CN109957576A - A kind of pFC330-BEC plasmid being able to achieve the accurate point mutation of base and its application - Google Patents

Abstract

The invention discloses a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base and its applications.The nucleotide sequence of the pFC330-BEC plasmid is as shown in SEQ ID NO:3, and it includes the rAPOBEC1-XTEN-nCas9-UGI fusion segment that can be expressed in aspergillus niger, E. coli resistance genetic fragment AmpR, pyrG selection markers, filamentous fungi autonomously replicating sequence AMA1, promoter Ptef and plasmid replication origin ori.The cytimidine in any site on filamentous fungi genome efficiently and quickly can be mutated into thymidine by the plasmid, can be realized the mutation of amino acid or the inactivation of gene.The plasmid the molecular breeding of filamentous fungi, physiological property, metabolite, host transformation, in terms of have broad application prospects, can for filamentous fungi genetic engineering transformation provide new technology platform.

Description

A kind of pFC330-BEC plasmid being able to achieve the accurate point mutation of base and its application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of pFC330-BEC matter for being able to achieve the accurate point mutation of base Grain and its application.

Background technique

CRISPR/Cas system with accurate edits genomic DNA characteristic has been that the development of genetic engineering brings leather The impetus of life property.Endonuclease Cas9 is directed to specific base under the guidance of single chimeric guidance RNA (sgRNA) Because of seat, it identifies and cuts in a targeted manner specific dna sequence in the locus, and double-strand break is generated in genome (DSB).In cell, DSB mainly carries out DNA double chain reparation by way of non-homologous end joining (NHEJ)；In donor dna In the presence of, DSB can also activate homologous recombination repair (HDR) to carry out accurate genetic modification, but its efficiency is lower than high NHEJ in eukaryocyte.The gene inactivation carried out by DSB be easy to cause to induce in protein coding gene to be inserted into frame Missing, still there may be functional protein and frameshit insertion and deletion, so as to cause that with immunogenicity and may have not Know the translation of the outer frame polypeptide sequence of effect.Therefore, it is necessary to the methods that accurate edits genome avoids DSB simultaneously.

It in order to avoid DNA damage during gene editing and eliminates the needs of HDR donor template is provided, Komor et al. exists A kind of new method for being known as " gene editing device " (BE) is developed in mammalian cell.In the base editing system, use Rat cytidine deaminase (rAPOBEC1) and uracil glycosylase enzyme inhibitor (UGI) are by Cas9 mutant (D10A or D10A& H840A) engineering, which may be implemented cytimidine (C) can be completed without DSB in target site, is converted into uracil (U).This base Because the advantages of group edit methods, is that it does not need double-strand DNA cleavage or donor dna template not only, but also can be straight in the editing window Editor's single nucleotide acid is connect, amino acid mutation or gene inactivation are completed.CRISPR/nCas9 base editing system because it is simple, Efficiently, the Genomic damage of low off-target rate and reduction, is widely used to mammalian cell recently, zebra fish, plant and thin Genome editor in bacterium.However, there are no construct and answer about CRISPR/nCas9 base editing system in filamentous fungi Report.

Aspergillus niger is a kind of well-known model organism for being used to study filamentous fungi biology, and natural polymer secretes energy Power is used in industrial biotechnology for a long time, for producing homologous and heterologous protein expression.Microbiological genetic engineering Development enables Microbial Breeding to free from conventional method, such as ultraviolet mutagenesis and chemical reagent mutagenesis.Using The research to gene function and genetic engineering is accelerated in the genome edit tool CRISPR/Cas9 of filamentous fungi.However, During filamentous fungi genetic modification, the FAQs of CRISPR/Cas9 system (DSB and need donor dna) is still had.

Summary of the invention

In order to overcome the deficiencies of the prior art, the present invention provides a kind of pFC330-BEC for being able to achieve the accurate point mutation of base Plasmid and its application.The plasmid (pFC330-BEC) can be efficiently and quickly by filamentous fungi (such as Aspergillus niger strain) The cytimidine in any site on genome is mutated into thymidine, can be realized the mutation of amino acid or the inactivation of gene.

We develop a base using rat rAPOBEC1 deaminase fusion nCas9 and UGI albumen in aspergillus niger Editing system (application method of pFC330-BEC plasmid) provides a kind of simple and efficient base editing side for aspergillus niger Method.

The purpose of the present invention is realized at least through one of following technical solution.

A kind of pFC330-BEC plasmid being able to achieve the accurate point mutation of base provided by the invention, nucleotide sequence such as SEQ Shown in ID NO:3.

Further, the pFC330-BEC plasmid, containing through aspergillus niger codon optimization and can in aspergillus niger table The genetic fragment and filamentous fungi autonomously replicating sequence AMA1 of the rAPOBEC1-XTEN-nCas9-UGI reached.

Further, the rAPOBEC1-XTEN-nCas9-UGI fusion segment includes artificial synthesized and through black The rAPOBEC1-XTEN genetic fragment (SEQ ID NO:1) and UGI genetic fragment (SEQ ID NO:2) of aspergillus codon optimization.

Further, the rAPOBEC1-XTEN-nCas9-UGI fusion segment, is able to use aspergillus fumigatus source Tef1 gene promoter Ptef driving ( C S,Nielsen J B,Kogle M E,et al.A CRISPR- Cas9system for genetic engineering of filamentous fungi[J].PLoS One,2015,10 (7): e0133085.), so that it is expressed in aspergillus niger.

Further, the pFC330-BEC plasmid includes the site BglII that can be used to be inserted into sgRNA segment, can be inserted Enter sgRNA；The sgRNA of insertion is responsible for guiding rAPOBEC1-nCas9-UGI fusion protein in the specific editor position of genome.

Further, the pFC330-BEC plasmid includes pyrG selection markers and the filiform that can be realized mark cycle Fungi autonomously replicating sequence AMA1.

Further, the pFC330-BEC plasmid is also containing the plasmid replication origin ori and large intestine bar in Escherichia coli Bacterium ampicillin resistance gene segment AmpR, the AmpR are the ampicillin resistance genes (AmpR) of Escherichia coli, PFC330-BEC plasmid needs to be transferred to Escherichia coli and expands culture period, and Gene A mpR can be used as pFC330-BEC matter The label of grain, to realize screening and expansion culture of the pFC330-BEC plasmid in Escherichia coli.

The pFC330-BEC plasmid that the accurate point mutation of base is able to achieve described in present invention offer carries out alkali in filamentous fungi The application of base editor.

Further, the filamentous fungi includes aspergillus niger.

Preferably, the aspergillus niger is aspergillus niger CBS513.88 bacterial strain or aspergillus niger FGSC1279 bacterial strain.

Further, the base editor includes the editor that cytimidine sports thymidine.

Further, the rAPOBEC1 genetic fragment is derived from rat (rat), can express cytimidine (C) deamination Enzyme, the XTEN genetic fragment are the hinge regions (linker) of 16 amino acid, and base sequence is by aspergillus niger password Son optimization, DNA sequence dna are as follows: 5'-agcggttccgagaccccgggcaccagcgaatccgccacccccgagtcc-3'； Its function is to carry out deamination to cytimidine C in DNA sequence dna to form uracil (U).

UGI genetic fragment of the present invention is uridine glycosylase repressor (uracil glycosylase Inhibitor abbreviation), can express UGI albumen, and the UGI albumen is able to suppress the C after deaminase rAPOBEC1 modification (being mutated into U in fact) independently repairs through DNA and reverts back to C.

The nucleotide for the rAPOBEC1-XTEN genetic fragment (rAPOBEC1-XTEN (optimized)) that the present invention uses Sequence is as shown in SEQ ID NO:1, the nucleotide sequence such as SEQ ID NO:2 institute of the UGI genetic fragment (UGI (optimized)) Show；The rAPOBEC1-XTEN genetic fragment and UGI genetic fragment pass through aspergillus niger codon optimization, can be in aspergillus niger Middle normal expression.

The filamentous fungi autonomously replicating sequence AMA1 of the present invention that can be realized mark cycle is existing literature report, Its function is to realize that plasmid realizes autonomous duplication in filamentous fungal cells, and the document in source is shown in C S,Nielsen J B,Kogle M E,et al.A CRISPR-Cas9system for genetic engineering of filamentous fungi[J].PLoS One,2015,10(7):e0133085.。

In application method provided by the invention, the process of the base editor are as follows: pFC330-BEC plasmid is transferred to aspergillus niger Afterwards, promoter Ptef drives the expression of fusion protein rAPOBEC1-nCas9-UGI, and wherein it is single-stranded to be responsible for DNA for nCas9 albumen Cutting, rAPOBEC1 albumen are responsible for the deamination to cytimidine (C), and the function that UGI albumen inhibits DNA itself to repair, this melts Hop protein targets target gene under the guidance of the sgRNA introduced by the site BglII, realizes that target gene is pinpoint Base mutation function.

