CN113880957A - Streptolysin O fusion protein - Google Patents

Abstract

The invention relates to a streptolysin O fusion protein. Specifically, the invention provides a streptolysin O fusion protein, which comprises a streptolysin O, His tag protein; and Trx tag proteins. The fusion protein has high expression, low-cost separation or purification by nickel column affinity chromatography, strong protein stability after purification and excellent streptolysin O antigen advantage, thereby being beneficial to the detection of the streptolysin O.

Description

Streptolysin O fusion protein

Technical Field

The invention relates to the field of medicines, in particular to a streptolysin O fusion protein.

Background

Streptococcus pyogenes is a bacterium that can cause pyogenic inflammation of skin and subcutaneous tissue, respiratory tract infection, explosive epidemic of epidemic pharyngitis, neonatal septicemia, bacterial endocarditis, scarlet fever and rheumatism, glomerulonephritis and other allergic reactions, and Streptolysin O (SLO) can combine with cholesterol on cell membranes of human and other animals to form cyclic oligomers, and large pore canals appear to cause the dissolution of the cell membranes. SLO protein has strong antigenicity and can remain in the body, thus stimulating the production of Antibodies (ASO) in the body and causing an allergic reaction due to ASO aggregation.

Because the SLO protein has strong antigenicity, the SLO protein can be used as a detection reagent to detect the ASO content in a patient. At present, the preparation method of the SLO protein is mainly a method for constructing recombinant plasmids by a gene engineering technology and then expressing and purifying the recombinant plasmids after transferring into host bacteria. However, the SLO protein expressed by genetic engineering recombination at present mainly has various defects, such as low His-SLO protein yield (low expression level), high GST-SLO protein purification cost, unstable protein and the like. For example, in the prior art, an amplified SLO fragment is connected to a vector pET-28a or pMD18T to construct a recombinant plasmid, however, the expression level of soluble protein of the recombinant plasmid pET-28a-SLO is low (mostly inclusion bodies), and the protein expressed by pMD-18T-SLO and provided with a GST tag has the disadvantages of high purification cost of a GST affinity column, poor stability of GST-SLO protein, large amount of flocculent precipitates after repeated freeze-thawing for 1-2 times or long time of 4 ℃, and difficulty in passing stability test at 37 ℃, and the like.

Therefore, there is a need in the art to develop an SLO protein fusion protein that is highly expressed, isolated or purified at low cost, highly stable, and has excellent antigenic activity.

Disclosure of Invention

The invention aims to develop an SLO protein fusion protein with high expression, low cost separation or purification, strong stability and excellent antigen activity.

In a first aspect of the invention, there is provided a streptolysin O fusion protein, said fusion protein comprising:

streptolysin O;

a His-tag protein; and

trx tag proteins.

In another preferred embodiment, the streptolysin O fusion protein is an isolated streptolysin O fusion protein.

In another preferred embodiment, the streptolysin O comprises human streptolysin O.

In another preferred embodiment, the nucleotide sequence of streptolysin O has the sequence shown in SEQ ID NO. 5.

In another preferred embodiment, the nucleotide sequence of streptolysin O has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO. 5.

In another preferred embodiment, the nucleotide sequence of said streptolysin O is complementary to the nucleotide sequence shown in SEQ ID NO. 5.

In another preferred embodiment, the nucleotide sequence of streptolysin O is as set forth in SEQ ID NO 5.

In another preferred embodiment, the nucleotide sequence of the His-tag protein has the nucleotide sequence shown in SEQ ID NO. 6.

In another preferred embodiment, the His-tag protein has a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID No. 6.

In another preferred embodiment, the nucleotide sequence of the His tag protein is complementary to the nucleotide sequence shown in SEQ ID NO. 6.

In another preferred embodiment, the His tag protein has a nucleotide sequence shown in SEQ ID NO 6.

In another preferred embodiment, the nucleotide sequence of the Trx tag protein has the nucleotide sequence shown in SEQ ID NO. 7.

In another preferred embodiment, the nucleotide sequence of the Trx tag protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO. 7.

In another preferred embodiment, the nucleotide sequence of the Trx tag protein is complementary to the nucleotide sequence shown in SEQ ID NO. 7.

In another preferred embodiment, the nucleotide sequence of the Trx tag protein is shown as SEQ ID NO. 7.

In another preferred embodiment, the nucleotide comprises a coding nucleotide.

In another preferred embodiment, the fusion protein has a structure represented by formula I:

X-L1-Y-L2-Z

(I)

wherein the content of the first and second substances,

x is His tag protein or Trx tag protein;

y is Trx tag protein or His tag protein;

z is streptolysin O;

l1 and L2 are each independently a null or a linking peptide;

"-" is a covalent bond (e.g., a peptide bond).

In another preferred embodiment, X and Y are different.

In another preferred embodiment, X is a Trx tag protein.

In another preferred embodiment, Y is a His-tag protein.

In another preferred embodiment, the fusion protein has a structure represented by formula I-1:

trx tag protein-L1-His tag protein-L2-streptolysin O

(I-1)

Wherein the content of the first and second substances,

l1 and L2 are each independently a null or a linking peptide;

"-" is a covalent bond (e.g., a peptide bond).

In another preferred embodiment, L1 is a connecting peptide with length of m amino acids, wherein m is a positive integer from 1 to 80.

In another preferred embodiment, the L2 is a linker peptide of length m amino acids, where m is a positive integer from 1 to 80.

In another preferred embodiment, the nucleotide sequence of L1 has the sequence shown in SEQ ID NO. 8.

In another preferred embodiment, the nucleotide sequence of L1 is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO. 8.

In another preferred embodiment, the nucleotide sequence of L1 is complementary to the nucleotide sequence shown in SEQ ID NO. 8.

In another preferred embodiment, the nucleotide sequence of L1 is shown as SEQ ID NO. 8.

In another preferred embodiment, the nucleotide sequence of L2 has the nucleotide sequence shown in SEQ ID NO. 9.

In another preferred embodiment, the nucleotide sequence of L2 is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO. 9.

In another preferred embodiment, the nucleotide sequence of L2 is complementary to the nucleotide sequence shown in SEQ ID NO. 9.

In another preferred embodiment, the nucleotide sequence of L2 is shown as SEQ ID NO. 9.

In another preferred embodiment, the fusion protein has excellent streptolysin O antigenicity.

In another preferred embodiment, the streptolysin O in the fusion protein has excellent specific binding capacity with streptolysin O antibody.

In a second aspect of the invention, there is provided a polynucleotide comprising a polynucleotide sequence encoding a fusion protein according to the first aspect of the invention or a complement thereof.

In another preferred embodiment, the polynucleotide has the nucleotide sequence shown in SEQ ID NO. 10.

In another preferred embodiment, the polynucleotide has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO. 10.

In another preferred embodiment, the polynucleotide is complementary to the nucleotide sequence shown in SEQ ID NO. 10.

In another preferred embodiment, the polynucleotide is represented by SEQ ID NO. 10.

In a third aspect of the invention, there is provided a vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector comprises a plasmid vector.

In another preferred embodiment, the plasmid vector comprises a pET-32a vector.

In another preferred embodiment, the plasmid vector is

In another preferred embodiment, the nucleotide sequence of the plasmid vector has the nucleotide sequence shown in SEQ ID NO. 4.

In another preferred embodiment, the nucleotide sequence of the plasmid vector has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence depicted in SEQ ID NO. 4.

