CN101525627A - Dual-gene co-expression plasmid, engineering bacteria transformed therefrom and construction method thereof - Google Patents

Abstract

The invention provides a dual-gene co-expression plasmid, engineering bacteria transformed from the dual-gene co-expression plasmid and a construction method thereof. The dual-gene co-expression plasmid contains a N-acetylneuraminate lyase gene, a N-acyl-D-glucosamine 2-isomerase gene and a proper expression vector, the engineering bacteria can be obtained after the plasmid is transformed into Escherichia coli, thalli obtained after the fermentation culture of the engineering bacteria are crushed and then are centrifugated, then a centrifugated supernatant is added into a GlcNAc reaction liquid, and Neu5Ac can be generated through the catalysis. The plasmid and the corresponding engineering bacteria can be used for preparing the Neu5Ac. At the same time, the preparation of the Neu5Ac by the method can simplify a method of two-bacteria secondary fermentation usually needed when a two-step enzyme method prepares the Neu5Ac into single-bacteria primary fermentation, which can realize the aim of preparing two biocatalysts, simplify the processes of fermentation technology and production technology of enzyme-producing bacteria, and improve the production efficiency and the yield of the Neu5Ac.

Description

The engineering bacteria of a kind of double gene coexpression plasmid, its conversion and construction process thereof

Technical field

The invention belongs to the genetically engineered field, specifically, relate to the engineering bacteria and the construction process thereof of a kind of double gene coexpression plasmid, its conversion.

Background technology

N-n acetylneuraminic acid n (Neu5Ac) is the precursor of neuraminidase inhibitor, and this inhibitor is used for the treatment of viral influenza clinically, has important use and be worth in field of medicaments.

Have multiplely though obtain the method for Neu5Ac, to have technology simple because biotransformation method prepares Neu5Ac, and purifying is convenient, pollute advantages such as few, therefore mainly now adopts this method preparation.The process that biotransformation method generates Neu5Ac is divided into two kinds of a step enzyme method and two step enzyme methods.Wherein a step enzyme method promptly utilizes N-n acetylneuraminic acid n lyase catalyzing N-acetylmannosamine (ManNAc) and pyruvic acid (pyruvate) directly to generate Neu5Ac.This method step is simple, and transformation efficiency and productive rate are all more satisfactory, but the price limit of the costliness of ManNAc the application of this method.Two step enzyme methods are promptly used N-acetyl-D-glucosamine 2-isomerase earlier N-acetyl-D-glucosamine (GlcNAc) to be transformed and are generated ManNAc, generate Neu5Ac by the catalysis of N-n acetylneuraminic acid n lyase again, and this process sees Fig. 1 for details.

1985, people such as Ohta announced coding e. coli k12 (Escherichia coli K12) N-n acetylneuraminic acid n lyase genes (nal) sequence, and had successfully cloned this gene in 1986 years.Subsequently, people such as Maru successfully cloned N-acetyl-D-glucosamine 2-isomerase gene (age) from the pig kidney in 1996.The existing at present independent expression plasmid that utilizes N-n acetylneuraminic acid n lyase genes nal and N-acetyl-D-glucosamine 2-isomerase gene age to make up respectively still owing to the production process relative complex of two step enzyme methods, therefore is necessary further to be improved.

Summary of the invention

Primary and foremost purpose of the present invention is improved with regard to being the technology of two step enzyme methods being produced N-n acetylneuraminic acid n (Neu5Ac), thereby the double gene coexpression plasmid of a kind of N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase is provided.

Second purpose of the present invention is to provide a kind of construction process of described double gene coexpression plasmid.

The 3rd purpose of the present invention is to provide a kind of genetic engineering bacterium that utilizes described double gene coexpression plasmid to transform.

The 4th purpose of the present invention is to provide a kind of construction process of described engineering bacteria.

The 5th purpose of the present invention is to provide a kind of method of utilizing described engineering bacteria to produce Neu5Ac.

Double gene coexpression plasmid of the present invention contains N-n acetylneuraminic acid n lyase genes nal and N-acetyl-D-glucosamine 2-isomerase gene age simultaneously.

The present invention utilizes plasmid pLY-3, pET-29a-nal and pQE30-nal amplification to obtain N-n acetylneuraminic acid n lyase genes nal Expression element respectively, under the effect of ligase enzyme, be connected to plasmid pLY-AGE, the pET-29a-age and the pQE30-age that contain N-acetyl-D-glucosamine 2-isomerase gene age Expression element then, make up and obtain double gene coexpression plasmid.

With described double gene coexpression plasmid transformed into escherichia coli, acquisition can be expressed the genetic engineering bacterium of N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase simultaneously.

Described engineering bacteria is fermented under suitable condition, and it is centrifugal to collect bacterial cell disruption, and the supernatant crude enzyme liquid of acquisition can be converted into Neu5Ac with substrate GlcNAc.

The genetic engineering bacterium that utilizes double gene coexpression plasmid of the present invention to make up, can express N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase simultaneously, thereby can be implemented in the primary first-order equation process, GlcNAc catalysis is generated Neu5Ac, simplify production process greatly, improved the productive rate of production efficiency and Neu5Ac.

Description of drawings

Fig. 1 is that two step enzyme methods prepare the Neu5Ac schematic flow sheet.

Fig. 2 is a double gene coexpression plasmid pLY-NA structural representation.

Fig. 3 is a double gene coexpression plasmid pLY-9 structural representation.

Fig. 4 is a double gene coexpression plasmid pLY-10 structural representation.

Fig. 5 is a construction recombination plasmid pLY-NA schema, and wherein, 5A is the preparation flow figure of pLY-NAL subclone, and 5B is the structure schema of recombinant plasmid pLY-NA.

Fig. 6 is a construction recombination plasmid pLY-9 schema, and wherein, 6A is the preparation flow figure of pLY-NAL-1 subclone, and 6B is the structure schema of recombinant plasmid pLY-9.

Fig. 7 is a construction recombination plasmid pLY-10 schema, and wherein, 7A is the preparation flow figure of pLY-NAL-2 subclone, and 7B is the structure schema of recombinant plasmid pLY-10.

Fig. 8 is the electrophoresis result of the Expression element pcr amplification of N-n acetylneuraminic acid n lyase genes nal.

Fig. 9 is that the enzyme of pLY-NA plasmid is cut rear electrophoresis checking picture, and wherein, electrophoretic band 1 is cut the result for the SphI enzyme of pLY-NA plasmid, and electrophoretic band 2 is contrast (pLY-AGE).

Figure 10 is (pLY-NA) the broken supernatant crude enzyme liquid of a bacterium electrophoresis result of E.coli BL21 (DE3), wherein electrophoretic band 1 is the molecular weight of albumen standard, electrophoretic band 2 is thick enzyme supernatant, and wherein 42Kda's is N-acetyl-D-glucosamine 2-isomerase, and 33Kda's is N-n acetylneuraminic acid n lyase.

Figure 11 is a Neu5Ac standard substance linear analysis typical curve.

Figure 12 is standard substance Neu5Ac mass spectrometric detection figure.

Figure 13 is standard substance GlcNAc mass spectrometric detection figure.

Figure 14 is the thick enzyme 12h conversion fluid mass spectrometric detection figure that (pLY-NA) is prepared by genetic engineering bacterium E.coli BL21 (DE3).

Figure 15 detects figure by the thick enzyme 12h conversion fluid HPLC that genetic engineering bacterium E.coli BL21 (DE3) (pLY-NA) prepares, and wherein 15A is standard substance HPLC result, and 15B is the detected result of thick enzyme 12h conversion fluid.

Figure 16 detects figure by the thick enzyme 12h conversion fluid HPLC that genetic engineering bacterium E.coli BL21 (DE3) (pLY-10) prepares, and wherein 16A is standard substance HPLC result, and 16B is the detected result of thick enzyme 12h conversion fluid.

Figure 17 is that wherein 17A is standard substance HPLC result by the thick enzyme 12h conversion fluid HPLC detection figure of genetic engineering bacterium E.coli DH α (pLY-9) preparation, and 17B is the detected result of thick enzyme 12h conversion fluid.

Embodiment

Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples only are used to the present invention is described but not are used to limit scope of the present invention.

The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, the condition described in " molecular cloning: laboratory manual " (New York:Cold Spring Harbor Laboratory Press, 1989) is carried out.

Used following bacterial strain and plasmid in the embodiments of the invention:

Intestinal bacteria (E.coli BL21 (DE3)): NOVAGEN company.

Intestinal bacteria (E.coli DH5 α): TIANGEN company.

Plasmid pMD18-T Simple Vector:TAKARA company has amicillin resistance (amp ^R) and beta-galactosidase enzymes (LacZ) operator gene;

PET30a: expression plasmid has the T7 promotor, kalamycin resistance gene, NOVAGEN company.

PET29a: expression plasmid has the T7 promotor, kalamycin resistance gene, NOVAGEN company.

PQE30: expression plasmid has the T5 promotor, ampicillin resistance gene, Qiagen company.

Plasmid pLY-AGE, pET-29a-age and pQE30-age: with reference to Lee, Y-C. (Production ofN-acetyl-d-neuraminic acid by recombinant whole cells expressing Anabaena sp.CH1N-acetyl-d-glucosamine 2-epimerase and Escherichia coli N-acetyl-D-neuraminic acid lyase such as the document that waits, J.Biotechnol.2007, the method of describing 129:453-460) makes up, respectively by different expression plasmid pET 30a, pET29a and pQE30 make up and form pLY-AGE, pET-29a-age has kalamycin resistance (kan ^R) and the age gene expression element, pQE30-age has amicillin resistance (amp ^R) and the age gene expression element.

Plasmid pLY-3, pET-29a-nal and pQE30-nal: with reference to Mahmoudia M., the document of Noble D. (Aneffcient process for N-acetylneura-minic acid using N-acetylneuraminic acid[J], Enz.Micro.Tech., 1997,20:399～400) method of describing in makes up, formed by different expression plasmid pET 30a, pET29a and pQE30 structure respectively, pLY-3 and pET-29a-nal have kalamycin resistance (kan ^R) and the nal gene expression element, pQE30-nal has amicillin resistance (amp ^R) and the nal gene expression element.