The present invention provides not only above-mentioned plasmid and additionally provides using the plasmid the new of in filamentous fungi base mutation Method, and if it works, it will promote the accuracy of its molecular breeding well.

Compared with prior art, the invention has the advantages that and the utility model has the advantages that

PFC330-BEC plasmid provided by the invention can be efficiently and quickly by appointing on various aspergillus niger genomes The cytimidine in meaning site is mutated into thymidine, realizes amino acid mutation and gene inactivation etc.；The pFC330-BEC plasmid exists The molecular breeding of aspergillus niger, physiological property, metabolite, host's transformation, industrial production etc. have broad application prospects, New technology platform is provided for the transformation of aspergillus niger genetic engineering.

Detailed description of the invention

Fig. 1 is the pFC330-BEC plasmid construct schematic diagram provided by the invention for being able to achieve the accurate point mutation of base；

Fig. 2 is real in aspergillus niger CBS513.88 bacterial strain using the pFC330-BEC plasmid in the embodiment of the present invention two Now to the sequencing result figure of protease regulator gene prtT base editor；

Fig. 3 is to be realized in aspergillus niger FGSC1279 bacterial strain to color in the embodiment of the present invention three using pFC330-BEC plasmid The result sequencer map of plain controlling gene fwnA base editor；

Fig. 4 is to make pigment tune in aspergillus niger FGSC1279 bacterial strain using FC330-BEC plasmid in the embodiment of the present invention three Control the phenotype plate of gene fwnA inactivation.

Specific embodiment

Specific implementation of the invention is described further below in conjunction with attached drawing and example, but implementation and protection of the invention It is without being limited thereto.If it is existing to be that those skilled in the art can refer to it is noted that there is the not special process of detailed description below Technology realize or understand.Reagents or instruments used without specified manufacturer, be considered as can by it is commercially available be commercially available it is normal Advise product.

Molecular biology experiment technology employed in following embodiment includes PCR amplification, plasmid extraction, DNA fragmentation The technical operations such as digestion, connection, gel electrophoresis referring specifically to " Molecular Cloning:A Laboratory guide " (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitang etc. is translated, and 2002, Beijing: Science Press).

According to Komor et al., 2016 rAPOBEC1 reported in the literature, the nucleotide sequence of the segments such as XTEN, UGI (Komor,A.C.,Kim,Y.B.,Packer,M.S.,Zuris,J.A.,&Liu,D.R.(2016).Programmable editing of a target base in genomic DNA without double-stranded DNA Cleavage.Nature, 533 (7603), 420.), bibliography provide aspergillus niger codon optimization table (Yin, C., Wang, B.,He,P.,Lin,Y.,&Pan,L.(2014).Genomic analysis of the aconidial and high- performance protein producer,industrially relevant Aspergillus niger SH2strain.Gene, 541 (2), 107-114.), the rAPOBEC1- of commission Nanjing Genscript Biotechnology Co., Ltd. synthesis The nucleotide sequence of XTEN and UGI, specific nucleotide sequence are respectively SEQ ID NO:1 and SEQ ID NO:2；It is described RAPOBEC1-XTEN and UGI nucleotide sequence passes through aspergillus niger codon optimization.

Embodiment one, genetic recombination building pFC330-BEC recombinant plasmid (pFC330-BEC plasmid)

The primer sequence used in embodiment one such as the following table 1 (synthesizes) in Guangzhou Tian Yihuiyuan Biotechnology Co., Ltd:

Table 1

The composition of pFC330-BEC recombinant plasmid is as shown in Figure 1, wherein the site BglII: for being inserted into sgRNA segment； Ptef: aspergillus fumigatus source tef1 gene promoter, for driving expressing fusion protein；AmpR: ampicillin resistance gene； Ori: the plasmid replicon (replication origin) in Escherichia coli；PyrG: uracil auxotrophy label；AMA1: filamentous fungi Autonomously replicating sequence；RAPOBEC1: the cytosine deaminase of codon optimization；NCas9:10 amino acids are mutated (D10A's) Cas9 albumen；UGI: uracil dna glycosylase inhibits albumen.

The pFC330-BEC recombinant plasmid contains the rAPOBEC1-nCas9-UGI genetic fragment that can be expressed and silk Shape fungi autonomously replicating sequence AMA1, the sequence of the recombinant plasmid (pFC330-BEC plasmid) is as shown in SEQ ID NO:3. The building of pFC330-BEC recombinant plasmid, comprises the following steps that

1, it (is purchased from restriction enzyme PacI (being purchased from New England Biolabs (Beijing) LTD.) and PmlI New England Biolabs (Beijing) LTD.) to pFC330 plasmid (C.S.,Nielsen,J.B., Kogle,M.E.,&Mortensen,U.H.(2015).A CRISPR-Cas9 system for genetic engineering Of filamentous fungi.PLoS One, 10 (7), e0133085.) double digestion is carried out, through gel electrophoresis, gel extraction Linearized nucleic acid piece containing pyrG label, ampicillin resistance gene AmpR and filamentous fungi autonomously replicating sequence AMA1 Section；

2, it using pFC330 plasmid as template, expands to obtain nCas9 segment by primer pair cas9-10GCT-F and cas9-R； By primer pair Ptef-pacI+20bp-F and Ptef-R (20bp), primer pair Ttef-F and Ttef-PmlI+20bp-R are expanded To Ptef and Ttef segment, (it is purchased from Thermo, article No. by PCR product QIAquick Gel Extraction Kit: 00524864) returned PCR product It receives；

3, using artificial synthesized rAPOBEC1-XTEN segment as template, pass through primer pair rAPOBEC1-F and rAPOBEC1- R expands to obtain the rAPOBEC1-XTEN segment containing fusion connector；

4, it using artificial synthesized UGI segment as template, expands to obtain by primer pair SGGS-UGI-F and SGGS-UGI-R UGI segment containing fusion connector；(concrete operation method is shown in the Hifi DNA Assembly Master of NEBuilder company The specification of Mix)

5, with Infusion method, (concrete operation method is shown in the Hifi DNA Assembly of NEBuilder company The specification of Master Mix) DNA fragmentation obtained in step 1-4 connected into circular plasmids, building obtains nCas9 base volume It collects plasmid pFC330-BEC (pFC330-rAPOBEC1-XTEN-nCAS9-UGI).The plasmid is first passed through chemical transformation to be transferred to Escherichia coli (E.coli MatchI TI), obtain positive colony, plasmid are extracted after being sequenced, obtain pFC330-BEC plasmid (i.e. pFC330-BEC plasmid vector).

Embodiment two, pFC330-BEC plasmid realize efficient base editor in aspergillus niger CBS513.88 bacterial strain:

It can be realized in aspergillus niger CBS513.88 bacterial strain with pFC330-BEC plasmid and the efficient base of different genes is compiled Volume.For having chosen the prtT gene (protease regulator gene prtT) of aspergillus niger in experiment, in aspergillus niger CBS513.88 bacterial strain Middle progress base editor's experiment.

Fig. 2 is real in aspergillus niger CBS513.88 bacterial strain using the pFC330-BEC plasmid in the embodiment of the present invention two Now to the sequencing result figure of protease regulator gene prtT base editor.

Wherein the DNA sequence dna (TTTGATTAAAAGCATCATCA) in Fig. 2 box is protospacer sequence (20bp)； Box above sequencer map is corresponding amino acid；Arrow indicates the site of mutation；Right side box is the amino to mutate Sour position and corresponding transformant number.

Embodiment two carries out base using the prtT gene in pFC330-BEC plasmid pair aspergillus niger CBS513.88 bacterial strain and dashes forward Become, 142 threonines (T) is mutated into isoleucine (I), while having also appeared the DNA sequencing result of same sense mutation；Specifically The threonine (T) of No. 142 positions is mutated into including being completed by the way that two C of No. 6,7 positions in protospacer are mutated into T Isoleucine (I)；The single base mutation of No. 7 positions is had also appeared simultaneously, this sports same sense mutation.