In another preferred embodiment, the nucleotide sequence of the plasmid vector is complementary to the nucleotide sequence shown in SEQ ID NO. 4.

In another preferred embodiment, the nucleotide sequence of the plasmid vector is shown as SEQ ID NO. 4.

In a fourth aspect of the invention, there is provided a host cell comprising a vector according to the third aspect of the invention or a chromosome into which has been integrated an exogenous polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the host cell comprises E.coli BL21(DE 3).

In another preferred embodiment, the host cell comprises a competent cell of E.coli BL21(DE 3).

In a fifth aspect of the invention, there is provided a composition comprising a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention or a host cell according to the fourth aspect of the invention.

In another preferred embodiment, the composition is a pharmaceutical composition, a vaccine composition or a diagnostic reagent composition.

In another preferred embodiment, the composition further comprises a pharmaceutically, vaccinally or diagnostically acceptable carrier or excipient.

In a sixth aspect of the invention, there is provided a use of a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention or a host cell according to the fourth aspect of the invention for the manufacture of a medicament, a vaccine or a diagnostic agent;

the medicine or the vaccine is used for preventing and/or treating streptococcus pyogenes infection;

the diagnostic reagent is used for diagnosing streptolysin O.

In a seventh aspect of the invention, there is provided a method of preparing a fusion protein according to the first aspect of the invention, comprising the steps of:

(a) culturing a host cell according to the fourth aspect of the invention, thereby expressing a fusion protein according to the first aspect of the invention;

(b) optionally isolating or purifying said fusion protein.

In another preferred embodiment, said separation or purification comprises nickel column affinity chromatography separation or purification.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the PCR result of the amplified SLO target gene fragment.

FIG. 2 is a pET-32a map.

FIG. 3 is a map of pET-32a-SLO recombinant plasmid expressing Trx-His-SLO fusion protein (T-SLO).

FIG. 4 shows the results of SDS-PAGE protein electrophoresis to verify purification.

FIG. 5 shows Trx-His-SLO fusion protein (T-SLO) fusion protein latex agglutination assay.

FIG. 6 shows the stability test of the fusion protein.

Detailed Description

The invention discloses a streptolysin O fusion protein, which comprises a streptolysin O, His tag protein and a Trx tag protein. The fusion protein has high expression, low-cost separation or purification by nickel column affinity chromatography, strong protein stability after purification and excellent streptolysin O antigen advantage, thereby being beneficial to the detection of the streptolysin O.

Term(s) for

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, the terms "comprising," "including," and "containing" are used interchangeably and include not only open-ended definitions, but also semi-closed and closed-ended definitions. In other words, the term includes "consisting of … …", "consisting essentially of … …".

As used herein, the term "SLO" refers to the streptolysin o (streptalysin o) antigen.

The term "ASO" as used herein refers to antistreptolysin O (Anti-strelysin O).

Fusion proteins

The invention provides a streptolysin O fusion protein, which comprises a streptolysin O, His tag protein and a Trx tag protein.

As used herein, the term "fusion protein of the invention" is used interchangeably with "streptolysin O of the invention" and refers to the fusion protein described in the first aspect of the invention.

Typically, the fusion protein of the invention is as described above in relation to the first aspect of the invention.

Linker peptide

The invention provides a fusion protein, which optionally contains a connecting peptide. The size and complexity of the linker peptide may affect the activity of the protein. In general, the linker peptide should be of sufficient length and flexibility to ensure that the two proteins being linked have sufficient degrees of freedom in space to function. Meanwhile, the influence of alpha helix or beta folding and the like formed in the connecting peptide on the stability of the fusion protein is avoided.

The length of the linker peptide is generally 1 to 80 amino acids, preferably 2 to 50 amino acids, and more preferably 3 to 30 amino acids.

Polynucleotides, vectors and host cells

The present invention provides a polynucleotide comprising a polynucleotide sequence encoding a fusion protein according to the first aspect of the invention or a complement thereof.

Typically, the nucleotide sequences encoding the streptolysin O, His-tagged protein, the Trx-tagged protein, and the linker peptide (e.g., L1, L2) are as described in the first aspect of the invention.

Typically, the polynucleotide sequence encoding the fusion protein according to the first aspect of the invention has the nucleotide sequence shown in SEQ ID NO. 10.

Typically, the polynucleotide is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO. 10.

Typically, the polynucleotide is complementary to the nucleotide sequence shown in SEQ ID NO. 10.

Typically, the polynucleotide is as set forth in SEQ ID NO 10.

SEQ ID NO:10：

taaaatcacttcttttcctttgtcatcataattgatttcatcccaaggatttcatattgagcaacatacgcgccttgatgagacaggttaatttttccactagtgtactcggtagatgttgtttcaacgtattcagttctgttattgacacccgcaattttattatttttaaggaaaacactggtgtatgaaataggataagctgggttttttctactgaaggtagcattgtctttgataacgtttctaataacatcaaagtcttttgtgactaccttattgtgctctgcagcatctcctcctaaaacgacagctgtaaatgagctattttctaagatatcagagtattttccattagttttaacatctgttccttttagagctgcactaaaggccgcttcaacatcattacttttagaacttgtttctagtttgacaaaaacagttcgaccataggctacgttactcacaaagagtggcggagcttcattgctgacaccttttcgttgcaactctttaaaggtcactgatttatcaaacacatccgcaggattattaggaaggtttgctgatacggtgtaaaaaatttgcttgtatgctgcaatcatcaccttcttttcaccttttgaaatcgacttgaaatcaatgcctaaagtaccatctaagattttgctattaacatttagagctgcttcaatctgtgacttagaatataccattgattcagtatattgtgttctggcaggaagcgtattaccaccagaataattatcatgccattggttaacaagattatcaatagctgttgaaacattggcataggtagggtcattgacctcaaccgttgctttgtctcccatacctggtaaatcaatatggattttttgtgggtttcgcttggtgactaccgcgtctggtttgttttcggtaaaacctttattagccagctgaagggctgctggataggtcctatcagtgacagagtcaatgatggaaatatcgactggtgtagtgttgatattttttttctttctttcaatgacaataaatttatcagctttcttaacgccttctttaggaacaaaattttcaatggtttcaccatttttagcaagtacttcaagctcattataatttagtgaataaatcttgtcattgatttcttcagtgtgatcttcttcgctcttttttttgtcttctgactttttttcttctttttctgcagattctagtggcatttctttgggagcaagcttaatcatatcgttagagttaagcatatcatccgttttctgacctgctttttcagtagttagctcacGGATCCGATATCAGCCATGGCCTTGTCGTCGTCGTCGGTACCCAGATCTGGGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTCTTTCATACCAGAACCGCGTGGCACCAGACCAGAAGAATGATGATGATGATGGTGCATATGGCCAGAACCAGAACCGGCCAGGTTAGCGTCGAGGAACTCTTTCAACTGACCTTTAGACAGTGCACCCACTTTGGTTGCCGCCACTTCACCGTTTTTGAACAGCAGCAGAGTCGGGATACCACGGATGCCATATTTCGGCGCAGTGCCAGGGTTTTGATCGATGTTCAGTTTTGCAACGGTCAGTTTGCCCTGATATTCGTCAGCGATTTCATCCAGAATCGGGGCGATCATTTTGCACGGACCGCACCACTCTGCCCAGAAATCGACGAG。

The full-length sequence of the polynucleotide molecule of the present invention or a fragment thereof can be obtained by, but not limited to, PCR amplification, recombination, or artificial synthesis. At present, polynucleotides encoding the fusion proteins of the present invention can be obtained completely by chemical synthesis. The polynucleotide can then be introduced into various existing polynucleotides (or vectors, for example) and cells known in the art.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

The present invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "primer" refers to a generic term for an oligonucleotide that, when paired with a template, is capable of synthesizing a DNA strand complementary to the template from its origin by the action of a DNA polymerase. The primer can be natural RNA, DNA, and any form of natural nucleotide. The primers may even be non-natural nucleotides such as LNA or ZNA etc. A primer is "substantially" (or "substantially") complementary to a particular sequence on one strand of the template. The primer must be sufficiently complementary to one strand of the template to begin extension, but the sequence of the primer need not be completely complementary to the sequence of the template. For example, a primer that is complementary to the template at its 3 'end and has a sequence that is not complementary to the template at its 5' end remains substantially complementary to the template. Primers that are not perfectly complementary can also form a primer-template complex with the template, so long as there is sufficient primer binding to the template, allowing amplification to occur.