PLY-NAL: be connected the subclone that makes up by the nal gene expression element that obtains through pcr amplification from pLY-3 with pMD18-T Simple Vector.

PLY-NAL-1: be connected the subclone that makes up by the nal gene expression element that obtains through pcr amplification from pQE30-nal with pMD18-T SimpleVector.

PLY-NAL-2: be connected the subclone that makes up by the nal gene expression element that obtains through pcr amplification from pET-29a-nal with pMD18-T SimpleVector.

PLY-NA: subclone pLY-NAL enzyme cut obtains the nal gene expression element, be connected to the pLY-AGE plasmid then, the co-expression plasmid of nal that is built into and age gene, plasmid map as shown in Figure 2, the host bacterium of this expression plasmid is e.coli BL21 (DE3).

PLY-9: subclone pLY-NAL-1 enzyme cut obtains the nal gene expression element, be connected to the pQE30-age plasmid then, the co-expression plasmid of nal that is built into and age gene, plasmid map as shown in Figure 3, the host bacterium of this expression plasmid is E.coli DH α.

PLY-10; Subclone pLY-NAL-2 enzyme cut obtains the nal gene expression element, be connected to the pET-29a-age plasmid then, the co-expression plasmid of nal that is built into and age gene, plasmid map as shown in Figure 4, the host bacterium of this expression plasmid is E.coli BL21 (DE3).

The building process of three kinds of double gene coexpression plasmids (pLY-NA, pLY-9 and pLY-10) is basic identical, change it over to corresponding expressive host colon bacillus after, can both express and have and transform to generate the Neu5Ac activity.Its building process is as follows:

Utilize the plasmid of expressing nal and age gene respectively that has made up, example pLY-3 and pLY-AGE, it contains nal and age gene expression element respectively, utilizing the method for PCR that the nal gene expression element is increased from the former obtains, after making up subclone, again the nal gene expression element is connected to the latter by suitable restriction endonuclease sites, finally obtains two enzyme co-expression plasmids, concrete structure flow process is seen Fig. 5-7.

Embodiment 1, double gene coexpression plasmid pLY-NA structure

The construction process of double gene coexpression plasmid pLY-NA as shown in Figure 3, detailed process is as follows:

1.1, the preparation of pLY-NAL subclone

1.1.1, design of primers

According to the following PCR primer of the sequences Design of plasmid pLY-3:

P5： GCATGCATCCGGATATAGTTCCTCC

P6：GAGCACCGCCGCCGCAAG

In primer P5, introduced the restriction enzyme site (shown in the underscore) of restriction enzyme SphI; Simultaneously, because contain the restriction enzyme site of a SphI among the plasmid pLY-3, and position suitable, the applicant has utilized this restriction enzyme site, thereby, but still make the two ends of final amplified fragments all contain the restriction enzyme site of SphI less than the restriction enzyme site of in P6, introducing restriction enzyme SphI.

1.1.2, pcr amplification

With plasmid pLY-3 is template, is that primer carries out pcr amplification with P5 and P6, specific as follows:

Reaction system (50 μ l): 10 * Ex Taq Buffer, 5 μ l; P5 (20 μ M), 1 μ l; P6 (20 μ M), 1 μ l; PLY-3,1 μ l; DNTP mixture (each 2.5Mm), 4 μ l; MgCl ₂(25 mM), 4 μ l; TaKaRa Ex Taq, 0.5 μ l; DdH ₂O, 33.5 μ l.

Reaction conditions: 94 ℃, 4min; 94 ℃, 1min, 55 ℃, 1min, 72 ℃, 2min circulates 29 times; 72 ℃, 10min.

The amplified production that pcr amplification is obtained carries out agarose electrophoresis, and the result according to this result, has located band as shown in Figure 8 about 1.4kb, illustrates that amplification has obtained the Expression element of N-n acetylneuraminic acid n lyase genes nal.

The DNA running gel that amplification is obtained cuts out the gel that contains required dna fragmentation under long wavelength (302nm) ultraviolet lamp.With reference to operational manual, to use the gel of V-GENE company to reclaim the test kit recovery, and check order reclaiming fragment, its sequence is shown in SEQ ID NO:2.

Sequencing result shows that the N-n acetylneuraminic acid n lyase genes nal Expression element that is obtained comprises N-n acetylneuraminic acid n lyase genes nal, T7 promotor, T7 terminator and SD sequence.

1.1.3, the acquisition of pLY-NAL subclone

With reference to service manual, N-n acetylneuraminic acid n lyase genes nal Expression element and pMD18-T Simple Vector under the catalysis of T4 dna ligase (TaKaRa company's T 4 dna ligase test kits), are connected 30min in 16 ℃.The connection product that uses the heat shock method to obtain transforms DH5 α competent cell (TIANGEN company), then on the LB flat board that contains IPTG, X-gal and 100 μ g/ml penbritins, cultivated 16 hours in 37 ℃, the single bacterium colony of picking male white at random from the flat board, extract plasmid and carry out the restriction enzyme digestion and electrophoresis checking, determine to contain on the plasmid DNA pcr amplified fragment of 1.4kb, with the recombinant plasmid called after subclone pLY-NAL that obtains.

1.2, plasmid pLY-NA makes up

1.2.1, plasmid pLY-AGE handles

After the plasmid pLY-AGE that will contain N-acetyl-D-glucosamine 2-isomerase gene age cuts with the SphI enzyme, replenish distilled water to 100 μ l, add isopyknic phenol again: chloroform (1: 1) extract extracting 1～2 time, with 20 μ l chloroform extractings 1 time, in aqueous phase solution, add the 3mol/L sodium acetate of its 1/10 volume and the isopropanol precipitating enzyme of 0.6 times of volume then respectively and cut the back dna fragmentation; Collecting precipitation is used 1ml 70% washing with alcohol precipitation 1 time, blots residual liquid, makes and precipitates drying, obtains the pLY-AGE endonuclease bamhi of purifying, and the TE damping fluid with 25 μ l dissolves the pLY-AGE endonuclease bamhi precipitation of the purifying of acquisition again again.

With reference to service manual, use alkaline phosphatase CIAP (available from TaKaRa company), to carry out dephosphorylation with TE damping fluid dissolved plasmid pLY-AGE endonuclease bamhi handles, use the dephosphorylized plasmid pLY-AGE of the method purifying endonuclease bamhi of above-mentioned purifying pLY-AGE endonuclease bamhi again, and dissolve with the TE damping fluid.

1.2.2, the processing of pLY-NAL subclone

With pLY-NAL subclone SphI single endonuclease digestion, enzyme is cut product and is tapped rubber behind agarose gel electrophoresis and reclaim the N-n acetylneuraminic acid n lyase genes nal Expression element nucleotide sequence that size is about 1.4kb.

1.2.3, plasmid pLY-NA preparation

With the dephosphorylized pLY-AGE endonuclease bamhi of above 1.2.1 acquisition and the N-n acetylneuraminic acid n lyase genes nal Expression element sequence of 1.2.2 acquisition, 1: 7 in molar ratio ratio connects 30min with T4 dna ligase (using TaKaRa company's T 4 dna ligase test kits) in 16 ℃, the connection product that obtains heat shock method Transformed E .coli DH5 α competent cell, then on the LB solid medium that contains 50 μ g/ml kantlex 37 ℃ cultivated 16 hours, choose resistance transformant list bacterium colony, be transferred to 3ml and contain the LB liquid nutrient medium of 50 μ g/ml kantlex, in 37 ℃ of overnight incubation.

Extracting plasmid from cultivate the bacterium liquid that obtains, carry out enzyme and cut checking, the result as shown in Figure 9, according to this figure result, enzyme is cut has size to be about the segment of 1.4kb in the product, determine that N-n acetylneuraminic acid n lyase genes nal Expression element sequence has been connected in the pLY-AGE plasmid, the recombinant plasmid of acquisition is double gene coexpression plasmid, called after pLY-NA.

Through sequence verification, the sequence of double gene coexpression plasmid pLY-NA is shown in SEQ ID NO:1, and wherein, 179-1342 is N-acetyl-D-glucosamine 2-isomerase gene age, and 1854-2747 is N-n acetylneuraminic acid n lyase genes nal; The structure of plasmid pLY-NA as shown in Figure 2.

Embodiment 2, the pLY-NA transformed into escherichia coli

The double gene coexpression plasmid pLY-NA that embodiment 1 is obtained is transformed into and uses CaCl ₂Intestinal bacteria E.coliBL21 (DE3) competent cell of method preparation, then on the LB solid medium that contains 50 μ g/ml kantlex 37 ℃ cultivated 16 hours, choose resistance transformant list bacterium colony, obtain the genetic engineering bacterium of double gene coexpression, called after E.coli BL21 (DE3) (pLY-NA).

Embodiment 3, double gene coexpression plasmid pLY-10 structure and conversion

The method of pressing embodiment 1 makes up double gene coexpression plasmid pLY-10, and the method for pressing embodiment 2 is with its Transformed E .coli BL21 (DE3) competent cell, obtain two enzyme co-expression gene engineering bacteria E.coli BL21 (DE3) (pLY-10), wherein, the primer of preparation pLY-NAL-2 subclone is:

P13： GCATGC?ATCCGGATATAGTTCCTCCT

P14：AGGTTGAGGCCGTTGAGCAC

Wherein, in primer P13, introduced the restriction enzyme site (shown in the underscore) of restriction enzyme SphI; Simultaneously, because contain the restriction enzyme site of a SphI among the plasmid pET-29a-nal, and position suitable, the applicant has utilized this restriction enzyme site, thereby, but still make the two ends of final amplified fragments all contain the restriction enzyme site of SphI less than the restriction enzyme site of in P6 and P14, introducing restriction enzyme SphI.