1, a NGG (any base of N expression, G are first selected on the target gene prtT of aspergillus niger CBS513.88 bacterial strain For guanine base) DNA fragmentation of 20 bases before sequence (20 bases are referred to as protospacer).This step It is characterized in that, the cytimidine C for needing to mutate should be located at the position 2-8 of upper 20 bases of protospacer (with 5' → 3' Sequential counting).Such as test the DNA sequence dna of selected prtT gene protospacer are as follows: 5'- TTTGACCAAAAGCATCATCA-3', wherein the cytimidine C (underscore overstriking) that base editor may occur is No. 6 positions and No. 7 Position.

2, it is synthesized by Guangzhou Ai Ji Bioisystech Co., Ltd containing the protospacer sequence and can be in filiform The sgRNA (prtT-sgRNA) of normal transcription in fungi, particular sequence is as shown in SEQ ID NO:4.

3, to enable sgRNA segment to be inserted into pFC330-BEC plasmid, the amplification containing BglII restriction enzyme site need to be designed Primer, particular sequence are as follows:

Forward primer PU6-F:

5'-GAAGATCTTCGCAGGCGGTTGCAAGCGATC-3'；

Reverse primer TU6-R:

5'-GAAGATCTTCAGCAGCTCTATATCACGTGACG-3'；

In Guangzhou, Tian Yihuiyuan Biotechnology Co., Ltd synthesizes above-mentioned two primers, and expands according to the procedure below PrtT-sgRNA:

98℃5min；98 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 30s；Totally 30 recycle, then 72 DEG C of 5min；Last 25 DEG C, 1s； PrtT-sgRNA amplified production is the identification of 1% agarose gel electrophoresis through mass fraction, is recycled with PCR product QIAquick Gel Extraction Kit pure Change PCR product.

By the prtT-sgRNA amplified production of recycling, digestion is carried out according to following condition:

Template 40ul, FD buffer 5ul (is purchased from Thermol, article No.: FD0083), and restriction endonuclease BglII5ul (is purchased from Thermol, article No.: FD0083), 37 DEG C 2 hours.

After digestion, digestion products are recycled with PCR product QIAquick Gel Extraction Kit, are obtained containing BglII digestion cohesive end PrtT-sgRNA segment；

4, the pFC330-BEC plasmid vector constructed in embodiment one is extracted, carries out single endonuclease digestion with restriction endonuclease BglII, is obtained Linearized vector.Its reaction system is as follows: 5ul FD buffer (is purchased from Thermol, article No.: FD0083), 2.5ul BglII (being purchased from Thermol, article No.: FD0083), 2.5ul fastAP (dephosphorylation) (are purchased from Thermol, article No.: EF0651), PFC330-BEC plasmid 40ul (includes 10ug Plasmid DNA).37 DEG C are reacted 8 hours, and linearisation pFC330-BEC carrier is obtained.

5, using DNA fragmentation connection kit (DNA Ligation Kit Ver 2.1, article No.: 6022) will linearisation PFC330-BEC carrier and the prtT-sgRNA containing BglII cohesive end connect into a cyclic plasmid pFC330-BEC- prtTsgRNA.Connection product (cyclic plasmid pFC330-BEC-prtTsgRNA) is transformed into the Escherichia coli of competence MatchI TI (is purchased from Takara company), and picking transformant is in liquid LB+Amp (100 μ g/ml of final concentration) after 37 DEG C of culture 12h Culture medium, under the conditions of 37 DEG C, shaking speed be that 200rpm cultivates 12h, be bacterium solution PCR, preliminary screening goes out positive transformant.By bacterium The positive transformant that liquid PCR is screened extracts plasmid processing, digestion verification, selects 2 plasmid sizes correctly and digestion verification Correct positive transformant, is sequenced.It compares after taking sequencing result with template sequence, obtains correct pFC330- BEC-prtTsgRNA base editor's carrier.

6, expression of the prtT gene base editor carrier in aspergillus niger CBS513.88: according to (Gomi K, Iimura Y, Hara S.Integrative transformation of Aspergillus oryzae with a plasmid containing the Aspergillus nidulans argB gene[J].Agricultural and biological Chemistry, 1987,51 (9): 2549-2555.) in provide the step of, prepare host strain aspergillus niger CBS513.88 (Δ ku Δ The base editor's carrier pFC330-BEC-prtTsgRNA plasmid obtained above that obtains is transformed into original by protoplast pyrG) In raw plastid, hypertonic CD culture medium is coated with (comprising 1M sucrose, 0.3% (w/v) NaNO₃, 0.2% (w/v) KCl, 0.05% (w/ v)MgSO₄.7H₂O, 0.1% (w/v) K₂HPO₄.3H₂O, 0.001% (w/v) FeSO₄.7H₂O, 2% (w/v) agar powder, pH5.5, The unit of w/v is g/mL), 30 DEG C of incubators are put into, observe transformant growing state after 5d.

7, it aspergillus niger transformant target site PCR and Sanger sequencing: after above-mentioned transformant is grown on hypertonic CD plate, chooses It (include 2% (w/v) glucose, 0.3% (w/v) NaNO to new common CD solid plate₃, 0.2% (w/v) KCl, 0.05% (w/ v)MgSO₄.7H₂O, 0.1% (w/v) K₂HPO₄.3H₂O, 0.001% (w/v) FeSO₄.7H₂O, 2% (w/v) agar powder, pH 5.5, w/v unit is g/mL), it is put into 30 DEG C of incubator culture 5d and grows up to bacterium colony, after bacterium colony is grown up, extract conversion subbase Because of group, prtT Gene Partial is expanded as pcr template.Design prtT partial sequence amplimer:

Forward primer prtT-BE-F:

5'-ATGCGTGCCGTCGCTGTCTA-3'

Reverse primer prtT-BE-R:

5'-CAGCCGTTTCATTGTCCACCA-3'

In Guangzhou, Tian Yihuiyuan Biotechnology Co., Ltd synthesizes above-mentioned two primers, and expands prtT according to the procedure below Partial sequence:

98℃5min；98 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 50s；Totally 30 recycle, then 72 DEG C of 5min；Last 25 DEG C, 1s； Amplified production is that 1% agarose gel electrophoresis is identified through mass fraction, with PCR product QIAquick Gel Extraction Kit recovery purifying PCR product, And PCR product is sent to Guangzhou Tian Yihuiyuan Bioisystech Co., Ltd sequence verification.

Experimental result discovery has 3 transformants that the mutation in No. 6 sites occurs, there is 6 in 15 transformants of selection No. 6 and No. 7 double mutation occur, sequencing result is as shown in Figure 2.

Embodiment three, pFC330-BEC plasmid realize efficient base editor in aspergillus niger FGSC1279 bacterial strain:

It can be realized in aspergillus niger FGSC1279 bacterial strain to the efficient base editor of different genes with pFC330-BEC plasmid. For having chosen pigment gene fwnA gene in experiment, base editor experiment (result is carried out in aspergillus niger FGSC1279 bacterial strain See Fig. 3 and Fig. 4).Fig. 3 is that the fwnA gene in pFC330-BEC plasmid pair aspergillus niger FGSC1279 bacterial strain carries out base mutation survey Sequence result figure；

Wherein the DNA sequence dna (GGTAATTGAGCATTTACGCC) in Fig. 3 box is protospacer sequence (20bp)； Box above sequencer map is corresponding amino acid；Arrow indicates the site of mutation；Right side box is the amino to mutate Sour position and corresponding transformant number.

It is completed by the way that the C of in protospacer 6, No. 7 positions is mutated into T and the arginine of No. 557 positions is mutated into termination Codon, No. 556 positions are same sense mutation；Have also appeared the single base mutations of No. 7 positions simultaneously, the mutation is by the smart ammonia of No. 557 positions Acid mutation realizes gene inactivation at terminator codon；Fig. 4 is using FC330-BEC plasmid in the embodiment of the present invention three black The phenotype plate for inactivating pigment controlling gene fwnA in aspergillus FGSC1279 bacterial strain, wherein the wt in the upper right corner is wild strain, herein Phenotype group after (wt) as a control group, with fwnA gene inactivation compares.As can be seen from Figure 4, the wild strain of control produces black spore Son；Massive plate is 9 plants of mutant strains by single base inactivation, and fwnA gene inactivates the generation for leading to white spore.