The full-length nucleotide sequence or a fragment thereof of the fusion protein or an element thereof of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells encoded with the vector or fusion protein coding sequences of the invention, and methods for producing the proteins of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant proteins by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) separating and purifying protein from culture medium or cell.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequences encoding the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, bacterial cells of the genus streptomyces; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, NS0, COS7, or 293 cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The protein in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. The purification process may employ purification processes conventionally used in the art, including but not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof. Purification processes specifically designed by the present inventors can also be employed. Preferably, the method comprises the following steps: (a) collecting culture supernatant; (b) separating by nickel column affinity chromatography; (c) superdex 200 molecular sieve separation. The purification is carried out by the process selected by the inventor, and finally the fusion protein with high yield and high purity can be obtained.

Compositions and methods of administration

The invention also provides a composition comprising an effective amount of a fusion protein of the invention. The composition of the present invention may be a pharmaceutical composition, a vaccine composition or a diagnostic reagent composition. The composition of the invention can also comprise a carrier or excipient acceptable in pharmacy, vaccine and diagnostic reagent.

Typically, the fusion proteins of the present invention can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is typically about 5 to about 8, preferably about 6 to about 8.

As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in and acceptable to humans and/or animals, such as 0.001 to 99 wt%; preferably 0.01 to 95 wt%; more preferably, 0.1 to 90 wt%.

As used herein, a "pharmaceutically, vaccinally acceptable" component is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., at a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

The compositions of the invention comprise a safe and effective amount of a fusion protein of the invention and a pharmaceutically acceptable carrier. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparations should generally be adapted to the mode of administration, and the compositions of the present invention may be prepared in the form of injections, for example, by conventional methods using physiological saline or aqueous solutions containing glucose and other adjuvants. The compositions are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount. The pharmaceutical preparation of the invention can also be prepared into a sustained release preparation.

The effective amount of the fusion protein of the present invention may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the fusion protein of the invention such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like.

The main effects of the invention include:

the invention develops the streptolysin O fusion protein simultaneously carrying the His tag protein and the Trx tag protein, and the streptolysin O fusion protein has high expression, low-cost separation or purification of nickel column affinity chromatography and strong stability of the purified protein and has excellent advantages of streptolysin O antigen, thereby being beneficial to the detection of the streptolysin O.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. Unless otherwise indicated, percentages and parts are by weight.

Example 1 expression, preparation and use of T-SLO protein

After the optimization of SLO (hemolysin O antigen) gene, a DNA sequence is synthesized by adopting an artificial synthesis mode, and the nucleotide sequence of the SLO gene is shown as the following SEQ ID NO:

SEQ ID NO:1：

aacaaacaaaacactgctagtacagaaaccacaacgacaaatgagcaaccaaagccagaaagtagtgagctaactactgaaaaagcaggtcagaaaacggatgatatgcttaactctaacgatatgattaagcttgctcccaaagaaatgccactagaatctgcagaaaaagaagaaaaaaagtcagaagacaaaaaaaagagcgaagaagatcacactgaagaaatcaatgacaagatttattcactaaattataatgagcttgaagtacttgctaaaaatggtgaaaccattgaaaattttgttcctaaagaaggcgttaagaaagctgataaatttattgtcattgaaagaaagaaaaaaaatatcaacactacaccagtcgatatttccatcattgactctgtcactgataggacctatccagcagcccttcagctggctaataaaggttttaccgaaaacaaaccagacgcggtagtcaccaagcgaaacccacaaaaaatccatattgatttaccaggtatgggagacaaagcaacggttgaggtcaatgaccctacctatgccaatgtttcaacagctattgataatcttgttaaccaatggcatgataattattctggtggtaatacgcttcctgccagaacacaatatactgaatcaatggtatattctaagtcacagattgaagcagctctaaatgttaatagcaaaatcttagatggtactttaggcattgatttcaagtcgatttcaaaaggtgaaaagaaggtgatgattgcagcatacaagcaaattttttacaccgtatcagcaaaccttcctaataatcctgcggatgtgtttgataaatcagtgacctttaaagagttgcaacgaaaaggtgtcagcaatgaagctccgccactctttgtgagtaacgtagcctatggtcgaactgtttttgtcaaactagaaacaagttctaaaagtaatgatgttgaagcggcctttagtgcagctctaaaaggaacagatgttaaaactaatggaaaatactctgatatcttagaaaatagctcatttacagctgtcgttttaggaggagatgctgcagagcacaataaggtagtcacaaaagactttgatgttattagaaacgttatcaaagacaatgctaccttcagtagaaaaaacccagcttatcctatttcatacaccagtgttttccttaaaaataataaaattgcgggtgtcaataacagaactgaatacgttgaaacaacatctaccgagtacactagtggaaaaattaacctgtctcatcaaggcgcgtatgttgctcaatatgaaatcctttgggatgaaatcaattatgatgacaaaggaaaagaagtgattacaaaacgacgttgggataactaa

the amino acid sequence of the SLO protein is shown as SEQ ID NO:

SEQ ID NO:2：

NKQNTASTETTTTNEQPKPESSELTTEKAGQKTDDMLNSNDMIKLAPKEMPLESAEKEEKKSEDKKKSEEDHTEEINDKIYSLNYNELEVLAKNGETIENFVPKEGVKKADKFIVIERKKKNINTTPVDISIIDSVTDRTYPAALQLANKGFTENKPDAVVTKRNPQKIHIDLPGMGDKATVEVNDPTYANVSTAIDNLVNQWHDNYSGGNTLPARTQYTESMVYSKSQIEAALNVNSKILDGTLGIDFKSISKGEKKVMIAAYKQIFYTVSANLPNNPADVFDKSVTFKELQRKGVSNEAPPLFVSNVAYGRTVFVKLETSSKSNDVEAAFSAALKGTDVKTNGKYSDILENSSFTAVVLGGDAAEHNKVVTKDFDVIRNVIKDNATFSRKNPAYPISYTSVFLKNNKIAGVNNRTEYVETTSTEYTSGKINLSHQGAYVAQYEILWDEINYDDKGKEVITKRRWDN。

1. PCR amplification by synthetic primers

When designing a primer, BamHI and XhoI restriction sites and protective bases are added, and a termination codon TAA is added, and the sequence of the primer is synthesized as follows:

upstream primer FP:5' -GCGGATCCgtgagctaactactgaaaaagc-3'

A downstream primer RP: 5' -GGCCTCGAGtaaaatcacttcttttcctttgtc-3'

1.1 reaction System

SLO gene template (SEQ ID NO: 1): 0.5 mul;

an upstream primer FP: 1 μ l

A downstream primer RP: 1 μ l

dNTP：4μl

Taq enzyme: 1 μ l

10×PCR buffer：5μl

ddH₂O: make up to 50. mu.l

1.2 reaction conditions:

pre-denaturation at 92 deg.C for 5min, at 92 deg.C for 30s, at 57 deg.C for 30s, at 72 deg.C for 2min, for 35 cycles, and after the last cycle, continuing to maintain the extension at 72 deg.C for 5 min. After completion of amplification, the amplification result was observed by agarose gel electrophoresis and the amplified SLO target gene fragment was recovered (FIG. 1).