Embodiment 4, double gene coexpression plasmid pLY-9 structure and conversion

The method of pressing embodiment 1 makes up double gene coexpression plasmid pLY-9, and the method for pressing embodiment 2 is with its Transformed E .coliDH5 α competent cell, obtain two enzyme co-expression gene engineering bacteria E.coli DH α (pLY-9), wherein, the primer of preparation pLY-NAL-1 subclone is:

P11：AAATAGGCGTATCACGAGGC

P12： CTCGAG?GTGGTATATCCAGTGATTTT

Wherein, in primer P12, introduced the restriction enzyme site XhoI (shown in the underscore) of restriction enzyme; Simultaneously, because pQE30-nal contains one XhoI restriction enzyme site in the plasmid, and position suitable, the applicant has utilized this restriction enzyme site, thereby not in P11, do not introduce the restriction enzyme site of restriction enzyme XhoI, but still make the XhoI restriction enzyme site that the two ends of final amplified fragments are all contained.

Embodiment 5, E.coli BL21 (DE3) (pLY-NA), E.coli BL21 (DE3) (pLY-10) and the fermentation of E.coli DH α (pLY-9)

With the genetic engineering bacterium E.coli BL21 (DE3) of the double gene coexpression for preparing in the foregoing description (pLY-NA), E.coli BL21 (DE3) (pLY-10) and E.coli DH α (pLY-9), be inoculated into respectively in the 3ml LB liquid nutrient medium, in 37 ℃, cultivated 16 hours.

Get 16 hours bacterium liquid of above-mentioned cultivation, inoculum size with 1.0%, (E.coliDH α (pLY-9) cultivates in the selective pressure of penbritin to be transferred to 50ml LB liquid nutrient medium respectively, E.coli BL21 (DE3) (pLY-10) (pLY-NA) cultivates under the selective pressure of kantlex with E.coli BL21 (DE3)) in, 37 ℃ are cultured to mid-log phase (A ₅₅₀=0.5～1), adds lactose (final concentration is 1mM) then, induce.

With the bacterium liquid of inducing culture after 8 hours, in 4 ℃, the centrifugal 5min of 8000rpm, collect centrifugation, obtain bacterial sediment, wash thalline three times with phosphate buffered saline buffer, each 10ml, use the resuspended thalline of Tris-HCl lysis buffer 10ml of 10mM pH7.4 again, and the ultrasonication cell, in 4 ℃, 15000rpm with cytoclasis solution centrifugal 15min after, gather in the crops centrifugal supernatant, promptly obtain respectively corresponding three kinds of engineering bacteria E.coli BL21 (DE3) (pLY-NA), E.coli BL21 (DE3) (pLY-10) and the crude enzyme liquid I of E.coli DH α (pLY-9), crude enzyme liquid II and crude enzyme liquid III.

Get the supernatant crude enzyme liquid respectively and carry out the SDS-PAGE detection, and scan, analyze the content of two enzymes with gel imaging system.Detected result shows, described two kinds of enzymes, and N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase all has expression in crude enzyme liquid I, crude enzyme liquid II and crude enzyme liquid III; Wherein, among the crude enzyme liquid I, N-n acetylneuraminic acid n lyase accounts for 30% of total protein, and N-acetyl-D-glucosamine 2-isomerase accounts for 15% of total protein, among the crude enzyme liquid II, N-n acetylneuraminic acid n lyase accounts for 29% of total protein, N-acetyl-D-glucosamine 2-isomerase accounts for 17% of total protein, and among the crude enzyme liquid III, N-n acetylneuraminic acid n lyase accounts for 27% of total protein, N-acetyl-D-glucosamine 2-isomerase accounts for 18% of total protein, and the electrophoresis result of crude enzyme liquid I as shown in figure 10.

Embodiment 6, crude enzyme liquid transforms N-acetyl-D-glucosamine (GlcNAc)

Get above-mentioned each 300 μ l of three kinds of crude enzyme liquids that obtain after centrifugal, be mixed with three 1ml water react systems (25mMTris-HCl (pH 7.4), 50mM GlcNAc, 200mM Sodium.alpha.-ketopropionate, 180 μ M ATP, 200 μ M MgCl respectively ₂), under 30 ℃ of conditions, 120rpm transforms 12h.

In 80 ℃, thermal treatment 5min is with stopped reaction with the solution after transforming.

Embodiment 7, product detects

7.1, mass spectrometric detection

The 12h conversion reaction liquid of Neu5Ac standard substance, reaction substrate GlcNAc and crude enzyme liquid I is done mass spectrometric detection, and detected result shown in Figure 12～14, according to this result, defines Neu5Ac and generates respectively.

7.2, HPLC detects

Take by weighing Neu5Ac 5mg, to 10ml, be prepared as Neu5Ac scalar solution with the pure water constant volume available from SIGMA company; Then in contrast, respectively the 12h conversion reaction liquid of crude enzyme liquid I, II and III is detected through HPLC that (use Agilent 1100 type liquid chromatographs to detect, testing conditions is: detect wavelength 220nm with Neu5Ac scalar solution; Flow velocity 1ml/min; Sample size 5 μ l), the result is shown in Figure 15-17.

Simultaneously, also the Neu5Ac standard substance are carried out linear analysis, its concrete operations are as follows: precision takes by weighing standard substance, and compound concentration (μ g/ml) is 27,56,112,225,450,900.Sample introduction 5 μ l carry out linear regression analysis with peak area to concentration successively, obtain regression equation Y=1.4133X+1.1879, R ²=0.998, the result as shown in figure 11.This result shows that the linear relationship of peak area and concentration relationship in 27～900 μ g/ml scopes of Neu5Ac under these conditions is good, therefore, can utilize peak area to be directly proportional with concentration in this concentration range, thereby measure the content of Neu5Ac in the solution to be measured.Result according to Figure 15-17 also can get as calculated, and the final growing amount of crude enzyme liquid I, crude enzyme liquid II and crude enzyme liquid III product Neu5Ac is respectively 1.3mg/ml, 1.5mg/ml and 1.7mg/ml; The quality transformation efficiency is 11.8%, 13.6% and 15.4% (method of calculation of quality transformation efficiency is as follows).

The above results shows, E.coli BL21 (DE3) (pLY-NA), E.coli BL21 (DE3) (pLY-10) and E.coliDH α (pLY-9) can be used for preparation and contain the crude enzyme liquid of described pair of enzyme (N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase), and proved that above-mentioned crude enzyme liquid has the ability that conversion of substrate GlcNAc generates Neu5Ac.

In sum, plasmid pLY-NA provided by the invention, but transformed into escherichia coli obtain engineering bacteria; The engineering bacteria that obtains is after fermentation culture, contain two kinds of required purpose enzymes (N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase) in the thalline that obtains, described two kinds of purpose enzymes are present in the supernatant of the centrifugal back of bacterial cell disruption, and this crude enzyme liquid of centrifugal supernatant of acquisition has the ability that conversion of substrate GlcNAc generates Neu5Ac.

Therefore, plasmid pLY-NA provided by the invention, pLY-9 and pLY-10, and the engineering bacteria of transformed into escherichia coli acquisition all can be used for preparing Neu5Ac.Use method provided by the invention to prepare Neu5Ac, in the time of common two step enzyme methods can being prepared Neu5Ac the method for two required bacterium fermenting twice be reduced to single bacterium (E.coliBL21 (DE3) (pLY-NA), E.coliBL21 (DE3) (pLY-10) or E.coli DH α (pLY-9)) one time fermentation, just can realize preparing the purpose of two kinds of biological catalysts, simplify the zymotechnique of zymogenic bacteria.Simultaneously, described double gene coexpression plasmid contains the gene of N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase, after transforming engineering bacteria, can express described two kinds of enzymes, thereby can be by reaction process once, GlcNAc catalysis is generated Neu5Ac, simplified production process greatly, improved the productive rate of production efficiency and Neu5Ac.

Sequence table

＜110〉company limited of the next beneficial bio-pharmaceutical in Shanghai research and development centre

<120>P5071052

＜130〉engineering bacteria of a kind of double gene coexpression plasmid, its conversion and construction process thereof