1, some NGG is first selected on the target gene fwnA of aspergillus niger FGSC1279 bacterial strain, and (N indicates any base, G For guanine base) DNA fragmentation of 20 bases before sequence (20 bases are referred to as protospacer).This step It is characterized in that, the cytimidine C for needing to mutate should be located at the position 2-8 of upper 20 bases of protospacer (with 5' → 3' Sequential counting).Such as test the DNA sequence dna of selected fwnA gene protospacer are as follows: 5'- GGTAACCGAGCATTTACGCC-3', wherein the cytimidine C (underscore overstriking) that base editor may occur is No. 6 positions and No. 7 Position.

2, synthesis containing the protospacer sequence and can in filamentous fungi normal transcription sgRNA (fwnA- SgRNA), particular sequence is shown in SEQ ID NO:5.

3, to enable sgRNA segment to be inserted into pFC330-BEC plasmid, the amplification containing BglII restriction enzyme site need to be designed Primer, particular sequence are as follows:

Forward primer PU6-F:

5'-GAAGATCTTCGCAGGCGGTTGCAAGCGATC-3'；

Reverse primer TU6-R:

5'-GAAGATCTTCAGCAGCTCTATATCACGTGACG-3'；

In Guangzhou day, the biological Co., Ltd of the remote science and technology of a brightness synthesizes above-mentioned two primers, and expands according to the procedure below FwnA-sgRNA:

98℃5min；98 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 30s；Totally 30 recycle, then 72 DEG C of 5min；Last 25 DEG C, 1s； FwnA-sgRNA amplified production is the identification of 1% agarose gel electrophoresis through mass fraction, is recycled with PCR product QIAquick Gel Extraction Kit pure Change PCR product.

By the fwnA-sgRNA amplified production of recycling, digestion is carried out according to following condition:

Template 40ul, FD buffer 5ul (is purchased from Thermol, article No.: FD0083), and restriction endonuclease BglII 5ul (is purchased from Thermol, article No.: FD0083), 37 DEG C 2 hours.

After digestion, digestion products are recycled with PCR product QIAquick Gel Extraction Kit.It obtains containing BglII digestion cohesive end FwnA-sgRNA segment.

4, the pFC330-BEC plasmid vector constructed in embodiment one is extracted, single endonuclease digestion is carried out with inscribe BglII, obtains line Property carrier.Its reaction system is as follows: 5ul FD buffer (is purchased from Thermol, article No.: FD0083), 2.5ul BglII (purchase From Thermol, article No.: FD0083), 2.5ul fastAP (dephosphorylation) (is purchased from Thermol, article No.: EF0651), PFC330-BEC plasmid 40ul (includes 10ug Plasmid DNA), and 37 DEG C are reacted 8 hours, obtains linearisation pFC330-BEC carrier.

5, using DNA fragmentation connection kit (DNA Ligation Kit Ver 2.1, article No.: 6022) will linearisation PFC330-BEC carrier and the fwnA-sgRNA containing BglII cohesive end connect into a cyclic plasmid pFC330-BEC- fwnAsgRNA.Connection product converts Escherichia coli MatchI TI (being purchased from Takara company) competence, chooses after 37 DEG C of culture 12h Take transformant under the conditions of liquid LB+Amp (100 μ g/ml of final concentration) culture medium, 37 DEG C, shaking speed is 200rpm culture 12h, is bacterium solution PCR, and preliminary screening goes out positive transformant.Positive transformant upgrading grain that bacterium solution PCR is screened, digestion verification, It selects that 2 plasmid sizes are correct and the correct positive transformant of digestion verification, is sequenced.Take after sequencing result with template Sequence compares, and obtains correct pFC330-BEC-fwnAsgRNA base editor's carrier.

6, expression of the fwnA gene base editor carrier in aspergillus niger FGSC1279: according to (Gomi K, Iimura Y, Hara S.Integrative transformation of Aspergillus oryzae with a plasmid containing the Aspergillus nidulans argB gene[J].Agricultural and biological Chemistry, 1987,51 (9): 2549-2555.) in provide the step of prepare host strain aspergillus niger FGSC1279 (Δ ku Δ Base editor carrier pFC330-BEC-fwnAsgRNA plasmid obtained above is transformed into plasm by protoplast pyrG) In body, hypertonic CD culture medium is coated with (comprising 1M sucrose, 0.3% (w/v) NaNO₃, 0.2% (w/v) KCl, 0.05% (w/v) MgSO₄.7H₂O, 0.1% (w/v) K₂HPO₄.3H₂O, 0.001% (w/v) FeSO₄.7H₂O, 2% (w/v) agar powder, pH 5.5, The unit of w/v is g/mL), 30 DEG C of incubators are put into, observe transformant growing state after 3d.

7, it aspergillus niger transformant target site PCR and Sanger sequencing: after above-mentioned transformant is grown on hypertonic CD plate, chooses It (include 2% (w/v) glucose, 0.3% (w/v) NaNO to new common CD solid plate₃, 0.2% (w/v) KCl, 0.05% (w/ v)MgSO₄.7H₂O, 0.1% (w/v) K₂HPO₄.3H₂O, 0.001% (w/v) FeSO₄.7H₂O, 2% (w/v) agar powder, pH 5.5, w/v unit is g/mL), it is put into 30 DEG C of incubator culture 3d and grows up to bacterium colony, after bacterium colony is grown up, extract conversion subbase Because of group, fwnA Gene Partial is expanded as pcr template.Design fwnA partial sequence amplimer；Wherein,

Forward primer fwnA-BE-F:

5'-TGTCGCCTCGGGAAGCACTC-3'；

Reverse primer fwnA-BE-R:

5'-AATACCAGGAGCCGTTGAGG-3'。

In Guangzhou, Tian Yihuiyuan Biotechnology Co., Ltd synthesizes above-mentioned two primers, and expands fwnA according to the procedure below Partial sequence:

98℃5min；98 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min15s；Totally 30 recycle, then 72 DEG C of 5min；Last 25 DEG C, 1s；Amplified production is the identification of 1% agarose gel electrophoresis through mass fraction, with PCR product QIAquick Gel Extraction Kit recovery purifying PCR product, and PCR product is sent to Guangzhou Tian Yihuiyuan Biotechnology Co., Ltd sequence verification.

Experimental result discovery has 21 transformants that cytimidine occurs to thymidine in 31 transformants of selection Base mutation, wherein 18 occur No. 6 and No. 7 double mutation, 3 occur No. 7 single mutation, sequencing result and phenotype such as Fig. 3 It is shown.

A kind of system (the application side of pFC330-BEC plasmid of fixed point editor filamentous fungi genome provided by the invention Method), using BE3 filamentous fungi expression vector, (expression is by nCas9 (D10A), deaminase (rAPOBEC1) and ura DNA glycosyl Change the fusion protein that enzyme inhibits albumen (UGI) composition, gene editing is carried out to filamentous fungi.Above-described embodiment is with aspergillus niger prtT It is that target gene verifies the system with fwnA, the results showed that, in two selected target genes, it is prominent to obtain expected fixed point Become transformant, accurate base point mutation is realized in aspergillus niger, to reach the effect of amino acid mutation or gene inactivation Fruit.

Above embodiments are only preferrred embodiment of the present invention, for explaining only the invention, are not intended to limit the present invention, this Field technical staff should belong to guarantor of the invention without departing from change made under spirit of the invention, replacement, modification etc. Protect range.

Sequence table

<110>South China Science & Engineering University

<120>a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base and its application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 735

<212> DNA

<213>artificial synthesized (artificial sequence)

<400> 1

atgagcagcg aaaccggtcc tgtggctgtg gaccctaccc tccgccgtcg gatcgagcct 60

cacgagttcg aagtcttctt cgatccgcgt gagctgcgga aggaaacctg cctgctctac 120

gaaatcaact ggggcggtcg ccacagcatc tggcgtcata cctcccagaa caccaacaag 180

catgtcgagg tgaacttcat cgaaaaattc accaccgagc ggtacttctg ccccaacacc 240

cgctgctcca tcacctggtt cctcagctgg tccccttgcg gtgaatgcag ccgcgctatc 300

accgagttcc tgtcccgtta cccgcacgtg accctcttca tctacatcgc tcggctgtac 360

caccatgctg accccaggaa caggcaaggt ctgagggatc tcatcagctc cggtgtcacc 420

atccagatca tgaccgagca agaatccggc tactgctggc gtaacttcgt gaactacagc 480

ccttccaacg aagcccactg gcctcgttac ccgcatctgt gggtccggct ctacgtgctg 540

gagctctact gcatcatcct gggtctgcct ccctgcctga acatcctccg ccgtaagcag 600

ccccaactca ccttcttcac catcgccctc cagagctgcc actaccaacg cctgccgccc 660

catatcctct gggctaccgg cctgaaaagc ggttccgaga ccccgggcac cagcgaatcc 720

gccacccccg agtcc 735

<210> 2

<211> 297

<212> DNA

<213>artificial synthesized (artificial sequence)