The sequence of the amplified SLO target gene fragment is recovered by PCR reaction liquid and then sent to a platooning biological sequencing part for sequencing, and the nucleotide sequence of the amplified SLO target gene fragment is shown as SEQ ID NO: 3:

SEQ ID NO:3：

GCGGATCCgtgagctaactactgaaaaagcaggtcagaaaacggatgatatgcttaactctaacgatatgattaagcttgctcccaaagaaatgccactagaatctgcagaaaaagaagaaaaaaagtcagaagacaaaaaaaagagcgaagaagatcacactgaagaaatcaatgacaagatttattcactaaattataatgagcttgaagtacttgctaaaaatggtgaaaccattgaaaattttgttcctaaagaaggcgttaagaaagctgataaatttattgtcattgaaagaaagaaaaaaaatatcaacactacaccagtcgatatttccatcattgactctgtcactgataggacctatccagcagcccttcagctggctaataaaggttttaccgaaaacaaaccagacgcggtagtcaccaagcgaaacccacaaaaaatccatattgatttaccaggtatgggagacaaagcaacggttgaggtcaatgaccctacctatgccaatgtttcaacagctattgataatcttgttaaccaatggcatgataattattctggtggtaatacgcttcctgccagaacacaatatactgaatcaatggtatattctaagtcacagattgaagcagctctaaatgttaatagcaaaatcttagatggtactttaggcattgatttcaagtcgatttcaaaaggtgaaaagaaggtgatgattgcagcatacaagcaaattttttacaccgtatcagcaaaccttcctaataatcctgcggatgtgtttgataaatcagtgacctttaaagagttgcaacgaaaaggtgtcagcaatgaagctccgccactctttgtgagtaacgtagcctatggtcgaactgtttttgtcaaactagaaacaagttctaaaagtaatgatgttgaagcggcctttagtgcagctctaaaaggaacagatgttaaaactaatggaaaatactctgatatcttagaaaatagctcatttacagctgtcgttttaggaggagatgctgcagagcacaataaggtagtcacaaaagactttgatgttattagaaacgttatcaaagacaatgctaccttcagtagaaaaaacccagcttatcctatttcatacaccagtgttttccttaaaaataataaaattgcgggtgtcaataacagaactgaatacgttgaaacaacatctaccgagtacactagtggaaaaattaacctgtctcatcaaggcgcgtatgttgctcaatatgaaatccttgggatgaaatcaattatgatgacaaaggaaaagaagtgattttaCTCGAGGCC

2. enzyme digestion amplified SLO target gene fragment and pET-32a plasmid

2.1 double-enzyme digestion of the amplified SLO target gene fragment and pET-32a vector by using BamH I and Xho I, the reaction system is as follows:

enzyme digestion fragment:

amplified SLO target gene fragment (SEQ ID NO: 3): 6 μ l

BamH I：1μl

Xho I：1μl

10×buffer：4μl

dd H2O: make up to 40. mu.l

Enzyme digestion vector:

pET-32a：6μl

BamH I：1μl

Xho I：1μl

10×buffer：4μl

dd H2O: make up to 40. mu.l

The pET-32a plasmid vector map (as shown in FIG. 2) and the sequence thereof are as follows:

observing the amplification result through agarose gel electrophoresis and recovering the gene fragment after enzyme digestion to obtain the SLO target gene fragment after double enzyme digestion and the pET-32a plasmid after double enzyme digestion.

3. Connection and transformation of target gene and vector

Connecting the double-restriction enzyme SLO target gene fragment with the double-restriction enzyme pET-32a plasmid to form pET-32a-SLO recombinant plasmid for expressing Trx-His-SLO fusion protein (T-SLO)

The connection reaction system and conditions of the SLO target gene fragment subjected to double enzyme digestion and the pET-32a plasmid subjected to double enzyme digestion are as follows:

double digested SLO fragment: 7 μ l

Double digested pET-32a fragment: 3 μ l

T4 DNA ligase: 2 μ l

10×T4 buffer：2μl

ddH 2O: make up to 20. mu.l

The ligation solution was placed in a 22 ℃ water bath for 3 h. Then the DNA is transformed into a host Escherichia coli DH5a, a transformation solution is smeared on an LB plate containing ampicillin resistance through a coating rod, is subjected to oven inversion culture at 37 ℃ for overnight, then a single colony is selected, a plasmid is extracted after the culture, the plasmid is sent to a platinum sequencing part for sequencing, the sequence is correct, a pET-32a-SLO recombinant plasmid map is shown in a figure 3, and the nucleotide sequence of Trx-His-SLO fusion protein (T-SLO) is shown in SEQ ID NO: 4:

SEQ ID NO:4：

ATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGtaaaatcacttcttttcctttgtcatcataattgatttcatcccaaggatttcatattgagcaacatacgcgccttgatgagacaggttaatttttccactagtgtactcggtagatgttgtttcaacgtattcagttctgttattgacacccgcaattttattatttttaaggaaaacactggtgtatgaaataggataagctgggttttttctactgaaggtagcattgtctttgataacgtttctaataacatcaaagtcttttgtgactaccttattgtgctctgcagcatctcctcctaaaacgacagctgtaaatgagctattttctaagatatcagagtattttccattagttttaacatctgttccttttagagctgcactaaaggccgcttcaacatcattacttttagaacttgtttctagtttgacaaaaacagttcgaccataggctacgttactcacaaagagtggcggagcttcattgctgacaccttttcgttgcaactctttaaaggtcactgatttatcaaacacatccgcaggattattaggaaggtttgctgatacggtgtaaaaaatttgcttgtatgctgcaatcatcaccttcttttcaccttttgaaatcgacttgaaatcaatgcctaaagtaccatctaagattttgctattaacatttagagctgcttcaatctgtgacttagaatataccattgattcagtatattgtgttctggcaggaagcgtattaccaccagaataattatcatgccattggttaacaagattatcaatagctgttgaaacattggcataggtagggtcattgacctcaaccgttgctttgtctcccatacctggtaaatcaatatggattttttgtgggtttcgcttggtgactaccgcgtctggtttgttttcggtaaaacctttattagccagctgaagggctgctggataggtcctatcagtgacagagtcaatgatggaaatatcgactggtgtagtgttgatattttttttctttctttcaatgacaataaatttatcagctttcttaacgccttctttaggaacaaaattttcaatggtttcaccatttttagcaagtacttcaagctcattataatttagtgaataaatcttgtcattgatttcttcagtgtgatcttcttcgctcttttttttgtcttctgactttttttcttctttttctgcagattctagtggcatttctttgggagcaagcttaatcatatcgttagagttaagcatatcatccgttttctgacctgctttttcagtagttagctcacGGATCCGATATCAGCCATGGCCTTGTCGTCGTCGTCGGTACCCAGATCTGGGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTCTTTCATACCAGAACCGCGTGGCACCAGACCAGAAGAATGATGATGATGATGGTGCATATGGCCAGAACCAGAACCGGCCAGGTTAGCGTCGAGGAACTCTTTCAACTGACCTTTAGACAGTGCACCCACTTTGGTTGCCGCCACTTCACCGTTTTTGAACAGCAGCAGAGTCGGGATACCACGGATGCCATATTTCGGCGCAGTGCCAGGGTTTTGATCGATGTTCAGTTTTGCAACGGTCAGTTTGCCCTGATATTCGTCAGCGATTTCATCCAGAATCGGGGCGATCATTTTGCACGGACCGCACCACTCTGCCCAGAAATCGACGAGGATCGCCCCGTCCGCTTTGAGTACATCCGTGTCAAAACTGTCGTCAGTCAGGTGAATAATTTTATCGCTCATATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCGATCTCGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGATCCCGGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGACATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACCGGGATCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCA。

