ1 promoter and an effector plasmid encoding the COI1 derivative under the control of the UBQ10 promoter. After transfection, transfected protoplasts were incubated with 5 μ MCOR; control without COR. Firefly luciferase (fLuc) activity was normalized by comparing Renilla luciferase (rLuc) activity. In simulated conditions, where empty effector vector was present and COR was not added, the activity was set to 1. Each value represents the mean (± SE) of four independent transformed protoplast batches. By t-test, NS showed no significance, P < 0.01. )

In the case of the oos COI1 double mutant protoplast, both COR and COI1 proteins must be added to activate the JAZ1 promoter activity. Protoplasts of the aos COI1 double mutant were co-transfected with a reporter plasmid driven by a promoter encoding firefly luciferase under the control of the JAZ1 promoter and an effector plasmid encoding the COI1 derivative under the control of the UBQ10 promoter. After transfection, transfected protoplasts were incubated with 5 μ MCOR; control without COR. The relative activity of protoplasts without addition of effector vector and untreated COR (the ratio of firefly luciferase (fLuc) activity to Renilla luciferase (rLuc) activity) was set to 1, and the relative activities of other protoplasts were counted.

The experimental results are shown in fig. 4 (a). The results show that COI1 and COR release the transcription activity of MYC2 by degrading the endogenous JAZ protein of protoplast, and further activate the JAZ1 promoter activity in the absence of COI1 or COR, the activity of JAZ1 promoter in aos COI1 double-mutant protoplast is not activated, which indicates that COI1 and COR are absent for activating the JAZ1 promoter activity; in the presence of both COI1 and COR, the activity of the JAZ1 promoter in the aos COI1 double mutant protoplasts was significantly increased. It can be seen that COR prompted COI1 to degrade the JAZ protein in protoplasts and release MYC2 activity, which is exactly the same as that obtained by genetic and biochemical analysis of whole arabidopsis plants. Thus, a complete cascade of signals from early JA perception to downstream gene expression was successfully reconstituted in protoplasts.

In conclusion, the JA signal transduction pathway reconstructed in protoplasts by the present inventors is shown in fig. 4 (b): the transcription regulator MYC2 binds to the target promoter to activate JA-responsive gene expression; in the absence of JA, the JAZ protein interacts with MYC2 to inhibit gene expression; in the presence of JA, COI1 interacts with JAZ proteins and causes them to be degraded by the ubiquitin protein 26S proteasome, resulting in the release of MYC2 transcriptional activity.

<110> technical university of the middle and south forestry

<120> application of protoplast of Arabidopsis mutant in analyzing signal transduction pathway