<400> 2

agcggcggtt ccaccaacct gagcgacatc atcgagaaag aaaccggcaa gcagctcgtc 60

atccaagagt ccatcctgat gctcccggag gaagtcgagg aagtgatcgg taacaaaccc 120

gaaagcgaca tcctggtcca caccgcctac gacgagagca ccgatgaaaa cgtgatgctg 180

ctcacctccg acgcccccga gtacaaacct tgggctctgg tcatccagga ttccaacggc 240

gaaaacaaaa tcaagatgct cagcggcggt tcccccaaga aaaagcgcaa ggtgtag 297

<210> 3

<211> 16766

<212> DNA

<213>artificial synthesized (artificial sequence)

<400> 3

accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 60

ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 120

gcgctgcgat gataccgcga gaaccacgct caccggctcc ggatttatca gcaataaacc 180

agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 240

ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 300

ttgttgccat cgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca 360

gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg 420

ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca 480

tggttatggc agcgctacat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 540

tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 600

cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 660

tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 720

gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 780

tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 840

ggaaatgttg aatactcata ttcttccttt ttcaatatta ttgaagcatt tatcagggtt 900

attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggtca 960

gtgttacaac caattaacca attctgaaca ttatcgcgag cccatttata cctgaatatg 1020

gctcataaca ccccttgttt gcctggcggc agtagcgcgg tggtcccacc tgaccccatg 1080

ccgaactcag aagtgaaacg ccgtagcgcc gatggtagtg tggggactcc ccatgcgaga 1140

gtagggaact gccaggcatc aaataaaacg aaaggctcag tcgaaagact gggcctttcg 1200

cccgggctaa ttatggggtg tcgcccttat tcgactctat agtgaagttc ctattctcta 1260

gaaagtatag gaacttctga agtggggatt taaatgcggc cgcgctgagg gtttaatcga 1320

cgaagcagct gacggccagt gccaagctta acgcgtaccc gggcccagta tatgttccgc 1380

agatgactgg agctctgcca tacgtgccct ctcaagcacc atttgttcca tctacagaga 1440

ctagtcacca actagtctat caagactcac agggtacatt gctgagacca actgaccaga 1500

ggcagggtag cggattgacg gctccatctc cttcacttac aaggtctatt gaaagccctt 1560

tagcatcacc aagcggagaa tagattgtta agcttatttt ttgtatactg ttttgtgata 1620

gcacgaagtt tttccacggt atcttgtaaa aatatatatt tgtggcgggc ttacctacat 1680

caaattaata agagactaat tataaactaa acacacaagc aagctacttt agggtaaaag 1740

tttataaatg cttttgacgt ataaacgttg cttgtattta ttattacaat taaaggtgga 1800

tagaaaacct agagactagt tagaaactaa tctcaggttt gcgttaaact aaatcagagc 1860

ccgagaggtt aacagaacct agaaggggac tagatatccg ggtagggaaa caaaaaaaaa 1920

aaacaagaca gccacatatt agggagacta gttagaagct agttccagga ctaggaaaat 1980

aaaagacaat gataccacag tctagttgac aactagatag attctagatt gaggccaaag 2040

tctctgagat ccaggttagt tgcaactaat actagttagt atctagtctc ctataactct 2100

gaagctagaa taacttacta ctattatcct caccactgtt cagctgcgca aacggagtga 2160

ttgcaaggtg ttcagagact agttattgac tagtcagtga ctagcaataa ctaacaaggt 2220

attaacctac catgtctgcc atcaccctgc acttcctcgg gctcagcagc cttttcctcc 2280

tcattttcat gctcattttc cttgtttaag actgtgacta gtcaaagact agtccagaac 2340

cacaaaggag aaatgtctta ccactttctt cattgcttgt ctcttttgca ttatccatgt 2400

ctgcaactag ttagagtcta gttagtgact agtccgacga ggacttgctt gtctccggat 2460

tgttggagga actctccagg gcctcaagat ccacaacaga gccttctaga agactggtca 2520

ataactagtt ggtctttgtc tgagtctgac ttacgaggtt gcatactcgc tccctttgcc 2580

tcgtcaatcg atgagaaaaa gcgccaaaac tcgcaatatg gctttgaacc acacggtgct 2640

gagactagtt agaatctagt cccaaactag cttggatagc ttacctttgc cctttgcgtt 2700

gcgacaggtc ttgcagggta tggttccttt ctcaccagct gatttagctg ccttgctacc 2760

ctcacggcgg atctgccata aagagtggct agaggttata aattagcact gatcctaggt 2820

acggggctga atgtaacttg cctttccttt ctcatcgcgc ggcaagacag gcttgctcaa 2880

attcctacca gtcacagggg tatgcacggc gtacggacca cttgaactag tcacagatta 2940

gttagcaact agtctgcatt gaatggctgt acttacgggc cctcgccatt gtcctgatca 3000

tttccagctt caccctcgtt gctgcaaagt agttagtgac tagtcaagga ctagttgaaa 3060

tgggagaaga aactcacgaa ttctcgactc ccttagtatt gtggtccttg gacttggtgc 3120

tgctatatat tagctaatac actagttaga ctcacagaaa cttacgcagc tcgcttgcgc 3180

ttcttggtag gagtcggggt tgggagaaca gtgccttcaa acaagccttc ataccatgct 3240

acttgactag tcagggacta gtcaccaagt aatctagata ggacttgcct ttggcctcca 3300

tcagttcctt catagtggga ggaccattgt gcaatgtaaa ctccatgccg tgggagttct 3360

tgtccttcaa gtgcttgacc aatatgtttc tgttggcaga gggaacctgt caactagtta 3420

ataactagtc agaaactatg atagcagtag actcactgta cgcttgaggc atcccttcac 3480

tcggcagtag acttcatatg gatggatatc aggcacgcca ttgtcgtcct gtggactagt 3540

cagtaactag gcttaaagct agtcgggtcg gcttactatc ttgaaatccg gcagcgtaag 3600

ctccccgtcc ttaactgcct cgagatagtg acagtactct ggggactttc ggagatcgtt 3660

atcgttatcg cgaatgctcg gcatactaac tgttgactag tcttggacta gtcccgagca 3720

aaaaggattg gaggaggagg aggaaggtga gagtgagaca aagagcgaaa taagagcttc 3780

aaaggctatc tctaagcagt atgaaggtta agtatctagt tcttgactag atttaaagag 3840

atttcgacta gttatgtacc tggagtttgg atataggaat gtgttgtggt aacgaaatgt 3900

aagggggagg aaagaaaaag tcgtcaagag gtaactctaa gtcggccatt cctttttggg 3960

aggcgctaac cataaacggc atggtcgact tagagttagc tcagggaatt tagggagtta 4020

tctgcgacca ccgaggaacg gcggaatgcc aaagaatccc gatggagctc tagctggcgg 4080

ttgacaaccc caccttttgg cgtttctgcg gcgttgcagg cgggactgga tacttcgtag 4140

aaccagaaag gcaaggcaga acgcgctcag caagagtgtt ggaagtgata gcatgatgtg 4200

ccttgttaac taggtaccaa tctgcagtat gcttgatgtt atccaaagtg tgagagagga 4260

aggtccaaac atacacgatt gggagagggc ctaggtataa gagtttttga gtagaacgca 4320

tgtgagccca gccatctcga ggagattaaa cacgggccgg catttgatgg ctatgttagt 4380

accccaatgg aaacggtgag agtccagtgg tcgcagataa ctccctaaat tccctgagct 4440

aactctaagt cgaccatgcc gtttatggtt agcgcctccc aaaaaggaat ggccgactta 4500

gagttacctc ttgacgactt tttctttcct cccccttaca tttcgttacc acaacacatt 4560

cctatatcca aactccaggt acataactag tcgaaatctc tttaaatcta gtcaagaact 4620

agatacttaa ccttcatact gcttagagat agcctttgaa gctcttattt cgctctttgt 4680

ctcactctca ccttcctcct cctcctccaa tcctttttgc tcgggactag tccaagacta 4740

gtcaacagtt agtatgccga gcattcgcga taacgataac gatctccgaa agtccccaga 4800