in the nucleotide sequence of SEQ ID NO. 4, the underlined part in black is His tag, the underlined part in black is Trx tag, and the lower case character is SLO expression gene nucleotide sequence, specifically as follows:

the SLO expression gene fragment is shown in SEQ ID NO: 5:

SEQ ID NO:5

taaaatcacttcttttcctttgtcatcataattgatttcatcccaaggatttcatattgagcaacatacgcgccttgatgagacaggttaatttttccactagtgtactcggtagatgttgtttcaacgtattcagttctgttattgacacccgcaattttattatttttaaggaaaacactggtgtatgaaataggataagctgggttttttctactgaaggtagcattgtctttgataacgtttctaataacatcaaagtcttttgtgactaccttattgtgctctgcagcatctcctcctaaaacgacagctgtaaatgagctattttctaagatatcagagtattttccattagttttaacatctgttccttttagagctgcactaaaggccgcttcaacatcattacttttagaacttgtttctagtttgacaaaaacagttcgaccataggctacgttactcacaaagagtggcggagcttcattgctgacaccttttcgttgcaactctttaaaggtcactgatttatcaaacacatccgcaggattattaggaaggtttgctgatacggtgtaaaaaatttgcttgtatgctgcaatcatcaccttcttttcaccttttgaaatcgacttgaaatcaatgcctaaagtaccatctaagattttgctattaacatttagagctgcttcaatctgtgacttagaatataccattgattcagtatattgtgttctggcaggaagcgtattaccaccagaataattatcatgccattggttaacaagattatcaatagctgttgaaacattggcataggtagggtcattgacctcaaccgttgctttgtctcccatacctggtaaatcaatatggattttttgtgggtttcgcttggtgactaccgcgtctggtttgttttcggtaaaacctttattagccagctgaagggctgctggataggtcctatcagtgacagagtcaatgatggaaatatcgactggtgtagtgttgatattttttttctttctttcaatgacaataaatttatcagctttcttaacgccttctttaggaacaaaattttcaatggtttcaccatttttagcaagtacttcaagctcattataatttagtgaataaatcttgtcattgatttcttcagtgtgatcttcttcgctcttttttttgtcttctgactttttttcttctttttctgcagattctagtggcatttctttgggagcaagcttaatcatatcgttagagttaagcatatcatccgttttctgacctgctttttcagtagttagctcac。

the nucleotide sequence of the His tag protein is shown as SEQ ID NO: 6:

SEQ ID NO:6

ATGATGATGATGATGGTG。

the nucleotide sequence of the Trx tag protein is shown as SEQ ID NO: 7:

SEQ ID NO:7：

GGCCAGGTTAGCGTCGAGGAACTCTTTCAACTGACCTTTAGACAGTGCACCCACTTTGGTTGCCGCCACTTCACCGTTTTTGAACAGCAGCAGAGTCGGGATACCACGGATGCCATATTTCGGCGCAGTGCCAGGGTTTTGATCGATGTTCAGTTTTGCAACGGTCAGTTTGCCCTGATATTCGTCAGCGATTTCATCCAGAATCGGGGCGATCATTTTGCACGGACCGCACCACTCTGCCCAGAAATCGACGAG。

the amino acid sequence of the connection of the Trx tag protein and the His tag protein is shown as SEQ ID NO: 8:

SEQ ID NO:8：

CATATGGCCAGAACCAGAACC。

the amino acid sequence of the connection of the His tag protein and the SLO expression gene fragment is shown as SEQ ID NO: 9:

SEQ ID NO:9：

GGATCCGATATCAGCCATGGCCTTGTCGTCGTCGTCGGTACCCAGATCTGGGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTCTTTCATACCAGAACCGCGTGGCACCAGACCAGAAGA。

preparation of Trx-His-SLO fusion protein (T-SLO)

4.1 transformation of pET-32a-SLO recombinant plasmid expressing Trx-His-SLO fusion protein (T-SLO)

Taking 100 μ l of Escherichia coli BL21(DE3) competent cells from a refrigerator at-70 ℃, thawing on ice (about 5min), adding 3 μ l of pET-32a-SLO recombinant plasmid with correct sequencing result for expressing Trx-His-SLO fusion protein (T-SLO), blowing and beating by using a pipette, and standing on ice for 30 min; placing the centrifugal tube in a water bath at 42 ℃, thermally shocking for 90-120 s, and accurately timing without shaking the centrifugal tube; carefully taking out the centrifuge tube, and placing on ice for 5min without shaking the centrifuge tube; taking out the centrifuge tube, adding 700 μ l of non-resistant LB liquid medium (to a total volume of 1ml), and placing in a water bath at 37 ℃ for 1 h; taking out the centrifuge tube, centrifuging at 2000rpm for 5min, discarding 600 mul of supernatant, uniformly coating the remaining 100 mul of mixed bacterium liquid on a solid culture medium plate containing ampicillin resistance, inverting the culture dish after the liquid is completely absorbed, and placing the culture dish in an oven at 37 ℃ for 12-16 h.

4.2 Induction and expression of Trx-His-SLO fusion protein (T-SLO)

Selecting a single colony from a cultured ampicillin-resistant solid culture medium plate, adding the single colony into 4ml of a Super Broth (SB) containing ampicillin resistance (20-50 mu g/ml), carrying out constant-temperature culture on shake-table bacteria at 37 ℃ and 250rpm until the bacterial liquid concentration OD600 is about 0.6, taking out 1ml of bacterial liquid, adding the bacterial liquid into 1L of Super Broth (SB) containing ampicillin resistance (20-50 mu g/ml), carrying out constant-temperature culture on shake-table bacteria at 37 ℃ and 250rpm until the bacterial liquid concentration OD600 is 0.6-0.8; adding lactose to a final concentration of 20mM, adjusting the temperature of a constant temperature shaking table to 22 ℃, inducing at 250rpm overnight, centrifuging the escherichia coli liquid after induction expression at 12000rpm for 5min, discarding the supernatant, and collecting the thalli.

4.3 purification of Trx-His-SLO fusion protein (T-SLO)

Re-dissolving the collected bacteria with 1 × PBS (pH 7.4), ultrasonically breaking the bacteria for 10min, centrifuging at 12000rpm for 15min, and collecting the supernatant for subsequent sample loading and purification;

preparing a reagent:

balance liquid: 1 XPBS (pH 7.4)

Washing liquid: 50mM imidazole +1 XPBS (pH 7.4).