<160>4

<170>PatentIn?version?3.1

<210>1

<211>7822

<212>DNA

＜213〉plasmid pLY-NA

<400>1

atccggatat?agttcctcct?ttcagcaaaa?aacccctcaa?gacccgttta?gaggccccaa 60

ggggttatgc?tagttattgc?tcagcggtgg?cagcagccaa?ctcagcttcc?tttcgggctt 120

tgttagcagc?cggatctcag?tggtggtggt?ggtggtgctc?gagtgcggcc?gcaagcttac 180

tcaaggcctc?gaattgttgc?caacacagat?acaaagcacg?gggtacatga?aaacatccct 240

tccatttacc?gcctttgaga?tttaacagca?cttccccacg?gcgatttaag?tagccaaacc 300

actcaccata?ttctgggtca?gcaaaatgct?gccaagaata?atcgtgcatt?ttttgatacc 360

attcccaaca?gacttcacga?cctgtcaaac?gataacccat?cgccaaagcc?accaaagatt 420

ctaaatgcac?ccaccacaat?ttttgatccc?attccaattg?ttgtggggga?tgacctgctg 480

catccataaa?gtaatacaag?ccgccatact?ctttatccca?ggcgaaattg?aggatattta 540

acaccacatc?aactgcttgg?ttaatagtct?tgctgtcgtt?tttccgtcgg?gcgatgtcca 600

taataaacca?catcgcctca?ataccgtgac?cagggttaat?cagccgccct?tcaaaacaat 660

caatgtggga?accatcgggg?gcaacatttt?catacatcaa?tcctcgttct?ttgtcgagaa 720

agtcactcat?aacttcctga?acggttgcac?tcaagacatt?ttctagagtc?tcctggggaa 780

gcaaccattc?catttctaag?gtcaggttag?ctaaaatcat?tggcacagct?aaggctttca 840

tggggcgtgt?gccgggatag?gttttggtat?atttgccttt?gggattatct?ttgcgacgca 900

aaacattgtt?atatgcttgc?atagccacat?cttttgccca?ctcttcacca?gaggcgagag 960

catattggct?aaaggccatc?gctgcaaaac?aatcagaaaa?aatattgtaa?ggctgtacta 1020

atggttcacc?tccacgggtg?agggcaaaat?accagtttcc?ctctgcgtct?ctgccatgtt 1080

gggcaagaaa?tttagcaccg?ttactagcaa?ttttgagcca?gttttcccgt?ttttctagct 1140

ggttacacag?catggaaaaa?gtccagactt?ggcggttttg?cagccaaata?aatttatctg 1200

tgtcatacac?cttaccctgg?cgatcaagac?aggtaaaata?accgccttcc?gtatccaggg 1260

agtggttttc?ccaaaacggg?agtacgtcgt?tgaggagggc?atttttgtaa?agttgcgcca 1320

gtgcttgtaa?gtttttcccc?atatgtatat?ctccttctta?aagttaaaca?aaattatttc 1380

tagaggggaa?ttgttatccg?ctcacaattc?ccctatagtg?agtcgtatta?atttcgcggg 1440

atcgagatcg?atctcgatcc?tctacgccgg?acgcatcgtg?gccggcatca?ccggcgccac 1500

aggtgcggtt?gctggcgcct?atatcgccga?catcaccgat?ggggaagatc?gggctcgcca 1560

cttcgggctc?atgagcgctt?gtttcggcgt?gggtatggtg?gcaggccccg?tggccggggg 1620

actgttgggc?gccatctcct?tgcatgcatc?cggatatagt?tcctcctttc?agcaaaaaac 1680

ccctcaagac?ccgtttagag?gccccaaggg?gttatgctag?ttattgctca?gcggtggcag 1740

cagccaactc?agcttccttt?cgggctttgt?tagcagccgg?atctcagtgg?tggtggtggt 1800

ggtgctcgag?tgcggccgca?agcttgtcga?cggagctcga?attcggatcc?aactcacccg 1860

cgctcttgca?tcaactgctg?ggccagcgcc?ttcagttctg?gcagatattt?ttcatctacc 1920

ggtccaaacg?gtttgcggca?cagcggcaca?gaaacgacat?ccatataatg?gaggacagtt 1980

ttcaggccgc?ggaatacgcc?cgttttgatc?agtaaatcaa?tgactttatt?gcattcagtt 2040

tgcagtttct?gcgcggtctg?gatatcgcct?tctttcagcg?ccttaacgat?cccctgatag 2100

cgccagccca?tgatgttgta?ggtactgccg?ataccaccat?cagcgcccgc?cagcagacca 2160

gaggcgaaga?tttcgtcgta?accgttatag?agcacaagat?caggatgttc?acgacggatc 2220

tgctccatct?gatagagatc?gccagaggtc?tgtttcagcg?cacctacgcc?aggcaatgta 2280

acaagtgtgt?tgatctgatc?cagggtcagt?tttaccccac?tcagggctgg?aatgttgtac 2340

accaccatcg?gcaaaccatc?cgccgaatca?ataattgccc?gatagtgatc?gcagtgttct 2400

tcaaagctga?aaggatagta?gaacggcgtg?acggcggaga?cggcatcgaa?gccataacgt 2460

ttagccgatg?ccgcaagttg?ttggctttcg?gcggtgctga?cgcaaccgac?gtgggcgatg 2520

agtttaatct?tacctttcgc?ctcttcggcg?acgatttcca?gtacctgttc?acgctcggaa 2580

aggctttgta?caaaggcctc?gccggtcgaa?ccacccacgt?ataaaccgtc?gatgccctgc 2640

tgaatattga?actgaaccag?gcgacgcaga?ctcgctttat?ccagtgcttg?ttgttggtca 2700

aaaggagtca?ggagtgcagc?cattacgcca?cgtaaattcg?ttgccatatg?tatatctcct 2760

tcttaaagtt?aaacaaaatt?atttctagag?gggaattgtt?atccgctcac?aattccccta 2820

tagtgagtcg?tattaatttc?gcgggatcga?gatcgatctc?gatcctctac?gccggacgca 2880

tcgtggccgg?catcaccggc?gccacaggtg?cggttgctgg?cgcctatatc?gccgacatca 2940

ccgatgggga?agatcgggct?cgccacttcg?ggctcatgag?cgcttgtttc?ggcgtgggta 3000

tggtggcagg?ccccgtggcc?gggggactgt?tgggcgccat?ctccttgcat?gcaccattcc 3060

ttgcggcggc?ggtgctcaac?ggcctcaacc?tactactggg?ctgcttccta?atgcaggagt 3120

cgcataaggg?agagcgtcga?gatcccggac?accatcgaat?ggcgcaaaac?ctttcgcggt 3180

atggcatgat?agcgcccgga?agagagtcaa?ttcagggtgg?tgaatgtgaa?accagtaacg 3240

ttatacgatg?tcgcagagta?tgccggtgtc?tcttatcaga?ccgtttcccg?cgtggtgaac 3300

caggccagcc?acgtttctgc?gaaaacgcgg?gaaaaagtgg?aagcggcgat?ggcggagctg 3360

aattacattc?ccaaccgcgt?ggcacaacaa?ctggcgggca?aacagtcgtt?gctgattggc 3420

gttgccacct?ccagtctggc?cctgcacgcg?ccgtcgcaaa?ttgtcgcggc?gattaaatct 3480

cgcgccgatc?aactgggtgc?cagcgtggtg?gtgtcgatgg?tagaacgaag?cggcgtcgaa 3540

gcctgtaaag?cggcggtgca?caatcttctc?gcgcaacgcg?tcagtgggct?gatcattaac 3600

tatccgctgg?atgaccagga?tgccattgct?gtggaagctg?cctgcactaa?tgttccggcg 3660

ttatttcttg?atgtctctga?ccagacaccc?atcaacagta?ttattttctc?ccatgaagac 3720

ggtacgcgac?tgggcgtgga?gcatctggtc?gcattgggtc?accagcaaat?cgcgctgtta 3780

gcgggcccat?taagttctgt?ctcggcgcgt?ctgcgtctgg?ctggctggca?taaatatctc 3840

actcgcaatc?aaattcagcc?gatagcggaa?cgggaaggcg?actggagtgc?catgtccggt 3900

tttcaacaaa?ccatgcaaat?gctgaatgag?ggcatcgttc?ccactgcgat?gctggttgcc 3960

aacgatcaga?tggcgctggg?cgcaatgcgc?gccattaccg?agtccgggct?gcgcgttggt 4020

gcggacatct?cggtagtggg?atacgacgat?accgaagaca?gctcatgtta?tatcccgccg 4080

ttaaccacca?tcaaacagga?ttttcgcctg?ctggggcaaa?ccagcgtgga?ccgcttgctg 4140

caactctctc?agggccaggc?ggtgaagggc?aatcagctgt?tgcccgtctc?actggtgaaa 4200

agaaaaacca?ccctggcgcc?caatacgcaa?accgcctctc?cccgcgcgtt?ggccgattca 4260

ttaatgcagc?tggcacgaca?ggtttcccga?ctggaaagcg?ggcagtgagc?gcaacgcaat 4320

taatgtaagt?tagctcactc?attaggcacc?gggatctcga?ccgatgccct?tgagagcctt 4380

caacccagtc?agctccttcc?ggtgggcgcg?gggcatgact?atcgtcgccg?cacttatgac 4440

tgtcttcttt?atcatgcaac?tcgtaggaca?ggtgccggca?gcgctctggg?tcattttcgg 4500

cgaggaccgc?tttcgctgga?gcgcgacgat?gatcggcctg?tcgcttgcgg?tattcggaat 4560

cttgcacgcc?ctcgctcaag?ccttcgtcac?tggtcccgcc?accaaacgtt?tcggcgagaa 4620

gcaggccatt?atcgccggca?tggcggcccc?acgggtgcgc?atgatcgtgc?tcctgtcgtt 4680

gaggacccgg?ctaggctggc?ggggttgcct?tactggttag?cagaatgaat?caccgatacg 4740

cgagcgaacg?tgaagcgact?gctgctgcaa?aacgtctgcg?acctgagcaa?caacatgaat 4800

ggtcttcggt?ttccgtgttt?cgtaaagtct?ggaaacgcgg?aagtcagcgc?cctgcaccat 4860

tatgttccgg?atctgcatcg?caggatgctg?ctggctaccc?tgtggaacac?ctacatctgt 4920

attaacgaag?cgctggcatt?gaccctgagt?gatttttctc?tggtcccgcc?gcatccatac 4980

cgccagttgt?ttaccctcac?aacgttccag?taaccgggca?tgttcatcat?cagtaacccg 5040

tatcgtgagc?atcctctctc?gtttcatcgg?tatcattacc?cccatgaaca?gaaatccccc 5100

ttacacggag?gcatcagtga?ccaaacagga?aaaaaccgcc?cttaacatgg?cccgctttat 5160