gtactgtcac tatctcgagg cagttaagga cggggagctt acgctgccgg atttcaagat 4860

agtaagccga cccgactagc tttaagccta gttactgact agtccacagg acgacaatgg 4920

cgtgcctgat atccatccat atgaagtcta ctgccgagtg aagggatgcc tcaagcgtac 4980

agtgagtcta ctgctatcat agtttctgac tagttattaa ctagttgaca ggttccctct 5040

gccaacagaa acatattggt caagcacttg aaggacaaga actcccacgg catggagttt 5100

acattgcaca atggtcctcc cactatgaag gaactgatgg aggccaaagg caagtcctat 5160

ctagattact tggtgactag tccctgacta gtcaagtagc atggtatgaa ggcttgtttg 5220

aaggcactgt tctcccaacc ccgactccta ccaagaagcg caagcgagct gcgtaagttt 5280

ctgtgagtct aactagtgta ttagctaata tatagcagca ccaagtccaa ggaccacaat 5340

actaagggag tcgagaattc gtgagtttct tctcccattt caactagtcc ttgactagtc 5400

actaactact ttgcagcaac gagggtgaag ctggaaatga tcaggacaat ggcgagggcc 5460

cgtaagtaca gccattcaat gcagactagt tgctaactaa tctgtgacta gttcaagtgg 5520

tccgtacgcc gtgcataccc ctgtgactgg taggaatttg agcaagcctg tcttgccgcg 5580

cgatgagaaa ggaaaggcaa gttacattca gccccgtacc taggatcagt gctaatttat 5640

aacctctagc cactctttat ggcagatccg ccgtgagggt agcaaggcag ctaaatcagc 5700

tggtgagaaa ggaaccatac cctgcaagac ctgtcgcaac gcaaagggca aaggtaagct 5760

atccaagcta gtttgggact agattctaac tagtctcagc accgtgtggt tcaaagccat 5820

attgcgagtt ttggcgcttt ttctcatcga ttgacgaggc aaagggagcg agtatgcaac 5880

ctcgtaagtc agactcagac aaagaccaac tagttattga ccagtcttct agaaggctct 5940

gttgtggatc ttgaggccct ggagagttcc tccaacaatc cggagacaag caagtcctcg 6000

tcggactagt cactaactag actctaacta gttgcagaca tggataatgc aaaagagaca 6060

agcaatgaag aaagtggtaa gacatttctc ctttgtggtt ctggactagt ctttgactag 6120

tcacagtctt aaacaaggaa aatgagcatg aaaatgagga ggaaaaggct gctgagcccg 6180

aggaagtgca gggtgatggc agacatggta ggttaatacc ttgttagtta ttgctagtca 6240

ctgactagtc aataactagt ctctgaacac cttgcaatca ctccgtttgc gcagctgaac 6300

agtggtgagg ataatagtag taagttattc tagcttcaga gttataggag actagatact 6360

aactagtatt agttgcaact aacctggatc tcagagactt tggcctcaat ctagaatcta 6420

tctagttgtc aactagactg tggtatcatt gtcttttatt ttcctagtcc tggaactagc 6480

ttctaactag tctccctaat atgtggctgt cttgtttttt ttttttgttt ccctacccgg 6540

atatctagtc cccttctagg ttctgttaac ctctcgggct ctgatttagt ttaacgcaaa 6600

cctgagatta gtttctaact agtctctagg ttttctatcc acctttaatt gtaataataa 6660

atacaagcaa cgtttatacg tcaaaagcat ttataaactt ttaccctaaa gtagcttgct 6720

tgtgtgttta gtttataatt agtctcttat taatttgatg taggtaagcc cgccacaaat 6780

atatattttt acaagatacc gtggaaaaac ttcgtgctat cacaaaacag tatacaaaaa 6840

ataagcttaa caatctattc tccgcttggt gatgctaaag ggctttcaat agaccttgta 6900

agtgaaggag atggagccgt caatccgcta ccctgcctct ggtcagttgg tctcagcaat 6960

gtaccctgtg agtcttgata gactagttgg tgactagtct ctgtagatgg aacaaatggt 7020

gcttgagagg gcacgtatgg cagagctcca gtcatctgcg gaacatatac tgggcccggg 7080

aagatctcat ggtcatagct gtttccgctg agggtttaat taagacctca gccgagacag 7140

cagaatcacc gcccaagtta agcctttgtg ctgatcatgc tctcgaacgg gccaagttcg 7200

ggaaaagcaa aggagcgttt agtgaggggc aatttgactc acctcccagg caacagatga 7260

ggggggcaaa aagaaagaaa ttttcgtgag tcaatatgga ttccgagcat cattttcttg 7320

cggtctatct tgctacgtat gttgatcttg acgctgtgga tcaagcaacg ccactcgctc 7380

gctccatcgc aggctggtcg cagacaaatt aaaaggcggc aaactcgtac agccgcgggg 7440

ttgtccgctg caaagtacag agtgataaaa gccgccatgc gaccatcaac gcgttgatgc 7500

ccagcttttt cgatccgaga atccaccgta gaggcgatag caagtaaaga aaagctaaac 7560

aaaaaaaaat ttctgcccct aagccatgaa aacgagatgg ggtggagcag aaccaaggaa 7620

agagtcgcgc tgggctgccg ttccggaagg tgttgtaaag gctcgacgcc caaggtggga 7680

gtctaggaga agaatttgca tcgggagtgg ggcgggttac ccctccatat ccaatgacag 7740

atatctacca gccaagggtt tgagcccgcc cgcttagtcg tcgtcctcgc ttgcccctcc 7800

ataaaaggat ttcccctccc cctcccacaa aattttcttt cccttcctct ccttgtccgc 7860

ttcagtacgt atatcttccc ttccctcgct tctctcctcc atccttcttt catccatctc 7920

ctgctaactt ctctgctcag cacctctacg cattactagc cgtagtatct gagcacttct 7980

cccttttata ttccacaaaa cataacacaa ccttcaccat gagcagcgaa accggtcctg 8040

tggctgtgga ccctaccctc cgccgtcgga tcgagcctca cgagttcgaa gtcttcttcg 8100

atccgcgtga gctgcggaag gaaacctgcc tgctctacga aatcaactgg ggcggtcgcc 8160

acagcatctg gcgtcatacc tcccagaaca ccaacaagca tgtcgaggtg aacttcatcg 8220

aaaaattcac caccgagcgg tacttctgcc ccaacacccg ctgctccatc acctggttcc 8280

tcagctggtc cccttgcggt gaatgcagcc gcgctatcac cgagttcctg tcccgttacc 8340

cgcacgtgac cctcttcatc tacatcgctc ggctgtacca ccatgctgac cccaggaaca 8400

ggcaaggtct gagggatctc atcagctccg gtgtcaccat ccagatcatg accgagcaag 8460

aatccggcta ctgctggcgt aacttcgtga actacagccc ttccaacgaa gcccactggc 8520

ctcgttaccc gcatctgtgg gtccggctct acgtgctgga gctctactgc atcatcctgg 8580

gtctgcctcc ctgcctgaac atcctccgcc gtaagcagcc ccaactcacc ttcttcacca 8640

tcgccctcca gagctgccac taccaacgcc tgccgcccca tatcctctgg gctaccggcc 8700

tgaaaagcgg ttccgagacc ccgggcacca gcgaatccgc cacccccgag tccgacaaga 8760

agtatagcat cgggctggct attggaacga actcggttgg ttgggctgtg attacggacg 8820

aatacaaggt gccatccaag aagtttaagg tcctgggaaa caccgaccgt cactcaatca 8880

agaagaatct cattggagcc ctgctcttcg atagtgggga gaccgccgaa gctactcgac 8940

tgaagcgaac ggctcgccgg cgttatacac gacgcaagaa tcgcatctgc tacctccagg 9000

agattttcag caacgaaatg gctaaggttg atgactcatt ctttcatcga ctcgaagaaa 9060

gtttcttggt cgaggaggat aagaagcacg agcgccatcc gatctttggt aacattgtgg 9120

atgaggttgc ctatcacgaa aagtacccaa ctatctatca tcttcgtaag aagctggtcg 9180

atagcacgga caaggctgat ttgcgactta tctacctggc actcgcgcac atgattaagt 9240

tccgcggcca ttttcttatc gagggtgacc tgaaccccga taattctgac gttgataagc 9300

tcttcatcca gttggtccaa acctacaatc agctgtttga ggaaaaccct attaatgcat 9360

ctggcgtgga cgccaaggct atcctttcgg cgcgcctgtc taagtcgcgg cgtttggaga 9420

accttatcgc acaactcccc ggcgaaaaga agaacggcct cttcggtaat ttgattgcgt 9480

tgtcacttgg tctgactcct aacttcaaga gtaattttga cctggcagag gatgcgaagc 9540

tccagttgtc taaggatacg tatgatgacg atctcgacaa cttgcttgcc caaatcggtg 9600

accagtacgc tgatcttttc ctggccgcta agaatctctc agatgcaatc ctgctcagtg 9660

acattttgcg ggtcaacacc gagattacta aggcccccct gtcagctagt atgatcaagc 9720

ggtatgatga gcaccatcag gacctcacct tgcttaaggc cctcgtgcgt cagcaattgc 9780

ctgagaagta caaggaaatc ttctttgacc aatccaagaa cggatacgca gggtatattg 9840