Eluent: 0.5M imidazole +1 XPBS (pH 7.4).

Dialyzate: 1 XPBS (pH 7.4)

The nickel column filler is filled into a chromatographic column and is connected with a computer nucleic acid protein purification instrument. Before use, balancing 5-10 column volumes with a balancing solution, calibrating the computer nucleic acid protein purifier, then loading the collected supernatant, rinsing 5-10 column volumes with a washing solution after loading is finished, calibrating the computer nucleic acid protein purifier again after the columns are rinsed, eluting with an eluent, collecting the eluent, and then verifying the purification result through SDS-PAGE protein electrophoresis (figure 4).

The total weight of the purified bacteria is about 21g, the total weight of the Trx-His-SLO fusion protein (T-SLO) obtained after purification is about 487mg, and compared with the expression of the His-SLO recombinant fusion protein of pET-28a recombinant plasmid only carrying a His label (the total weight of the bacteria is about 24g, and the total weight of the His-SLO fusion protein obtained is about 216mg), the expression amount of the Trx-His-SLO fusion protein (T-SLO) of the pET-32a-SLO recombinant plasmid carrying the Trx label is obviously improved.

4.4 dialysis and concentration of the T-SLO protein

Dialyzing the eluate at a ratio of 1:100 into 1 × PBS (pH 7.4) buffer solution, and changing the solution 1 time every 4-6h and 3 times in total; after dialysis, the protein was concentrated to 4-5mg/ml, filtered through a 0.22 μm filter, and then 0.09% NaN3 was added to prevent contamination by infectious microbes.

Latex agglutination assay and stability assay for Trx-His-SLO fusion protein (T-SLO)

5.1Trx-His-SLO fusion protein (T-SLO) latex agglutination assay

Adding 5 μ l of purified T-SLO antigen into 95 μ l of blank latex, diluting with 1 × PBS (pH 7.4) solution with different concentration gradient (0,100,150,200,250,300IU/ml) of anti-streptolysin O (ASO antibody), mixing the latex with 5 μ l of antibody with different concentration, and standing for 20 min; when the same batch of latex is used simultaneously, the T-SLO antigen is not added, the mixed latex with the same volume as the above and the antibody with different concentration are used for standing for 20min as a negative control (in order to verify the effect of the batch of latex), and the result is shown in FIG. 5, the agglutination phenomenon of the latex does not occur when the antibody concentration is lower than 250IU/ml after the 5 mu l T-SLO antigen is added by comparing the control group with the experimental group, and the SLO protein is proved to have good antigenicity.

5.2 stability test

20. mu.l each of Trx-His-SLO fusion protein (T-SLO) and GST-tagged plasmid pGEX 4T-SLO-expressed GST-SLO fusion protein was mixed with the same batch of latex and placed in an oven at 37 ℃ for 5 days, followed by taking out the latex for latex agglutination test to observe the effect using the method as described above for "5.1 Trx-His-SLO fusion protein (T-SLO) latex agglutination test", GST-SLO fusion protein expressed by GST-tagged plasmid pGEX4T-SLO was used as a control experiment to observe the stability of the fusion protein, and the stability results are shown in FIG. 6:

as can be seen from FIG. 6, the GST-tagged SLO (GST-SLO fusion protein) showed the aggregation of the ASO antibody latex at different concentrations in the latex aggregation test after being left at 37 ℃ for 5 days, whereas the TRX-His-SLO showed no aggregation in the latex aggregation test after being left at 37 ℃ for 5 days, and thus it was found that TRX-HIS-SLO had higher stability than GST-SLO.

Sequence listing

<110> Shanghai Jimen Biotechnology Ltd

<120> streptolysin O fusion protein

<130> P210398-1CNCNA1

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 1407

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 1

aacaaacaaa acactgctag tacagaaacc acaacgacaa atgagcaacc aaagccagaa 60

agtagtgagc taactactga aaaagcaggt cagaaaacgg atgatatgct taactctaac 120

gatatgatta agcttgctcc caaagaaatg ccactagaat ctgcagaaaa agaagaaaaa 180

aagtcagaag acaaaaaaaa gagcgaagaa gatcacactg aagaaatcaa tgacaagatt 240

tattcactaa attataatga gcttgaagta cttgctaaaa atggtgaaac cattgaaaat 300

tttgttccta aagaaggcgt taagaaagct gataaattta ttgtcattga aagaaagaaa 360

aaaaatatca acactacacc agtcgatatt tccatcattg actctgtcac tgataggacc 420

tatccagcag cccttcagct ggctaataaa ggttttaccg aaaacaaacc agacgcggta 480

gtcaccaagc gaaacccaca aaaaatccat attgatttac caggtatggg agacaaagca 540

acggttgagg tcaatgaccc tacctatgcc aatgtttcaa cagctattga taatcttgtt 600

aaccaatggc atgataatta ttctggtggt aatacgcttc ctgccagaac acaatatact 660

gaatcaatgg tatattctaa gtcacagatt gaagcagctc taaatgttaa tagcaaaatc 720

ttagatggta ctttaggcat tgatttcaag tcgatttcaa aaggtgaaaa gaaggtgatg 780

attgcagcat acaagcaaat tttttacacc gtatcagcaa accttcctaa taatcctgcg 840

gatgtgtttg ataaatcagt gacctttaaa gagttgcaac gaaaaggtgt cagcaatgaa 900

gctccgccac tctttgtgag taacgtagcc tatggtcgaa ctgtttttgt caaactagaa 960

acaagttcta aaagtaatga tgttgaagcg gcctttagtg cagctctaaa aggaacagat 1020

gttaaaacta atggaaaata ctctgatatc ttagaaaata gctcatttac agctgtcgtt 1080

ttaggaggag atgctgcaga gcacaataag gtagtcacaa aagactttga tgttattaga 1140

aacgttatca aagacaatgc taccttcagt agaaaaaacc cagcttatcc tatttcatac 1200

accagtgttt tccttaaaaa taataaaatt gcgggtgtca ataacagaac tgaatacgtt 1260

gaaacaacat ctaccgagta cactagtgga aaaattaacc tgtctcatca aggcgcgtat 1320

gttgctcaat atgaaatcct ttgggatgaa atcaattatg atgacaaagg aaaagaagtg 1380

attacaaaac gacgttggga taactaa 1407

<210> 2

<211> 468

<212> PRT

<213> Artificial Sequence (Artifical Sequence)