cagaagccag?acattaacgc?ttctggagaa?actcaacgag?ctggacgcgg?atgaacaggc 5220

agacatctgt?gaatcgcttc?acgaccacgc?tgatgagctt?taccgcagct?gcctcgcgcg 5280

tttcggtgat?gacggtgaaa?acctctgaca?catgcagctc?ccggagacgg?tcacagcttg 5340

tctgtaagcg?gatgccggga?gcagacaagc?ccgtcagggc?gcgtcagcgg?gtgttggcgg 5400

gtgtcggggc?gcagccatga?cccagtcacg?tagcgatagc?ggagtgtata?ctggcttaac 5460

tatgcggcat?cagagcagat?tgtactgaga?gtgcaccata?tatgcggtgt?gaaataccgc 5520

acagatgcgt?aaggagaaaa?taccgcatca?ggcgctcttc?cgcttcctcg?ctcactgact 5580

cgctgcgctc?ggtcgttcgg?ctgcggcgag?cggtatcagc?tcactcaaag?gcggtaatac 5640

ggttatccac?agaatcaggg?gataacgcag?gaaagaacat?gtgagcaaaa?ggccagcaaa 5700

aggccaggaa?ccgtaaaaag?gccgcgttgc?tggcgttttt?ccataggctc?cgcccccctg 5760

acgagcatca?caaaaatcga?cgctcaagtc?agaggtggcg?aaacccgaca?ggactataaa 5820

gataccaggc?gtttccccct?ggaagctccc?tcgtgcgctc?tcctgttccg?accctgccgc 5880

ttaccggata?cctgtccgcc?tttctccctt?cgggaagcgt?ggcgctttct?catagctcac 5940

gctgtaggta?tctcagttcg?gtgtaggtcg?ttcgctccaa?gctgggctgt?gtgcacgaac 6000

cccccgttca?gcccgaccgc?tgcgccttat?ccggtaacta?tcgtcttgag?tccaacccgg 6060

taagacacga?cttatcgcca?ctggcagcag?ccactggtaa?caggattagc?agagcgaggt 6120

atgtaggcgg?tgctacagag?ttcttgaagt?ggtggcctaa?ctacggctac?actagaagga 6180

cagtatttgg?tatctgcgct?ctgctgaagc?cagttacctt?cggaaaaaga?gttggtagct 6240

cttgatccgg?caaacaaacc?accgctggta?gcggtggttt?ttttgtttgc?aagcagcaga 6300

ttacgcgcag?aaaaaaagga?tctcaagaag?atcctttgat?cttttctacg?gggtctgacg 6360

ctcagtggaa?cgaaaactca?cgttaaggga?ttttggtcat?gaacaataaa?actgtctgct 6420

tacataaaca?gtaatacaag?gggtgttatg?agccatattc?aacgggaaac?gtcttgctct 6480

aggccgcgat?taaattccaa?catggatgct?gatttatatg?ggtataaatg?ggctcgcgat 6540

aatgtcgggc?aatcaggtgc?gacaatctat?cgattgtatg?ggaagcccga?tgcgccagag 6600

ttgtttctga?aacatggcaa?aggtagcgtt?gccaatgatg?ttacagatga?gatggtcaga 6660

ctaaactggc?tgacggaatt?tatgcctctt?ccgaccatca?agcattttat?ccgtactcct 6720

gatgatgcat?ggttactcac?cactgcgatc?cccgggaaaa?cagcattcca?ggtattagaa 6780

gaatatcctg?attcaggtga?aaatattgtt?gatgcgctgg?cagtgttcct?gcgccggttg 6840

cattcgattc?ctgtttgtaa?ttgtcctttt?aacagcgatc?gcgtatttcg?tctcgctcag 6900

gcgcaatcac?gaatgaataa?cggtttggtt?gatgcgagtg?attttgatga?cgagcgtaat 6960

ggctggcctg?ttgaacaagt?ctggaaagaa?atgcataaac?ttttgccatt?ctcaccggat 7020

tcagtcgtca?ctcatggtga?tttctcactt?gataacctta?tttttgacga?ggggaaatta 7080

ataggttgta?ttgatgttgg?acgagtcgga?atcgcagacc?gataccagga?tcttgccatc 7140

ctatggaact?gcctcggtga?gttttctcct?tcattacaga?aacggctttt?tcaaaaatat 7200

ggtattgata?atcctgatat?gaataaattg?cagtttcatt?tgatgctcga?tgagtttttc 7260

taagaattaa?ttcatgagcg?gatacatatt?tgaatgtatt?tagaaaaata?aacaaatagg 7320

ggttccgcgc?acatttcccc?gaaaagtgcc?acctgaaatt?gtaaacgtta?atattttgtt 7380

aaaattcgcg?ttaaattttt?gttaaatcag?ctcatttttt?aaccaatagg?ccgaaatcgg 7440

caaaatccct?tataaatcaa?aagaatagac?cgagataggg?ttgagtgttg?ttccagtttg 7500

gaacaagagt?ccactattaa?agaacgtgga?ctccaacgtc?aaagggcgaa?aaaccgtcta 7560

tcagggcgat?ggcccactac?gtgaaccatc?accctaatca?agttttttgg?ggtcgaggtg 7620

ccgtaaagca?ctaaatcgga?accctaaagg?gagcccccga?tttagagctt?gacggggaaa 7680

gccggcgaac?gtggcgagaa?aggaagggaa?gaaagcgaaa?ggagcgggcg?ctagggcgct 7740

ggcaagtgta?gcggtcacgc?tgcgcgtaac?caccacaccc?gccgcgctta?atgcgccgct 7800

acagggcgcg?tcccattcgc?ca 7822

<210>2

<211>1436

<212>DNA

＜213〉N-n acetylneuraminic acid n lyase genes nal Expression element

<400>2

gcatgcatcc?ggatatagtt?cctcctttca?gcaaaaaacc?cctcaagacc?cgtttagagg 60

ccccaagggg?ttatgctagt?tattgctcag?cggtggcagc?agccaactca?gcttcctttc 120

gggctttgtt?agcagccgga?tctcagtggt?ggtggtggtg?gtgctcgagt?gcggccgcaa 180

gcttgtcgac?ggagctcgaa?ttcggatcca?actcacccgc?gctcttgcat?caactgctgg 240

gccagcgcct?tcagttctgg?cagatatttt?tcatctaccg?gtccaaacgg?tttgcggcac 300

agcggcacag?aaacgacatc?catataatgg?aggacagttt?tcaggccgcg?gaatacgccc 360

gttttgatca?gtaaatcaat?gactttattg?cattcagttt?gcagtttctg?cgcggtctgg 420

atatcgcctt?ctttcagcgc?cttaacgatc?ccctgatagc?gccagcccat?gatgttgtag 480

gtactgccga?taccaccatc?agcgcccgcc?agcagaccag?aggcgaagat?ttcgtcgtaa 540

ccgttataga?gcacaagatc?aggatgttca?cgacggatct?gctccatctg?atagagatcg 600

ccagaggtct?gtttcagcgc?acctacgcca?ggcaatgtaa?caagtgtgtt?gatctgatcc 660

agggtcagtt?ttaccccact?cagggctgga?atgttgtaca?ccaccatcgg?caaaccatcc 720

gccgaatcaa?taattgcccg?atagtgatcg?cagtgttctt?caaagctgaa?aggatagtag 780

aacggcgtga?cggcggagac?ggcatcgaag?ccataacgtt?tagccgatgc?cgcaagttgt 840

tggctttcgg?cggtgctgac?gcaaccgacg?tgggcgatga?gtttaatctt?acctttcgcc 900

tcttcggcga?cgatttccag?tacctgttca?cgctcggaaa?ggctttgtac?aaaggcctcg 960

ccggtcgaac?cacccacgta?taaaccgtcg?atgccctgct?gaatattgaa?ctgaaccagg 1020

cgacgcagac?tcgctttatc?cagtgcttgt?tgttggtcaa?aaggagtcag?gagtgcagcc 1080

attacgccac?gtaaattcgt?tgccatatgt?atatctcctt?cttaaagtta?aacaaaatta 1140

tttctagagg?ggaattgtta?tccgctcaca?attcccctat?agtgagtcgt?attaatttcg 1200

cgggatcgag?atcgatctcg?atcctctacg?ccggacgcat?cgtggccggc?atcaccggcg 1260

ccacaggtgc?ggttgctggc?gcctatatcg?ccgacatcac?cgatggggaa?gatcgggctc 1320

gccacttcgg?gctcatgagc?gcttgtttcg?gcgtgggtat?ggtggcaggc?cccgtggccg 1380

ggggactgtt?gggcgccatc?tccttgcatg?caccattcct?tgcggcggcg?gtgctc 1436

<210>3

<211>5824

<212>DNA

＜213〉plasmid pLY-9

<400>3

ctcgagaaat?cataaaaaat?ttatttgctt?tgtgagcgga?taacaattat?aatagattca 60

attgtgagcg?gataacaatt?tcacacagaa?ttcattaaag?aggagaaatt?aactatgaga 120

ggatcgcatc?accatcacca?tcacggatcc?atggcaacga?atttacgtgg?cgtaatggct 180

gcactcctga?ctccttttga?ccaacaacaa?gcactggata?aagcgagtct?gcgtcgcctg 240

gttcagttca?atattcagca?gggcatcgac?ggtttatacg?tgggtggttc?gaccggcgag 300

gcctttgtac?aaagcctttc?cgagcgtgaa?caggtactgg?aaatcgtcgc?cgaagaggcg 360

aaaggtaaga?ttaaactcat?cgcccacgtc?ggttgcgtca?gcaccgccga?aagccaacaa 420

cttgcggcat?cggctaaacg?ttatggcttc?gatgccgtct?ccgccgtcac?gccgttctac 480

tatcctttca?gctttgaaga?acactgcgat?cactatcggg?caattattga?ttcggcggat 540

ggtttgccga?tggtggtgta?caacattcca?gccctgagtg?gggtaaaact?gaccctggat 600

cagatcaaca?cacttgttac?attgcctggc?gtaggtgcgc?tgaaacagac?ctctggcgat 660

ctctatcaga?tggagcagat?ccgtcgtgaa?catcctgatc?ttgtgctcta?taacggttac 720

gacgaaatct?tcgcctctgg?tctgctggcg?ggcgctgatg?gtggtatcgg?cagtacctac 780

aacatcatgg?gctggcgcta?tcaggggatc?gttaaggcgc?tgaaagaagg?cgatatccag 840

accgcgcaga?aactgcaaac?tgaatgcaat?aaagtcattg?atttactgat?caaaacgggc 900

gtattccgcg?gcctgaaaac?tgtcctccat?tatatggatg?tcgtttctgt?gccgctgtgc 960

cgcaaaccgt?ttggaccggt?agatgaaaaa?tatctgccag?aactgaaggc?gctggcccag 1020