atggcggtgc gagccaggag gaattctaca agtttatcaa gccgattttg gagaagatgg 9900

acggcactga ggaactgctc gtcaagctga atcgcgaaga tttgcttcgt aagcaacgaa 9960

cgttcgacaa cggctccatc ccgcaccaga ttcatctggg cgagctccac gccatccttc 10020

gacgccagga agatttctac ccatttctga aggacaaccg tgagaagatc gaaaagattc 10080

ttacattccg aatcccctac tatgtgggac ctttggcccg tgggaattcc cgatttgctt 10140

ggatgacccg aaagagcgag gaaaccatca ctccgtggaa cttcgaggaa gtcgtggaca 10200

agggtgcatc cgcgcagagc ttcattgagc ggatgaccaa ttttgataag aaccttccga 10260

atgaaaaggt cctgccaaag cattcgctgc tctacgagta tttcaccgtg tataacgaac 10320

tgactaaggt caagtacgtg acggagggaa tgcggaagcc agccttcctc tcaggggaac 10380

aaaagaaggc tatcgtcgat ttgcttttta agaccaatcg taaagtgact gttaagcagc 10440

tgaaggagga ttatttcaag aagattgaat gtttcgactc cgtcgagatc agcggcgtgg 10500

aagatcgctt taacgcttcc ctcggtacct accacgacct gctcaagatc attaaggaca 10560

aggatttcct cgataacgag gaaaatgagg acatcttgga agatattgtc ctcacgttga 10620

cactttttga ggaccgcgaa atgatcgagg aacggctcaa gacatatgcc catttgttcg 10680

acgataaggt gatgaagcag ctgaagcggc gtcgatacac cggatggggt cgccttagcc 10740

ggaagctgat caacggcatt cgagataagc aatctggtaa gactatcttg gatttcctta 10800

agtcggacgg cttcgccaac cgcaatttta tgcagcttat tcacgacgat tccctgacgt 10860

tcaaggagga catccagaag gcacaagtct caggacaagg ggattccctg cacgagcata 10920

tcgccaacct ggctggatcc ccggcgatca agaaggggat tcttcagacc gtcaaggttg 10980

tcgacgagct ggtcaaggtg atgggccgtc ataagccaga aaacatcgtg attgagatgg 11040

cccgagaaaa tcagaccact caaaagggtc agaagaacag ccgcgagcgg atgaagcgga 11100

tcgaggaagg cattaaggaa cttggttctc agatcctgaa ggagcaccct gttgaaaaca 11160

cacagctcca aaatgagaag ctgtatctct actatttgca aaatggacgc gacatgtacg 11220

tcgatcagga gctcgacatt aaccggttgt cggactacga tgttgaccat atcgtcccgc 11280

aatccttcct taaggacgat agcattgata acaaggtgct gactcgctca gataagaacc 11340

ggggcaagtc cgacaatgtt ccaagcgagg aagtggttaa gaagatgaag aactactggc 11400

gccaattgct taatgccaag ctcatcacac agcgcaagtt tgacaacttg accaaggccg 11460

agcggggagg gctgagtgaa ctcgataagg ctggcttcat caagcgtcaa ctcgtggaga 11520

cgcgacagat cacaaagcac gttgctcaga ttctggactc ccggatgaac acaaagtacg 11580

acgagaatga taagctcatc cgtgaagtta aggtcattac cctcaagtct aagttggtgt 11640

cggatttccg caaggacttc caattttata aggttcggga gatcaacaat tatcaccatg 11700

cacatgatgc gtacctcaac gcagtcgtgg gaactgcgct catcaagaag tatcccaagt 11760

tggagtccga attcgtctac ggggattata aggtttacga cgtccgcaag atgatcgcca 11820

agagtgagca ggaaattggc aaggccacgg ctaagtattt cttttactcc aacatcatga 11880

atttctttaa gacggagatc acactcgcca atggagaaat ccgtaagcga cctttgattg 11940

agaccaacgg cgagactggt gaaatcgttt gggataaggg gcgcgacttc gctaccgtgc 12000

ggaaggttct gagcatgccg caagtcaata tcgtcaagaa aaccgaggtg cagacaggcg 12060

gtttctctaa ggaatcgatt cttccaaagc gtaactctga caagctgatc gctcgaaaga 12120

aggattggga ccccaagaag tatggagggt tcgattctcc tacagtggca tactcggttc 12180

tcgttgtcgc gaaggttgag aagggaaagt ctaagaagct gaagtcggtc aaggaactgc 12240

tcgggatcac cattatggag cgctccagct tcgaaaagaa tcccatcgac tttctcgagg 12300

ccaagggcta taaggaagtc aagaaggatc ttatcattaa gctgcctaag tactctttgt 12360

tcgagcttga aaacggtcga aagcgaatgc tcgcatcggc aggagagttg cagaagggga 12420

atgaattggc acttccctca aagtacgtga acttcctgta tctcgcgtcc cactacgaga 12480

agctgaaggg tagccctgag gacaacgaac agaagcaact ttttgttgag caacacaagc 12540

attatctgga tgagatcatt gaacagattt cagagttcag taagcgcgtc atcctcgccg 12600

atgctaatct cgacaaggtg ttgtcggcct acaacaagca ccgtgacaag ccgatccgag 12660

agcaggctga aaatatcatt catctgttca ccctcactaa cttgggagca ccagcagcgt 12720

tcaagtattt tgatacgaca atcgaccgta agcgatacac gtccacaaag gaggtgcttg 12780

atgcgaccct gattcatcaa tccatcactg ggctctatga aacccgtatc gaccttagtc 12840

aactgggggg cgacagcggc ggttccacca acctgagcga catcatcgag aaagaaaccg 12900

gcaagcagct cgtcatccaa gagtccatcc tgatgctccc ggaggaagtc gaggaagtga 12960

tcggtaacaa acccgaaagc gacatcctgg tccacaccgc ctacgacgag agcaccgatg 13020

aaaacgtgat gctgctcacc tccgacgccc ccgagtacaa accttgggct ctggtcatcc 13080

aggattccaa cggcgaaaac aaaatcaaga tgctcagcgg cggttccccc aagaaaaagc 13140

gcaaggtgta ggcggacatt cgatttatgc cgttatgact tccttaaaaa agcctttacg 13200

aatgaaagaa atggaattag acttgttatg tagttgattc tacaatggat tatgattcct 13260

gaacttcaaa tccgctgttc attattaatc tcagctcttc ccgtaaagcc aatgttgaaa 13320

ctattcgtaa atgtacctcg ttttgcgtgt accttgctta tcacgtgata ttacatgacc 13380

tggacagagt tctgcgcgaa agtcataacg taaatcccgg gcggtaggtg cgtcccgggc 13440

ggaaggtagt tttctcgtcc accccaacgc gtttatcaac ctcaactttc aacaaccatc 13500

atgccaccaa aagcgcgtaa aacaaagcga gatttgattg agcaagaggg caggatccaa 13560

tgcgcgattc aagacattaa aaatggaaaa tttcaaaaaa ttgcgcccgc agcgcgtgca 13620

tacaaaattc atcccaatac aagtgtaatt cctcgtgtac tgtgtaagcg cccactaggt 13680

aatatgacat gattacgaat tcgagctcgg tacccggccg gaactccacg tctagaggat 13740

ccaccagtga ttgaccaatg ttttatcttc tacagttctg cctgtctacc ccattctagc 13800

tgtacctgac tacagagtag tttaattgtg gttgacccca cagtcggagg cggaggaata 13860

cagcaccgat gtggcctgtc tccatccaga ttggcacgca atttttacac gcggaaaaga 13920

tcgagataga gtacgacttt aaatttagtc cccggcggct tctattttag aatatttgag 13980

atttgattct caagcaattg atttggttgg gtcaccctca attggataat atacctcatt 14040

gctcggctac ttcaactcat caatcaccgt cataccccgc atataaccct ccattcccac 14100

gatgtcgtcc aagtcgcaat tgacttacgg tgctcgagcc agcaagcacc ccaatcctct 14160

ggcaaagaga ctttttgaga ttgccgaagc aaagaagaca aacgttaccg tctctgctga 14220

tgtgacgaca acccgagaac tcctggacct cgctgaccgt acggaagctg ttggatccaa 14280

tacatatgcc gtctagcaat ggactaatca acttttgatg atacaggtct cggtccctac 14340

atcgccgtca tcaagacaca catcgacatc ctcaccgatt tcagcgtcga cactatcaat 14400

ggcctgaatg tgctggctca aaagtacaac tttttgatct tcgaggaccg caaattcatc 14460

gacatcggca ataccgtcca gaagcaatac cacggcggtg ctctgaggat ctccgaatgg 14520

gcccacatta tcaactgcag cgttctccct ggcgagggca tcgtcgaggc tctggcccag 14580

accgcatctg cgcaagactt cccctatggt cctgagagag gactgttggt cctggcagag 14640

atgaccccca aaggatcgct ggctacgggc gagtatacca aggcatcggt tgactacgct 14700

cgcaaataca agaacttcgt tatgggtttc gtgtcgacgc gggccctgac ggaagtgcag 14760

tcggatgtgt cttcagcctc ggaggatgaa gatttcgtgg tcttcacgac gggtgtgaac 14820