<160> 1

<170> PatentIn version 3.5

<210>1

<211>12455

<212>DNA

<213>Artificial sequence

<400>1

gataattcga gctggcacga caggtttccc gactggaaag cgggcagtga gcgcaacgca 60

attaatgtga gttagctcac tcattaggca ccccaggctt tacactttat gcttccggct 120

cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag ctatgaccat 180

gattacgaat tctcatgttt gacagcttat catcgatgtg gttgcagccg gcacacacga 240

gtcgtgttta tcaactcaaa gcacaaatac ttttcctcaa cctaaaaata aggcaattag 300

ccaaaaacaa ctttgcgtgt aaacaacgct caatacacgt gtcattttat tattagctat 360

tgcttcaccg ccttagcttt ctcgtgacct agtcgtcctc gtcttttctt cttcttcttc 420

tataaaacaa tacccaaaga gctcttcttc ttcacaattc agatttcaat ttctcaaaat 480

cttaaaaact ttctctcaat tctctctacc gtgatcaagg taaatttctg tgttccttat 540

tctctcaaaa tcttcgattt tgttttcgtt cgatcccaat ttcgtatatg ttctttggtt 600

tagattctgt taatcttaga tcgaagacga ttttctgggt ttgatcgtta gatatcatct 660

taattctcga ttagggtttc atagatatca tccgatttgt tcaaataatt tgagttttgt 720

cgaataatta ctcttcgatt tgtgatttct atctagatct ggtgttagtt tctagtttgt 780

gcgatcgaat ttgtcgatta atctgagttt ttctgattaa cagctcgaga acaatggcat 840

acccatacga cgttccggac tacgcttctt tgggtggttc tagcccaagc tcagagctcc 900

accgcggtgg cggccgcatc ttttacccat acgatgttcc tgactatgcg ggctatccct 960

atgacgtccc ggactatgca gatatctcta ggcagatcac aagtttgtac aaaaaagctg 1020

aacgagaaac gtaaaatgat ataaatatca atatattaaa ttagattttg cataaaaaac 1080

agactacata atactgtaaa acacaacata tccagtcact atggcggccg cattaggcac 1140

cccaggcttt acactttatg cttccggctc gtataatgtg tggattttga gttaggatcc 1200

ggcgagattt tcaggagcta aggaagctaa aatggagaaa aaaatcactg gatataccac 1260

cgttgatata tcccaatggc atcgtaaaga acattttgag gcatttcagt cagttgctca 1320

atgtacctat aaccagaccg ttcagctgga tattacggcc tttttaaaga ccgtaaagaa 1380

aaataagcac aagttttatc cggcctttat tcacattctt gcccgcctga tgaatgctca 1440

tccggaattc cgtatggcaa tgaaagacgg tgagctggtg atatgggata gtgttcaccc 1500

ttgttacacc gttttccatg agcaaactga aacgttttca tcgctctgga gtgaatacca 1560

cgacgatttc cggcagtttc tacacatata ttcgcaagat gtggcgtgtt acggtgaaaa 1620

cctggcctat ttccctaaag ggtttattga gaatatgttt ttcgtctcag ccaatccctg 1680

ggtgagtttc accagttttg atttaaacgt ggccaatatg gacaacttct tcgcccccgt 1740

tttcaccatg ggcaaatatt atacgcaagg cgacaaggtg ctgatgccgc tggcgattca 1800

ggttcatcat gccgtctgtg atggcttcca tgtcggcaga atgcttaatg aattacaaca 1860

gtactgcgat gagtggcagg gcggggcgta aacgcgtgga tccggcttac taaaagccag 1920

ataacagtat gcgtatttgc gcgctgattt ttgcggtata agaatatata ctgatatgta 1980

tacccgaagt atgtcaaaaa gaggtgtgct atgaagcagc gtattacagt gacagttgac 2040

agcgacagct atcagttgct caaggcatat atgatgtcaa tatctccggt ctggtaagca 2100

caaccatgca gaatgaagcc cgtcgtctgc gtgccgaacg ctggaaagcg gaaaatcagg 2160

aagggatggc tgaggtcgcc cggtttattg aaatgaacgg ctcttttgct gacgagaaca 2220

ggggctggtg aaatgcagtt taaggtttac acctataaaa gagagagccg ttatcgtctg 2280

tttgtggatg tacagagtga tattattgac acgcccgggc gacggatggt gatccccctg 2340

gccagtgcac gtctgctgtc agataaagtc tcccgtgaac tttacccggt ggtgcatatc 2400

ggggatgaaa gctggcgcat gatgaccacc gatatggcca gtgtgccggt ctccgttatc 2460

ggggaagaag tggctgatct cagccaccgc gaaaatgaca tcaaaaacgc cattaacctg 2520

atgttctggg gaatataaat gtcaggctcc cttatacaca gccagtctgc aggtcgacca 2580

tagtgactgg atatgttgtg ttttacagta ttatgtagtc tgttttttat gcaaaatcta 2640

atttaatata ttgatattta tatcatttta cgtttctcgt tcagctttct tgtacaaagt 2700

ggtgataaaa aaatggaaga cgccaaaaac ataaagaaag gcccggcgcc attctatcct 2760

ctagaggatg gaaccgctgg agagcaactg cataaggcta tgaagagata cgccctggtt 2820

cctggaacaa ttgcttttac agatgcacat atcgaggtga acatcacgta cgcggaatac 2880

ttcgaaatgt ccgttcggtt ggcagaagct atgaaacgat atgggctgaa tacaaatcac 2940

agaatcgtcg tatgcagtga aaactctctt caattcttta tgccggtgtt gggcgcgtta 3000

tttatcggag ttgcagttgc gcccgcgaac gacatttata atgaacgtga attgctcaac 3060

agtatgaaca tttcgcagcc taccgtagtg tttgtttcca aaaaggggtt gcaaaaaatt 3120

ttgaacgtgc aaaaaaaatt accaataatc cagaaaatta ttatcatgga ttctaaaacg 3180

gattaccagg gatttcagtc gatgtacacg ttcgtcacat ctcatctacc tcccggtttt 3240

aatgaatacg attttgtacc agagtccttt gatcgtgaca aaacaattgc actgataatg 3300

aattcctctg gatctactgg gttacctaag ggtgtggccc ttccgcatag aactgcctgc 3360

gtcagattct cgcatgccag agatcctatt tttggcaatc aaatcattcc ggatactgcg 3420

attttaagtg ttgttccatt ccatcacggt tttggaatgt ttactacact cggatatttg 3480

atatgtggat ttcgagtcgt cttaatgtat agatttgaag aagagctgtt tttacgatcc 3540

cttcaggatt acaaaattca aagtgcgttg ctagtaccaa ccctattttc attcttcgcc 3600

aaaagcactc tgattgacaa atacgattta tctaatttac acgaaattgc ttctgggggc 3660