cagttgatgc?aagagcgcgg?gtgaaagctt?aattagctga?gcttggactc?ctgttgatag 1080

atccagtaat?gacctcagaa?ctccatctgg?atttgttcag?aacgctcggt?tgccgccggg 1140

cgttttttat?tggtgagaat?ccaagctagc?ttggcgagat?tttcaggagc?taaggaagct 1200

aaaatggaga?aaaaaatcac?tggatatacc?acctcgagaa?atcataaaaa?atttatttgc 1260

tttgtgagcg?gataacaatt?ataatagatt?caattgtgag?cggataacaa?tttcacacag 1320

aattcattaa?agaggagaaa?ttaactatga?gaggatcgca?tcaccatcac?catcacggat 1380

ccatggggaa?aaacttacaa?gcactggcgc?aactttacaa?aaatgccctc?ctcaacgacg 1440

tactcccgtt?ttgggaaaac?cactccctgg?atacggaagg?cggttatttt?acctgtcttg 1500

atcgccaggg?taaggtgtat?gacacagata?aatttatttg?gctgcaaaac?cgccaagtct 1560

ggactttttc?catgctgtgt?aaccagctag?aaaaacggga?aaactggctc?aaaattgcta 1620

gtaacggtgc?taaatttctt?gcccaacatg?gcagagacgc?agagggaaac?tggtattttg 1680

ccctcacccg?tggaggtgaa?ccattagtac?agccttacaa?tattttttct?gattgttttg 1740

cagcgatggc?ctttagccaa?tatgctctcg?cctctggtga?agagtgggca?aaagatgtgg 1800

ctatgcaagc?atataacaat?gttttgcgtc?gcaaagataa?tcccaaaggc?aaatatacca 1860

aaacctatcc?cggcacacgc?cccatgaaag?ccttagctgt?gccaatgatt?ttagctaacc 1920

tgaccttaga?aatggaatgg?ttgcttcccc?aggagactct?agaaaatgtc?ttgagtgcaa 1980

ccgttcagga?agttatgagt?gactttctcg?acaaagaacg?aggattgatg?tatgaaaatg 2040

ttgcccccga?tggttcccac?attgattgtt?ttgaagggcg?gctgattaac?cctggtcacg 2100

gtattgaggc?gatgtggttt?attatggaca?tcgcccgacg?gaaaaacgac?agcaagacta 2160

ttaaccaagc?agttgatgtg?gtgttaaata?tcctcaattt?cgcctgggat?aaagagtatg 2220

gcggcttgta?ttactttatg?gatgcagcag?gtcatccccc?acaacaattg?gaatgggatc 2280

aaaaattgtg?gtgggtgcat?ttagaatctt?tggtggcttt?ggcgatgggt?tatcgtttga 2340

caggtcgtga?agtctgttgg?gaatggtatc?aaaaaatgca?cgattattct?tggcagcatt 2400

ttgctgaccc?agaatatggt?gagtggtttg?gctacttaaa?tcgccgtggg?gaagtgctgt 2460

taaatctcaa?aggcggtaaa?tggaagggat?gttttcatgt?accccgtgct?ttgtatctgt 2520

gttggcaaca?attcgaggcc?ttgagttaaa?agcttaatta?gctgagcttg?gactcctgtt 2580

gatagatcca?gtaatgacct?cagaactcca?tctggatttg?ttcagaacgc?tcggttgccg 2640

ccgggcgttt?tttattggtg?agaatccaag?ctagcttggc?gagattttca?ggagctaagg 2700

aagctaaaat?ggagaaaaaa?atcactggat?ataccaccgt?tgatatatcc?caatggcatc 2760

gtaaagaaca?ttttgaggca?tttcagtcag?ttgctcaatg?tacctataac?cagaccgttc 2820

agctggatat?tacggccttt?ttaaagaccg?taaagaaaaa?taagcacaag?ttttatccgg 2880

cctttattca?cattcttgcc?cgcctgatga?atgctcatcc?ggaatttcgt?atggcaatga 2940

aagacggtga?gctggtgata?tgggatagtg?ttcacccttg?ttacaccgtt?ttccatgagc 3000

aaactgaaac?gttttcatcg?ctctggagtg?aataccacga?cgatttccgg?cagtttctac 3060

acatatattc?gcaagatgtg?gcgtgttacg?gtgaaaacct?ggcctatttc?cctaaagggt 3120

ttattgagaa?tatgtttttc?gtctcagcca?atccctgggt?gagtttcacc?agttttgatt 3180

taaacgtggc?caatatggac?aacttcttcg?cccccgtttt?caccatgggc?aaatattata 3240

cgcaaggcga?caaggtgctg?atgccgctgg?cgattcaggt?tcatcatgcc?gtttgtgatg 3300

gcttccatgt?cggcagaatg?cttaatgaat?tacaacagta?ctgcgatgag?tggcagggcg 3360

gggcgtaatt?tttttaaggc?agttattggt?gcccttaaac?gcctggggta?atgactctct 3420

agcttgaggc?atcaaataaa?acgaaaggct?cagtcgaaag?actgggcctt?tcgttttatc 3480

tgttgtttgt?cggtgaacgc?tctcctgagt?aggacaaatc?cgccctctag?agctgcctcg 3540

cgcgtttcgg?tgatgacggt?gaaaacctct?gacacatgca?gctcccggag?acggtcacag 3600

cttgtctgta?agcggatgcc?gggagcagac?aagcccgtca?gggcgcgtca?gcgggtgttg 3660

gcgggtgtcg?gggcgcagcc?atgacccagt?cacgtagcga?tagcggagtg?tatactggct 3720

taactatgcg?gcatcagagc?agattgtact?gagagtgcac?catatgcggt?gtgaaatacc 3780

gcacagatgc?gtaaggagaa?aataccgcat?caggcgctct?tccgcttcct?cgctcactga 3840

ctcgctgcgc?tcggtcgttc?ggctgcggcg?agcggtatca?gctcactcaa?aggcggtaat 3900

acggttatcc?acagaatcag?gggataacgc?aggaaagaac?atgtgagcaa?aaggccagca 3960

aaaggccagg?aaccgtaaaa?aggccgcgtt?gctggcgttt?ttccataggc?tccgcccccc 4020

tgacgagcat?cacaaaaatc?gacgctcaag?tcagaggtgg?cgaaacccga?caggactata 4080

aagataccag?gcgtttcccc?ctggaagctc?cctcgtgcgc?tctcctgttc?cgaccctgcc 4140

gcttaccgga?tacctgtccg?cctttctccc?ttcgggaagc?gtggcgcttt?ctcatagctc 4200

acgctgtagg?tatctcagtt?cggtgtaggt?cgttcgctcc?aagctgggct?gtgtgcacga 4260

accccccgtt?cagcccgacc?gctgcgcctt?atccggtaac?tatcgtcttg?agtccaaccc 4320

ggtaagacac?gacttatcgc?cactggcagc?agccactggt?aacaggatta?gcagagcgag 4380

gtatgtaggc?ggtgctacag?agttcttgaa?gtggtggcct?aactacggct?acactagaag 4440

gacagtattt?ggtatctgcg?ctctgctgaa?gccagttacc?ttcggaaaaa?gagttggtag 4500

ctcttgatcc?ggcaaacaaa?ccaccgctgg?tagcggtggt?ttttttgttt?gcaagcagca 4560

gattacgcgc?agaaaaaaag?gatctcaaga?agatcctttg?atcttttcta?cggggtctga 4620

cgctcagtgg?aacgaaaact?cacgttaagg?gattttggtc?atgagattat?caaaaaggat 4680

cttcacctag?atccttttaa?attaaaaatg?aagttttaaa?tcaatctaaa?gtatatatga 4740

gtaaacttgg?tctgacagtt?accaatgctt?aatcagtgag?gcacctatct?cagcgatctg 4800

tctatttcgt?tcatccatag?ttgcctgact?ccccgtcgtg?tagataacta?cgatacggga 4860

gggcttacca?tctggcccca?gtgctgcaat?gataccgcga?gacccacgct?caccggctcc 4920

agatttatca?gcaataaacc?agccagccgg?aagggccgag?cgcagaagtg?gtcctgcaac 4980

tttatccgcc?tccatccagt?ctattaattg?ttgccgggaa?gctagagtaa?gtagttcgcc 5040

agttaatagt?ttgcgcaacg?ttgttgccat?tgctacaggc?atcgtggtgt?cacgctcgtc 5100

gtttggtatg?gcttcattca?gctccggttc?ccaacgatca?aggcgagtta?catgatcccc 5160

catgttgtgc?aaaaaagcgg?ttagctcctt?cggtcctccg?atcgttgtca?gaagtaagtt 5220

ggccgcagtg?ttatcactca?tggttatggc?agcactgcat?aattctctta?ctgtcatgcc 5280

atccgtaaga?tgcttttctg?tgactggtga?gtactcaacc?aagtcattct?gagaatagtg 5340

tatgcggcga?ccgagttgct?cttgcccggc?gtcaatacgg?gataataccg?cgccacatag 5400

cagaacttta?aaagtgctca?tcattggaaa?acgttcttcg?gggcgaaaac?tctcaaggat 5460

cttaccgctg?ttgagatcca?gttcgatgta?acccactcgt?gcacccaact?gatcttcagc 5520

atcttttact?ttcaccagcg?tttctgggtg?agcaaaaaca?ggaaggcaaa?atgccgcaaa 5580

aaagggaata?agggcgacac?ggaaatgttg?aatactcata?ctcttccttt?ttcaatatta 5640

ttgaagcatt?tatcagggtt?attgtctcat?gagcggatac?atatttgaat?gtatttagaa 5700

aaataaacaa?ataggggttc?cgcgcacatt?tccccgaaaa?gtgccacctg?acgtctaaga 5760

aaccattatt?atcatgacat?taacctataa?aaataggcgt?atcacgaggc?cctttcgtct 5820

tcac 5824

<210>4

<211>7797

<212>DNA

＜213〉plasmid pLY-10

<400>4

atccggatat?agttcctcct?ttcagcaaaa?aacccctcaa?gacccgttta?gaggccccaa 60

ggggttatgc?tagttattgc?tcagcggtgg?cagcagccaa?ctcagcttcc?tttcgggctt 120

tgttagcagc?cggatctcag?tggtggtggt?ggtggtgctc?gagtgcggcc?gcaagctttt 180

aactcaaggc?ctcgaattgt?tgccaacaca?gatacaaagc?acggggtaca?tgaaaacatc 240

ccttccattt?accgcctttg?agatttaaca?gcacttcccc?acggcgattt?aagtagccaa 300

accactcacc?atattctggg?tcagcaaaat?gctgccaaga?ataatcgtgc?attttttgat 360

accattccca?acagacttca?cgacctgtca?aacgataacc?catcgccaaa?gccaccaaag 420