ctctcttcca aaggagataa gcttggacag caataccaga ctcctgcatc ggctattgga 14880

cgcggtgccg actttatcat cgccggtcga ggcatctacg ctgctcccga cccggttgaa 14940

gctgcacagc ggtaccagaa agaaggctgg gaagcttata tggccagagt atgcggcaag 15000

tcatgatttc ctcttggagc aaaagtgtag tgccagtacg agtgttgtgg aggaaggctg 15060

catacattgt gcctgtcatt aaacgatgag ctcgtccgta ttggcccctg taatgccatg 15120

ttttccgccc ccaatcgtca aggttttccc tttgttagat tcctaccagt catctagcaa 15180

ggcggccgca gctagcacaa ttgaggcatc cccactaccg cattaagacc tcagcgcggc 15240

cgcaaattta aataaaatga agtgaagttc ctatactttc tagagaatag gaacttctat 15300

agtgagtcga ataagggcga cacaaaattt attctaaatg cataataaat actgataaca 15360

tcttatagtt tgtattatat tttgtattat cgttgacatg tataattttg atatcaaaaa 15420

ctgattttcc ctttattatt ttcgagattt attttcttaa ttctctttaa caaactagaa 15480

atattgtata tacaaaaaat cataaataat agatgaatag tttaattata ggtgttcatc 15540

aatcgaaaaa gcaacgtatc ttatttaaag tgcgttgctt ttttctcatt tataaggtta 15600

aataattctc atatatcaag caaagtgaca ggcgccctta aatattctga caaatgctct 15660

ttccctaaac tccccccata aaaaaacccg ccgaagcggg tttttacgtt atttgcggat 15720

taacgattac tcgttatcag aaccgcccag ggggcccgag cttaagactg gccgtcgttt 15780

tacaacacag aaagagtttg tagaaacgca aaaaggccat ccgtcagggg ccttctgctt 15840

agtttgatgc ctggcagttc cctactctcg ccttccgctt cctcgctcac tgactcgctg 15900

cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta 15960

tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc 16020

aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag 16080

catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac 16140

caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc 16200

ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt 16260

aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc 16320

gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga 16380

cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta 16440

ggcggtgcta cagagttctt gaagtggtgg gctaactacg gctacactag aagaacagta 16500

tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga 16560

tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 16620

cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag 16680

tggaacgacg cgcgcgtaac tcacgttaag ggattttggt catgagcttg cgccgtcccg 16740

tcaagtcagc gtaatgctct gctttt 16766

<210> 4

<211> 635

<212> DNA

<213>artificial synthesized (artificial sequence)

<400> 4

gcaggcggtt gcaagcgatc tatcgtgaat ttgtggaggg acgtaatggt gaaatgccga 60

atggcgaagc aggtcgggag atcggtggtc ggacgagcct gatgtagatg ggtgcatatc 120

tttcttttct ctttcacaat ttcaagatca tgtattagaa ctacattgct atgtttcagc 180

aatatatatg catagctaga gagcgatgtt acgatgagac atgtaatctt tgaacatttc 240

tctgtacagc ttgtcagagt ttcgaaggtt aagctcgaga gcaaggaggg gaaaagaaga 300

caaaaaagac actcggtccg gtctcgaacc gacgaccttt cgcacacacg tagaaggtac 360

agaaactcaa cacctccaaa agaggtctgt aagaatgaaa gtttgaccaa aagcatcatc 420

agttttagag ctagaaatag caagttaaaa taaggctagt ccgttatcaa cttgaaaaag 480

tggcaccgag tcggtgcttt ttttttgagc atttatcagc ttgatataga ggtaggaatg 540

tatggaggtg cagaatggct attttgttat tggagcgggt tcgaaacgga gggcaggaga 600

ctttttctaa atacgtcacg tgatatagag ctgct 635

<210> 5

<211> 632

<212> DNA

<213>artificial synthesized (artificial sequence)

<400> 5

gcaggcggtt gcaagcgatc tatcgtgaat ttgtggaggg acgtaatggt gaaatgccga 60

atggcgaagc aggtcgggag atcggtggtc ggacgagcct gatgtagatg ggtgcatatc 120

tttcttttct ctttcacaat ttcaagatca tgtattagaa ctacattgct atgtttcagc 180

aatatatatg catagctaga gagcgatgtt acgatgagac atgtaatctt tgaacatttc 240

tctgtacagc ttgtcagagt ttcgaaggtt aagctcgaga gcaaggaggg gaaaagaaga 300

caaaaaagac actcggtccg gtctcgaacc gacgaccttt cgcacacacg tagaaggtac 360

agaaactcaa cacctccaaa agaggtctgt aagaatgaaa ggtaaccgag catttacgcc 420

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 480

ggcaccgagt cggtgctttt tttttgagca tttatcagct tgatatagag gtaggaatgt 540

atggaggtgc agaatggcta ttttgttatt ggagcgggtt cgaaacggag ggcaggagac 600

tttttctaaa tacgtcacgt gatatagagc tg 632

Claims (10)

1. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base, which is characterized in that nucleotide sequence such as SEQ ID Shown in NO:3.

2. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 1, which is characterized in that Include the rAPOBEC1-XTEN-nCas9-UGI fusion segment that can be expressed in aspergillus niger.

3. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 1, which is characterized in that Promoter comprising E. coli resistance genetic fragment AmpR and rAPOBEC1-XTEN-nCas9-UGI expressing fusion protein Ptef。

4. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 2, which is characterized in that The rAPOBEC1-XTEN-nCas9-UGI fusion segment includes rAPOBEC1-XTEN genetic fragment and UGI gene piece Section.

5. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 4, which is characterized in that The nucleotide sequence of the rAPOBEC1-XTEN genetic fragment is as shown in SEQ ID NO:1, the nucleosides of the UGI genetic fragment Acid sequence is as shown in SEQ ID NO:2；It is close that the rAPOBEC1-XTEN genetic fragment and UGI genetic fragment pass through aspergillus niger Numeral optimization, can in aspergillus niger normal expression.

6. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 1, which is characterized in that Include the plasmid replication origin ori that can be used to be inserted into the site BglII and Escherichia coli of sgRNA segment.

7. a kind of pFC330-BEC plasmid for being able to achieve the accurate point mutation of base according to claim 1, which is characterized in that Comprising pyrG selection markers and it can be realized the filamentous fungi autonomously replicating sequence AMA1 of mark cycle.

8. be able to achieve described in claim any one of 1-7 the pFC330-BEC plasmid of the accurate point mutation of base in filamentous fungi into The application of row base editor.

9. application according to claim 8, which is characterized in that the filamentous fungi includes aspergillus niger.

10. application according to claim 8, which is characterized in that the base editor includes that sport thymus gland phonetic for cytimidine The editor of pyridine.