<400> 2

Asn Lys Gln Asn Thr Ala Ser Thr Glu Thr Thr Thr Thr Asn Glu Gln

1 5 10 15

Pro Lys Pro Glu Ser Ser Glu Leu Thr Thr Glu Lys Ala Gly Gln Lys

20 25 30

Thr Asp Asp Met Leu Asn Ser Asn Asp Met Ile Lys Leu Ala Pro Lys

35 40 45

Glu Met Pro Leu Glu Ser Ala Glu Lys Glu Glu Lys Lys Ser Glu Asp

50 55 60

Lys Lys Lys Ser Glu Glu Asp His Thr Glu Glu Ile Asn Asp Lys Ile

65 70 75 80

Tyr Ser Leu Asn Tyr Asn Glu Leu Glu Val Leu Ala Lys Asn Gly Glu

85 90 95

Thr Ile Glu Asn Phe Val Pro Lys Glu Gly Val Lys Lys Ala Asp Lys

100 105 110

Phe Ile Val Ile Glu Arg Lys Lys Lys Asn Ile Asn Thr Thr Pro Val

115 120 125

Asp Ile Ser Ile Ile Asp Ser Val Thr Asp Arg Thr Tyr Pro Ala Ala

130 135 140

Leu Gln Leu Ala Asn Lys Gly Phe Thr Glu Asn Lys Pro Asp Ala Val

145 150 155 160

Val Thr Lys Arg Asn Pro Gln Lys Ile His Ile Asp Leu Pro Gly Met

165 170 175

Gly Asp Lys Ala Thr Val Glu Val Asn Asp Pro Thr Tyr Ala Asn Val

180 185 190

Ser Thr Ala Ile Asp Asn Leu Val Asn Gln Trp His Asp Asn Tyr Ser

195 200 205

Gly Gly Asn Thr Leu Pro Ala Arg Thr Gln Tyr Thr Glu Ser Met Val

210 215 220

Tyr Ser Lys Ser Gln Ile Glu Ala Ala Leu Asn Val Asn Ser Lys Ile

225 230 235 240

Leu Asp Gly Thr Leu Gly Ile Asp Phe Lys Ser Ile Ser Lys Gly Glu

245 250 255

Lys Lys Val Met Ile Ala Ala Tyr Lys Gln Ile Phe Tyr Thr Val Ser

260 265 270

Ala Asn Leu Pro Asn Asn Pro Ala Asp Val Phe Asp Lys Ser Val Thr

275 280 285

Phe Lys Glu Leu Gln Arg Lys Gly Val Ser Asn Glu Ala Pro Pro Leu

290 295 300

Phe Val Ser Asn Val Ala Tyr Gly Arg Thr Val Phe Val Lys Leu Glu

305 310 315 320

Thr Ser Ser Lys Ser Asn Asp Val Glu Ala Ala Phe Ser Ala Ala Leu

325 330 335

Lys Gly Thr Asp Val Lys Thr Asn Gly Lys Tyr Ser Asp Ile Leu Glu

340 345 350

Asn Ser Ser Phe Thr Ala Val Val Leu Gly Gly Asp Ala Ala Glu His

355 360 365

Asn Lys Val Val Thr Lys Asp Phe Asp Val Ile Arg Asn Val Ile Lys

370 375 380

Asp Asn Ala Thr Phe Ser Arg Lys Asn Pro Ala Tyr Pro Ile Ser Tyr

385 390 395 400

Thr Ser Val Phe Leu Lys Asn Asn Lys Ile Ala Gly Val Asn Asn Arg

405 410 415

Thr Glu Tyr Val Glu Thr Thr Ser Thr Glu Tyr Thr Ser Gly Lys Ile

420 425 430

Asn Leu Ser His Gln Gly Ala Tyr Val Ala Gln Tyr Glu Ile Leu Trp

435 440 445

Asp Glu Ile Asn Tyr Asp Asp Lys Gly Lys Glu Val Ile Thr Lys Arg

450 455 460

Arg Trp Asp Asn

465

<210> 3

<211> 1338

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 3

gcggatccgt gagctaacta ctgaaaaagc aggtcagaaa acggatgata tgcttaactc 60

taacgatatg attaagcttg ctcccaaaga aatgccacta gaatctgcag aaaaagaaga 120

aaaaaagtca gaagacaaaa aaaagagcga agaagatcac actgaagaaa tcaatgacaa 180

gatttattca ctaaattata atgagcttga agtacttgct aaaaatggtg aaaccattga 240

aaattttgtt cctaaagaag gcgttaagaa agctgataaa tttattgtca ttgaaagaaa 300

gaaaaaaaat atcaacacta caccagtcga tatttccatc attgactctg tcactgatag 360

gacctatcca gcagcccttc agctggctaa taaaggtttt accgaaaaca aaccagacgc 420

ggtagtcacc aagcgaaacc cacaaaaaat ccatattgat ttaccaggta tgggagacaa 480

agcaacggtt gaggtcaatg accctaccta tgccaatgtt tcaacagcta ttgataatct 540

tgttaaccaa tggcatgata attattctgg tggtaatacg cttcctgcca gaacacaata 600

tactgaatca atggtatatt ctaagtcaca gattgaagca gctctaaatg ttaatagcaa 660

aatcttagat ggtactttag gcattgattt caagtcgatt tcaaaaggtg aaaagaaggt 720

gatgattgca gcatacaagc aaatttttta caccgtatca gcaaaccttc ctaataatcc 780

tgcggatgtg tttgataaat cagtgacctt taaagagttg caacgaaaag gtgtcagcaa 840

tgaagctccg ccactctttg tgagtaacgt agcctatggt cgaactgttt ttgtcaaact 900

agaaacaagt tctaaaagta atgatgttga agcggccttt agtgcagctc taaaaggaac 960

agatgttaaa actaatggaa aatactctga tatcttagaa aatagctcat ttacagctgt 1020

cgttttagga ggagatgctg cagagcacaa taaggtagtc acaaaagact ttgatgttat 1080

tagaaacgtt atcaaagaca atgctacctt cagtagaaaa aacccagctt atcctatttc 1140

atacaccagt gttttcctta aaaataataa aattgcgggt gtcaataaca gaactgaata 1200

cgttgaaaca acatctaccg agtacactag tggaaaaatt aacctgtctc atcaaggcgc 1260

gtatgttgct caatatgaaa tccttgggat gaaatcaatt atgatgacaa aggaaaagaa 1320

gtgattttac tcgaggcc 1338

<210> 4

<211> 7187

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 4

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtaaaatc acttcttttc 180

ctttgtcatc ataattgatt tcatcccaag gatttcatat tgagcaacat acgcgccttg 240

atgagacagg ttaatttttc cactagtgta ctcggtagat gttgtttcaa cgtattcagt 300

tctgttattg acacccgcaa ttttattatt tttaaggaaa acactggtgt atgaaatagg 360

ataagctggg ttttttctac tgaaggtagc attgtctttg ataacgtttc taataacatc 420

aaagtctttt gtgactacct tattgtgctc tgcagcatct cctcctaaaa cgacagctgt 480

aaatgagcta ttttctaaga tatcagagta ttttccatta gttttaacat ctgttccttt 540

tagagctgca ctaaaggccg cttcaacatc attactttta gaacttgttt ctagtttgac 600

aaaaacagtt cgaccatagg ctacgttact cacaaagagt ggcggagctt cattgctgac 660

accttttcgt tgcaactctt taaaggtcac tgatttatca aacacatccg caggattatt 720

aggaaggttt gctgatacgg tgtaaaaaat ttgcttgtat gctgcaatca tcaccttctt 780

ttcacctttt gaaatcgact tgaaatcaat gcctaaagta ccatctaaga ttttgctatt 840

aacatttaga gctgcttcaa tctgtgactt agaatatacc attgattcag tatattgtgt 900

tctggcagga agcgtattac caccagaata attatcatgc cattggttaa caagattatc 960

aatagctgtt gaaacattgg cataggtagg gtcattgacc tcaaccgttg ctttgtctcc 1020

catacctggt aaatcaatat ggattttttg tgggtttcgc ttggtgacta ccgcgtctgg 1080

tttgttttcg gtaaaacctt tattagccag ctgaagggct gctggatagg tcctatcagt 1140

gacagagtca atgatggaaa tatcgactgg tgtagtgttg atattttttt tctttctttc 1200

aatgacaata aatttatcag ctttcttaac gccttcttta ggaacaaaat tttcaatggt 1260

ttcaccattt ttagcaagta cttcaagctc attataattt agtgaataaa tcttgtcatt 1320

gatttcttca gtgtgatctt cttcgctctt ttttttgtct tctgactttt tttcttcttt 1380

ttctgcagat tctagtggca tttctttggg agcaagctta atcatatcgt tagagttaag 1440

catatcatcc gttttctgac ctgctttttc agtagttagc tcacggatcc gatatcagcc 1500

atggccttgt cgtcgtcgtc ggtacccaga tctgggctgt ccatgtgctg gcgttcgaat 1560

ttagcagcag cggtttcttt cataccagaa ccgcgtggca ccagaccaga agaatgatga 1620

tgatgatggt gcatatggcc agaaccagaa ccggccaggt tagcgtcgag gaactctttc 1680

aactgacctt tagacagtgc acccactttg gttgccgcca cttcaccgtt tttgaacagc 1740

agcagagtcg ggataccacg gatgccatat ttcggcgcag tgccagggtt ttgatcgatg 1800

ttcagttttg caacggtcag tttgccctga tattcgtcag cgatttcatc cagaatcggg 1860

gcgatcattt tgcacggacc gcaccactct gcccagaaat cgacgaggat cgccccgtcc 1920

gctttgagta catccgtgtc aaaactgtcg tcagtcaggt gaataatttt atcgctcata 1980