attctaaatg?cacccaccac?aatttttgat?cccattccaa?ttgttgtggg?ggatgacctg 480

ctgcatccat?aaagtaatac?aagccgccat?actctttatc?ccaggcgaaa?ttgaggatat 540

ttaacaccac?atcaactgct?tggttaatag?tcttgctgtc?gtttttccgt?cgggcgatgt 600

ccataataaa?ccacatcgcc?tcaataccgt?gaccagggtt?aatcagccgc?ccttcaaaac 660

aatcaatgtg?ggaaccatcg?ggggcaacat?tttcatacat?caatcctcgt?tctttgtcga 720

gaaagtcact?cataacttcc?tgaacggttg?cactcaagac?attttctaga?gtctcctggg 780

gaagcaacca?ttccatttct?aaggtcaggt?tagctaaaat?cattggcaca?gctaaggctt 840

tcatggggcg?tgtgccggga?taggttttgg?tatatttgcc?tttgggatta?tctttgcgac 900

gcaaaacatt?gttatatgct?tgcatagcca?catcttttgc?ccactcttca?ccagaggcga 960

gagcatattg?gctaaaggcc?atcgctgcaa?aacaatcaga?aaaaatattg?taaggctgta 1020

ctaatggttc?acctccacgg?gtgagggcaa?aataccagtt?tccctctgcg?tctctgccat 1080

gttgggcaag?aaatttagca?ccgttactag?caattttgag?ccagttttcc?cgtttttcta 1140

gctggttaca?cagcatggaa?aaagtccaga?cttggcggtt?ttgcagccaa?ataaatttat 1200

ctgtgtcata?caccttaccc?tggcgatcaa?gacaggtaaa?ataaccgcct?tccgtatcca 1260

gggagtggtt?ttcccaaaac?gggagtacgt?cgttgaggag?ggcatttttg?taaagttgcg 1320

ccagtgcttg?taagtttttc?cccatatgta?tatctccttc?ttaaagttaa?acaaaattat 1380

ttctagaggg?gaattgttat?ccgctcacaa?ttcccctata?gtgagtcgta?ttaatttcgc 1440

gggatcgaga?tcgatctcga?tcctctacgc?cggacgcatc?gtggccggca?tcaccggcgc 1500

cacaggtgcg?gttgctggcg?cctatatcgc?cgacatcacc?gatggggaag?atcgggctcg 1560

ccacttcggg?ctcatgagcg?cttgtttcgg?cgtgggtatg?gtggcaggcc?ccgtggccgg 1620

gggactgttg?ggcgccatct?ccttgcatgc?atccggatat?agttcctcct?ttcagcaaaa 1680

aacccctcaa?gacccgttta?gaggccccaa?ggggttatgc?tagttattgc?tcagcggtgg 1740

cagcagccaa?ctcagcttcc?tttcgggctt?tgttagcagc?cggatctcag?tggtggtggt 1800

ggtggtgctc?gagtgcggcc?gcaagctttc?acccgcgctc?ttgcatcaac?tgctgggcca 1860

gcgccttcag?ttctggcaga?tatttttcat?ctaccggtcc?aaacggtttg?cggcacagcg 1920

gcacagaaac?gacatccata?taatggagga?cagttttcag?gccgcggaat?acgcccgttt 1980

tgatcagtaa?atcaatgact?ttattgcatt?cagtttgcag?tttctgcgcg?gtctggatat 2040

cgccttcttt?cagcgcctta?acgatcccct?gatagcgcca?gcccatgatg?ttgtaggtac 2100

tgccgatacc?accatcagcg?cccgccagca?gaccagaggc?gaagatttcg?tcgtaaccgt 2160

tatagagcac?aagatcagga?tgttcacgac?ggatctgctc?catctgatag?agatcgccag 2220

aggtctgttt?cagcgcacct?acgccaggca?atgtaacaag?tgtgttgatc?tgatccaggg 2280

tcagttttac?cccactcagg?gctggaatgt?tgtacaccac?catcggcaaa?ccatccgccg 2340

aatcaataat?tgcccgatag?tgatcgcagt?gttcttcaaa?gctgaaagga?tagtagaacg 2400

gcgtgacggc?ggagacggca?tcgaagccat?aacgtttagc?cgatgccgca?agttgttggc 2460

tttcggcggt?gctgacgcaa?ccgacgtggg?cgatgagttt?aatcttacct?ttcgcctctt 2520

cggcgacgat?ttccagtacc?tgttcacgct?cggaaaggct?ttgtacaaag?gcctcgccgg 2580

tcgaaccacc?cacgtataaa?ccgtcgatgc?cctgctgaat?attgaactga?accaggcgac 2640

gcagactcgc?tttatccagt?gcttgttgtt?ggtcaaaagg?agtcaggagt?gcagccatta 2700

cgccacgtaa?attcgttgcc?atatgtatat?ctccttctta?aagttaaaca?aaattatttc 2760

tagaggggaa?ttgttatccg?ctcacaattc?ccctatagtg?agtcgtatta?atttcgcggg 2820

atcgagatcg?atctcgatcc?tctacgccgg?acgcatcgtg?gccggcatca?ccggcgccac 2880

aggtgcggtt?gctggcgcct?atatcgccga?catcaccgat?ggggaagatc?gggctcgcca 2940

cttcgggctc?atgagcgctt?gtttcggcgt?gggtatggtg?gcaggccccg?tggccggggg 3000

actgttgggc?gccatctcct?tgcatgcacc?attccttgcg?gcggcggtgc?tcaacggcct 3060

caacctacta?ctgggctgct?tcctaatgca?ggagtcgcat?aagggagagc?gtcgagatcc 3120

cggacaccat?cgaatggcgc?aaaacctttc?gcggtatggc?atgatagcgc?ccggaagaga 3180

gtcaattcag?ggtggtgaat?gtgaaaccag?taacgttata?cgatgtcgca?gagtatgccg 3240

gtgtctctta?tcagaccgtt?tcccgcgtgg?tgaaccaggc?cagccacgtt?tctgcgaaaa 3300

cgcgggaaaa?agtggaagcg?gcgatggcgg?agctgaatta?cattcccaac?cgcgtggcac 3360

aacaactggc?gggcaaacag?tcgttgctga?ttggcgttgc?cacctccagt?ctggccctgc 3420

acgcgccgtc?gcaaattgtc?gcggcgatta?aatctcgcgc?cgatcaactg?ggtgccagcg 3480

tggtggtgtc?gatggtagaa?cgaagcggcg?tcgaagcctg?taaagcggcg?gtgcacaatc 3540

ttctcgcgca?acgcgtcagt?gggctgatca?ttaactatcc?gctggatgac?caggatgcca 3600

ttgctgtgga?agctgcctgc?actaatgttc?cggcgttatt?tcttgatgtc?tctgaccaga 3660

cacccatcaa?cagtattatt?ttctcccatg?aagacggtac?gcgactgggc?gtggagcatc 3720

tggtcgcatt?gggtcaccag?caaatcgcgc?tgttagcggg?cccattaagt?tctgtctcgg 3780

cgcgtctgcg?tctggctggc?tggcataaat?atctcactcg?caatcaaatt?cagccgatag 3840

cggaacggga?aggcgactgg?agtgccatgt?ccggttttca?acaaaccatg?caaatgctga 3900

atgagggcat?cgttcccact?gcgatgctgg?ttgccaacga?tcagatggcg?ctgggcgcaa 3960

tgcgcgccat?taccgagtcc?gggctgcgcg?ttggtgcgga?catctcggta?gtgggatacg 4020

acgataccga?agacagctca?tgttatatcc?cgccgttaac?caccatcaaa?caggattttc 4080

gcctgctggg?gcaaaccagc?gtggaccgct?tgctgcaact?ctctcagggc?caggcggtga 4140

agggcaatca?gctgttgccc?gtctcactgg?tgaaaagaaa?aaccaccctg?gcgcccaata 4200

cgcaaaccgc?ctctccccgc?gcgttggccg?attcattaat?gcagctggca?cgacaggttt 4260

cccgactgga?aagcgggcag?tgagcgcaac?gcaattaatg?taagttagct?cactcattag 4320

gcaccgggat?ctcgaccgat?gcccttgaga?gccttcaacc?cagtcagctc?cttccggtgg 4380

gcgcggggca?tgactatcgt?cgccgcactt?atgactgtct?tctttatcat?gcaactcgta 4440

ggacaggtgc?cggcagcgct?ctgggtcatt?ttcggcgagg?accgctttcg?ctggagcgcg 4500

acgatgatcg?gcctgtcgct?tgcggtattc?ggaatcttgc?acgccctcgc?tcaagccttc 4560

gtcactggtc?ccgccaccaa?acgtttcggc?gagaagcagg?ccattatcgc?cggcatggcg 4620

gccccacggg?tgcgcatgat?cgtgctcctg?tcgttgagga?cccggctagg?ctggcggggt 4680

tgccttactg?gttagcagaa?tgaatcaccg?atacgcgagc?gaacgtgaag?cgactgctgc 4740

tgcaaaacgt?ctgcgacctg?agcaacaaca?tgaatggtct?tcggtttccg?tgtttcgtaa 4800

agtctggaaa?cgcggaagtc?agcgccctgc?accattatgt?tccggatctg?catcgcagga 4860

tgctgctggc?taccctgtgg?aacacctaca?tctgtattaa?cgaagcgctg?gcattgaccc 4920

tgagtgattt?ttctctggtc?ccgccgcatc?cataccgcca?gttgtttacc?ctcacaacgt 4980

tccagtaacc?gggcatgttc?atcatcagta?acccgtatcg?tgagcatcct?ctctcgtttc 5040

atcggtatca?ttacccccat?gaacagaaat?cccccttaca?cggaggcatc?agtgaccaaa 5100

caggaaaaaa?ccgcccttaa?catggcccgc?tttatcagaa?gccagacatt?aacgcttctg 5160

gagaaactca?acgagctgga?cgcggatgaa?caggcagaca?tctgtgaatc?gcttcacgac 5220

cacgctgatg?agctttaccg?cagctgcctc?gcgcgtttcg?gtgatgacgg?tgaaaacctc 5280

tgacacatgc?agctcccgga?gacggtcaca?gcttgtctgt?aagcggatgc?cgggagcaga 5340

caagcccgtc?agggcgcgtc?agcgggtgtt?ggcgggtgtc?ggggcgcagc?catgacccag 5400

tcacgtagcg?atagcggagt?gtatactggc?ttaactatgc?ggcatcagag?cagattgtac 5460

tgagagtgca?ccatatatgc?ggtgtgaaat?accgcacaga?tgcgtaagga?gaaaataccg 5520

catcaggcgc?tcttccgctt?cctcgctcac?tgactcgctg?cgctcggtcg?ttcggctgcg 5580

gcgagcggta?tcagctcact?caaaggcggt?aatacggtta?tccacagaat?caggggataa 5640