gcacctcttt cgaaagaagt cggggaagcg gttgcaaaac gcttccatct tccagggata 3720

cgacaaggat atgggctcac tgagactaca tcagctattc tgattacacc cgagggggat 3780

gataaaccgg gcgcggtcgg taaagttgtt ccattttttg aagcgaaggt tgtggatctg 3840

gataccggga aaacgctggg cgttaatcag agaggcgaat tatgtgtcag aggacctatg 3900

attatgtccg gttatgtaaa caatccggaa gcgaccaacg ccttgattga caaggatgga 3960

tggctacatt ctggagacat agcttactgg gacgaagacg aacacttctt catagttgac 4020

cgcttgaagt ctttaattaa atacaaagga tatcaggtgg cccccgctga attggaatcg 4080

atattgttac aacaccccaa catcttcgac gcgggcgtgg caggtcttcc cgacgatgac 4140

gccggtgaac ttcccgccgc cgttgttgtt ttggagcacg gaaagacgat gacggaaaaa 4200

gagatcgtgg attacgtcgc cagtcaagta acaaccgcga aaaagttgcg cggaggagtt 4260

gtgtttgtgg acgaagtacc gaaaggtctt accggaaaac tcgacgcaag aaaaatcaga 4320

gagatcctca taaaggccaa gaagggcgga aagtccaaat tgtaaccgcg gccatgctag 4380

agtccgcaaa aatcaccagt ctctctctac aaatctatct ctctctattt ttctccagaa 4440

taatgtgtga gtagttccca gataagggaa ttagggttct tatagggttt cgctcatgtg 4500

ttgagcatat aagaaaccct tagtatgtat ttgtatttgt aaaatacttc tatcaataaa 4560

atttctaatt cctaaaacca aaatccagtg acctgcaggc atgcgacgtc gggcccaagc 4620

ttagcttgag cttggatcag attgtcgttt cccgccttca gtttaaacta tcagtgtttg 4680

acaggatata ttggcgggta aacctaagag aaaagagcgt ttattagaat aacggatatt 4740

taaaagggcg tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg 4800

ttcccctcgg gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt 4860

ctgacgttca gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg 4920

acaggctgcc gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa 4980

gtagaatact tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg 5040

cctgctgggc tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga 5100

actgcacgcg gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga 5160

ccgcccggag ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac 5220

caggctagac cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca 5280

ggaggccggc gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc 5340

cggccgcatg gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat 5400

cgaccgcacc cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg 5460

ccctaccctc accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg 5520

caccgtgaaa gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact 5580

tgagcgcagc gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga 5640

cgcattgacc gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc 5700

atgaaaccgc accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg 5760

gagatgatcg cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg 5820

catgaaatcc tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc 5880

gctgaagaaa ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg 5940

cgtcatgcgg tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac 6000

gcatgaaggt tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa 6060

cccatctagc ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc 6120

cccagggcag tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg 6180

gcatcgaccg cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag 6240

tgatcgacgg agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact 6300

tcgtgctgat tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg 6360

agctggttaa gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt 6420

cgcgggcgat caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg 6480

agctgcccat tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg 6540

ccggcacaac cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc 6600

tggccgctga aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa 6660

aagcacaaac acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt 6720

ggccagcctg gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga 6780

tcacaccaag ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc 6840

tgaatacatc gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt 6900

tagcggctaa aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat 6960

gccccatgtg tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc 7020

cctgcaatgg cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc 7080

ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg 7140

caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg 7200

gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt 7260

aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg 7320

ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac 7380

cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca 7440

gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat 7500

ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc 7560

cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa 7620

gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg 7680

aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc 7740

tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat 7800

tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat 7860

tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca 7920

ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga 7980

gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag 8040

tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac 8100

ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt 8160

gccctagcag gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg 8220

aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt 8280

gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc 8340

taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct 8400

ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta 8460

cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta 8520

cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc 8580

ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat 8640

gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg 8700

tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag 8760

cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg 8820

caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc 8880

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 8940

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 9000

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 9060

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 9120

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 9180

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 9240

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 9300

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 9360

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 9420

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 9480

cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 9540

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 9600

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 9660

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 9720

gtcatgcatg atatatctcc caatttgtgt agggcttatt atgcacgctt aaaaataata 9780

aaagcagact tgacctgata gtttggctgt gagcaattat gtgcttagtg catctaatcg 9840

cttgagttaa cgccggcgaa gcggcgtcgg cttgaacgaa tttctagcta gacattattt 9900

gccgactacc ttggtgatct cgcctttcac gtagtggaca aattcttcca actgatctgc 9960

gcgcgaggcc aagcgatctt cttcttgtcc aagataagcc tgtctagctt caagtatgac 10020

gggctgatac tgggccggca ggcgctccat tgcccagtcg gcagcgacat ccttcggcgc 10080

gattttgccg gttactgcgc tgtaccaaat gcgggacaac gtaagcacta catttcgctc 10140

atcgccagcc cagtcgggcg gcgagttcca tagcgttaag gtttcattta gcgcctcaaa 10200

tagatcctgt tcaggaaccg gatcaaagag ttcctccgcc gctggaccta ccaaggcaac 10260

gctatgttct cttgcttttg tcagcaagat agccagatca atgtcgatcg tggctggctc 10320

gaagatacct gcaagaatgt cattgcgctg ccattctcca aattgcagtt cgcgcttagc 10380

tggataacgc cacggaatga tgtcgtcgtg cacaacaatg gtgacttcta cagcgcggag 10440

aatctcgctc tctccagggg aagccgaagt ttccaaaagg tcgttgatca aagctcgccg 10500

cgttgtttca tcaagcctta cggtcaccgt aaccagcaaa tcaatatcac tgtgtggctt 10560

caggccgcca tccactgcgg agccgtacaa atgtacggcc agcaacgtcg gttcgagatg 10620

gcgctcgatg acgccaacta cctctgatag ttgagtcgat acttcggcga tcaccgcttc 10680

ccccatgatg tttaactttg ttttagggcg actgccctgc tgcgtaacat cgttgctgct 10740

ccataacatc aaacatcgac ccacggcgta acgcgcttgc tgcttggatg cccgaggcat 10800

agactgtacc ccaaaaaaac atgtcataac aagaagccat gaaaaccgcc actgcgccgt 10860

taccaccgct gcgttcggtc aaggttctgg accagttgcg tgacggcagt tacgctactt 10920

gcattacagc ttacgaaccg aacgaggctt atgtccactg ggttcgtgcc cgaattgatc 10980

acaggcagca acgctctgtc atcgttacaa tcaacatgct accctccgcg agatcatccg 11040

tgtttcaaac ccggcagctt agttgccgtt cttccgaata gcatcggtaa catgagcaaa 11100

gtctgccgcc ttacaacggc tctcccgctg acgccgtccc ggactgatgg gctgcctgta 11160

tcgagtggtg attttgtgcc gagctgccgg tcggggagct gttggctggc tggtggcagg 11220

atatattgtg gtgtaaacaa attgacgctt agacaactta ataacacatt gcggacgttt 11280

ttaatgtact gaattaacgc cgaattgaat tatcagcttg catgccggtc gatctagtaa 11340

catatagatg acaccgcgcg cgataattta tcctagtttg cgcgctatat tttgttttct 11400