cgcaggaaag?aacatgtgag?caaaaggcca?gcaaaaggcc?aggaaccgta?aaaaggccgc 5700

gttgctggcg?tttttccata?ggctccgccc?ccctgacgag?catcacaaaa?atcgacgctc 5760

aagtcagagg?tggcgaaacc?cgacaggact?ataaagatac?caggcgtttc?cccctggaag 5820

ctccctcgtg?cgctctcctg?ttccgaccct?gccgcttacc?ggatacctgt?ccgcctttct 5880

cccttcggga?agcgtggcgc?tttctcatag?ctcacgctgt?aggtatctca?gttcggtgta 5940

ggtcgttcgc?tccaagctgg?gctgtgtgca?cgaacccccc?gttcagcccg?accgctgcgc 6000

cttatccggt?aactatcgtc?ttgagtccaa?cccggtaaga?cacgacttat?cgccactggc 6060

agcagccact?ggtaacagga?ttagcagagc?gaggtatgta?ggcggtgcta?cagagttctt 6120

gaagtggtgg?cctaactacg?gctacactag?aaggacagta?tttggtatct?gcgctctgct 6180

gaagccagtt?accttcggaa?aaagagttgg?tagctcttga?tccggcaaac?aaaccaccgc 6240

tggtagcggt?ggtttttttg?tttgcaagca?gcagattacg?cgcagaaaaa?aaggatctca 6300

agaagatcct?ttgatctttt?ctacggggtc?tgacgctcag?tggaacgaaa?actcacgtta 6360

agggattttg?gtcatgaaca?ataaaactgt?ctgcttacat?aaacagtaat?acaaggggtg 6420

ttatgagcca?tattcaacgg?gaaacgtctt?gctctaggcc?gcgattaaat?tccaacatgg 6480

atgctgattt?atatgggtat?aaatgggctc?gcgataatgt?cgggcaatca?ggtgcgacaa 6540

tctatcgatt?gtatgggaag?cccgatgcgc?cagagttgtt?tctgaaacat?ggcaaaggta 6600

gcgttgccaa?tgatgttaca?gatgagatgg?tcagactaaa?ctggctgacg?gaatttatgc 6660

ctcttccgac?catcaagcat?tttatccgta?ctcctgatga?tgcatggtta?ctcaccactg 6720

cgatccccgg?gaaaacagca?ttccaggtat?tagaagaata?tcctgattca?ggtgaaaata 6780

ttgttgatgc?gctggcagtg?ttcctgcgcc?ggttgcattc?gattcctgtt?tgtaattgtc 6840

cttttaacag?cgatcgcgta?tttcgtctcg?ctcaggcgca?atcacgaatg?aataacggtt 6900

tggttgatgc?gagtgatttt?gatgacgagc?gtaatggctg?gcctgttgaa?caagtctgga 6960

aagaaatgca?taaacttttg?ccattctcac?cggattcagt?cgtcactcat?ggtgatttct 7020

cacttgataa?ccttattttt?gacgagggga?aattaatagg?ttgtattgat?gttggacgag 7080

tcggaatcgc?agaccgatac?caggatcttg?ccatcctatg?gaactgcctc?ggtgagtttt 7140

ctccttcatt?acagaaacgg?ctttttcaaa?aatatggtat?tgataatcct?gatatgaata 7200

aattgcagtt?tcatttgatg?ctcgatgagt?ttttctaaga?attaattcat?gagcggatac 7260

atatttgaat?gtatttagaa?aaataaacaa?ataggggttc?cgcgcacatt?tccccgaaaa 7320

gtgccacctg?aaattgtaaa?cgttaatatt?ttgttaaaat?tcgcgttaaa?tttttgttaa 7380

atcagctcat?tttttaacca?ataggccgaa?atcggcaaaa?tcccttataa?atcaaaagaa 7440

tagaccgaga?tagggttgag?tgttgttcca?gtttggaaca?agagtccact?attaaagaac 7500

gtggactcca?acgtcaaagg?gcgaaaaacc?gtctatcagg?gcgatggccc?actacgtgaa 7560

ccatcaccct?aatcaagttt?tttggggtcg?aggtgccgta?aagcactaaa?tcggaaccct 7620

aaagggagcc?cccgatttag?agcttgacgg?ggaaagccgg?cgaacgtggc?gagaaaggaa 7680

gggaagaaag?cgaaaggagc?gggcgctagg?gcgctggcaa?gtgtagcggt?cacgctgcgc 7740

gtaaccacca?cacccgccgc?gcttaatgcg?ccgctacagg?gcgcgtccca?ttcgcca 7797

Claims (16)

1, a kind of double gene coexpression plasmid is characterized in that, described plasmid comprises N-n acetylneuraminic acid n lyase genes, N-acetyl-D-glucosamine 2-isomerase gene and a kind of suitable expression vector.

2, plasmid as claimed in claim 1 is characterized in that, described expression vector is selected from pET30a, pET29a or pQE30.

3, plasmid as claimed in claim 1 is characterized in that, described its sequence of N-n acetylneuraminic acid n lyase genes is shown in the 1829-2722 of the 151-1044 of 1854-2747, the SEQ ID NO:3 of SEQ ID NO:1 or SEQ ID NO:4.

4, plasmid as claimed in claim 1 is characterized in that, described N-acetyl-its sequence of D-glucosamine 2-isomerase gene is shown in the 182-1345 of the 1383-2546 of 179-1342, the SEQ ID NO:3 of SEQ ID NO:1 or SEQ ID NO:4.

As each described plasmid among the claim 1-4, it is characterized in that 5, described plasmid sequence is shown in SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:4.

6, as the construction process of plasmid as described in each among the claim 1-5, it is characterized in that, said method comprising the steps of:

A) design and synthesize suitable primer, carry out pcr amplification and be connected with suitable carrier, preparation comprises the subclone plasmid of N-n acetylneuraminic acid n lyase genes;

B) enzyme is cut the plasmid that comprises N-acetyl-D-glucosamine 2-isomerase gene, obtains N-acetyl-D-glucosamine 2-isomerase gene endonuclease bamhi;

C) use with the B step in same enzyme, enzyme is cut the subclone plasmid that the A step obtains, and obtains the plasmid enzyme restriction fragment;

D) endonuclease bamhi of Connection Step B and C acquisition.

7, method as claimed in claim 6 is characterized in that, described carrier is selected from pET30a, pET29a or pQE30.

8, method as claimed in claim 6 is characterized in that, described its sequence of N-n acetylneuraminic acid n lyase genes is shown in the 1829-2722 of the 151-1044 of 1854-2747, the SEQ ID NO:3 of SEQ ID NO:1 or SEQ ID NO:4.

9, method as claimed in claim 6 is characterized in that, described N-acetyl-its sequence of D-glucosamine 2-isomerase gene is shown in the 182-1345 of the 1383-2546 of 179-1342, the SEQ ID NO:3 of SEQ ID NO:1 or SEQ ID NO:4.

10, method as claimed in claim 6 is characterized in that, described plasmid sequence is shown in SEQ ID NO:1 or SEQID NO:3 or SEQ ID NO:4.

11, transform the engineering bacteria that obtains as each described plasmid among the claim 1-5.

12, engineering bacteria as claimed in claim 11 is characterized in that, described engineering bacterial strain is intestinal bacteria.

13, engineering bacteria as claimed in claim 11 is characterized in that, described engineering bacteria is expressed N-n acetylneuraminic acid n lyase and N-acetyl-D-glucosamine 2-isomerase after cultivating.

14, as the preparation method of the described engineering bacteria of claim 11-13, it is characterized in that, may further comprise the steps:

A, with claim 1-6 described double gene coexpression plasmid transformed competence colibacillus cell and on selective medium, cultivate;

B, select positive transformant.

15, method as claimed in claim 14 is characterized in that, comprises that also the positive transformant that will obtain carries out the step of amplification cultivation.

16, a kind of method of producing Neu5Ac is characterized in that, and is centrifugal behind the bacterial cell disruption with the described engineering bacterium fermentation cultivation of claim 11-13 acquisition, and centrifugal supernatant is added the GlcNAc reaction solution, and catalysis generates Neu5Ac.

Images