atcgcgtatt aaatgtataa ttgcgggact ctaatcataa aaacccatct cataaataac 11460

gtcatgcatt acatgttaat tattacatgc ttaacgtaat tcaacagaaa ttatatgata 11520

atcatcgcaa gaccggcaac aggattcaat cttaagaaac tttattgcca aatgtttgaa 11580

cgatctgctt gactctaggg gtcatcagat ttcggtgacg ggcaggaccg gacggggcgg 11640

caccggcagg ctgaagtcca gctgccagaa acccacgtca tgccagttcc cgtgcttgaa 11700

gccggccgcc cgcagcatgc cgcggggggc atatccgagc gcctcgtgca tgcgcacgct 11760

cgggtcgttg ggcagcccga tgacagcgac cacgctcttg aagccctgtg cctccaggga 11820

cttcagcagg tgggtgtaga gcgtggagcc cagtcccgtc cgctggtggc ggggggagac 11880

gtacacggtc gactcggccg tccagtcgta ggcgttgcgt gccttccagg gacccgcgta 11940

ggcgatgccg gcgacctcgc cgtccacctc ggcgacgagc cagggatagc gctcccgcag 12000

acggacgagg tcgtccgtcc actcctgcgg ttcctgcggc tcggtacgga agttgaccgt 12060

gcttgtctcg atgtagtggt tgacgatggt gcagaccgcc ggcatgtccg cctcggtggc 12120

acggcggatg tcggccgggc gtcgttctgg gctcatggta gatcccctcg atcgagttga 12180

gagtgaatat gagactctaa ttggataccg aggggaattt atggaacgtc agtggagcat 12240

ttttgacaag aaatatttgc tagctgatag tgaccttagg cgacttttga acgcgcaata 12300

atggtttctg acgtatgtgc ttagctcatt aaactccaga aacccgcggc tcagtggctc 12360

cttcaacgtt gcggttctgt cagttccaaa cgtaaaacgg cttgtcccgc gtcatcggcg 12420

ggggtcataa cgtgactccc ttaattctca tgtat 12455

Claims (7)

1. A method for analyzing whether COI1 protein in a hormone signal transduction pathway can degrade a target protein is to analyze whether COI1 protein in the hormone signal transduction pathway can degrade the target protein by using protoplasts of an Arabidopsis mutant COI1 mutant, and comprises the following specific steps:

(1) constructing a protein fusion reporter gene expression vector, an effect vector and an internal control vector;

the protein fusion reporter gene expression vector contains an expression box A, and the expression box A sequentially comprises a promoter A, a nucleotide sequence of a coded protein tag A, a coded gene of a target protein and a coded gene of firefly luciferase from 5 'to 3'; expressing the fusion protein containing the protein label A by using a protein fusion reporter gene expression vector; the fusion protein consists of target protein and firefly luciferase;

the effect vector contains an expression cassette B, and the expression cassette B sequentially comprises a promoter B, a nucleotide sequence for encoding a protein tag B and an encoding gene of COI1 protein from 5 'to 3'; the effector vector expresses COI1 protein containing protein tag B;

the internal control vector contains an expression cassette C, and the expression cassette C sequentially comprises a promoter C and coding genes of renilla luciferase from 5 'to 3'; the internal control vector expresses renilla luciferase;

(2) after completion of step (1), the protein fusion reporter gene expression vector, the effector vector and the internal control vector were transiently expressed in protoplasts of the arabidopsis mutant coi1 mutant, and then luciferase activity was measured and judged as follows: the COI1 protein may degrade the protein of interest if luciferase activity is reduced; otherwise, the COI1 protein cannot degrade the target protein.

2. The method of claim 1, wherein:

the promoter A, the promoter B or the promoter C is a UBQ10 promoter;

the protein tag A or the protein tag B is an HA protein tag.

3. A kit for analyzing whether a COI1 protein in a hormone signaling pathway can degrade a target protein, consisting of protoplasts of Arabidopsis mutant COI1 mutant, the protein fusion reporter expression vector of claim 1, the effector vector, and the internal control vector.

4. Protoplasts of an Arabidopsis mutant coi1 mutant transfected with the protein fusion reporter expression vector of claim 1, the effector vector and the internal control vector.

5. Application of protoplasts of arabidopsis mutant COI1 mutant in analyzing whether COI1 protein can degrade target protein in hormone signal transduction pathway.

6. Use of a kit according to claim 3 for assaying the ability of the COI1 protein to degrade a protein of interest in the hormone signaling pathway.

7. Use of protoplasts of an Arabidopsis mutant COI1 mutant transfected with the protein fusion reporter expression vector of claim 1, the effector vector and the internal control vector for analyzing whether the COI1 protein degrades a protein of interest in a hormone signal transduction pathway.

Images