tgtatatctc cttcttaaag ttaaacaaaa ttatttctag aggggaattg ttatccgctc 2040

acaattcccc tatagtgagt cgtattaatt tcgcgggatc gagatcgatc tcgatcctct 2100

acgccggacg catcgtggcc ggcatcaccg gcgccacagg tgcggttgct ggcgcctata 2160

tcgccgacat caccgatggg gaagatcggg ctcgccactt cgggctcatg agcgcttgtt 2220

tcggcgtggg tatggtggca ggccccgtgg ccgggggact gttgggcgcc atctccttgc 2280

atgcaccatt ccttgcggcg gcggtgctca acggcctcaa cctactactg ggctgcttcc 2340

taatgcagga gtcgcataag ggagagcgtc gagatcccgg acaccatcga atggcgcaaa 2400

acctttcgcg gtatggcatg atagcgcccg gaagagagtc aattcagggt ggtgaatgtg 2460

aaaccagtaa cgttatacga tgtcgcagag tatgccggtg tctcttatca gaccgtttcc 2520

cgcgtggtga accaggccag ccacgtttct gcgaaaacgc gggaaaaagt ggaagcggcg 2580

atggcggagc tgaattacat tcccaaccgc gtggcacaac aactggcggg caaacagtcg 2640

ttgctgattg gcgttgccac ctccagtctg gccctgcacg cgccgtcgca aattgtcgcg 2700

gcgattaaat ctcgcgccga tcaactgggt gccagcgtgg tggtgtcgat ggtagaacga 2760

agcggcgtcg aagcctgtaa agcggcggtg cacaatcttc tcgcgcaacg cgtcagtggg 2820

ctgatcatta actatccgct ggatgaccag gatgccattg ctgtggaagc tgcctgcact 2880

aatgttccgg cgttatttct tgatgtctct gaccagacac ccatcaacag tattattttc 2940

tcccatgaag acggtacgcg actgggcgtg gagcatctgg tcgcattggg tcaccagcaa 3000

atcgcgctgt tagcgggccc attaagttct gtctcggcgc gtctgcgtct ggctggctgg 3060

cataaatatc tcactcgcaa tcaaattcag ccgatagcgg aacgggaagg cgactggagt 3120

gccatgtccg gttttcaaca aaccatgcaa atgctgaatg agggcatcgt tcccactgcg 3180

atgctggttg ccaacgatca gatggcgctg ggcgcaatgc gcgccattac cgagtccggg 3240

ctgcgcgttg gtgcggacat ctcggtagtg ggatacgacg ataccgaaga cagctcatgt 3300

tatatcccgc cgttaaccac catcaaacag gattttcgcc tgctggggca aaccagcgtg 3360

gaccgcttgc tgcaactctc tcagggccag gcggtgaagg gcaatcagct gttgcccgtc 3420

tcactggtga aaagaaaaac caccctggcg cccaatacgc aaaccgcctc tccccgcgcg 3480

ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga 3540

gcgcaacgca attaatgtaa gttagctcac tcattaggca ccgggatctc gaccgatgcc 3600

cttgagagcc ttcaacccag tcagctcctt ccggtgggcg cggggcatga ctatcgtcgc 3660

cgcacttatg actgtcttct ttatcatgca actcgtagga caggtgccgg cagcgctctg 3720

ggtcattttc ggcgaggacc gctttcgctg gagcgcgacg atgatcggcc tgtcgcttgc 3780

ggtattcgga atcttgcacg ccctcgctca agccttcgtc actggtcccg ccaccaaacg 3840

tttcggcgag aagcaggcca ttatcgccgg catggcggcc ccacgggtgc gcatgatcgt 3900

gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc cttactggtt agcagaatga 3960

atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc aaaacgtctg cgacctgagc 4020

aacaacatga atggtcttcg gtttccgtgt ttcgtaaagt ctggaaacgc ggaagtcagc 4080

gccctgcacc attatgttcc ggatctgcat cgcaggatgc tgctggctac cctgtggaac 4140

acctacatct gtattaacga agcgctggca ttgaccctga gtgatttttc tctggtcccg 4200

ccgcatccat accgccagtt gtttaccctc acaacgttcc agtaaccggg catgttcatc 4260

atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc ggtatcatta cccccatgaa 4320

cagaaatccc ccttacacgg aggcatcagt gaccaaacag gaaaaaaccg cccttaacat 4380

ggcccgcttt atcagaagcc agacattaac gcttctggag aaactcaacg agctggacgc 4440

ggatgaacag gcagacatct gtgaatcgct tcacgaccac gctgatgagc tttaccgcag 4500

ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac 4560

ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc 4620

gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata gcggagtgta 4680

tactggctta actatgcggc atcagagcag attgtactga gagtgcacca tatatgcggt 4740

gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct 4800

cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 4860

aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 4920

aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 4980

tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 5040

caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 5100

cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 5160

ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 5220

gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 5280

agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 5340

gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 5400

acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 5460

gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 5520

gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 5580

cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 5640

caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 5700

gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 5760

cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 5820

cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 5880

caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 5940

gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 6000

gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctgcaggc atcgtggtgt 6060

cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 6120

catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 6180

gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 6240

ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 6300

gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 6360

cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 6420

tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 6480

gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 6540

atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 6600

ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 6660

gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 6720

aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat 6780

tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga 6840

tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca 6900

acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct 6960

aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc 7020

cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag 7080

cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca 7140

cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgcca 7187

<210> 5

<211> 1321

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 5

taaaatcact tcttttcctt tgtcatcata attgatttca tcccaaggat ttcatattga 60

gcaacatacg cgccttgatg agacaggtta atttttccac tagtgtactc ggtagatgtt 120

gtttcaacgt attcagttct gttattgaca cccgcaattt tattattttt aaggaaaaca 180

ctggtgtatg aaataggata agctgggttt tttctactga aggtagcatt gtctttgata 240

acgtttctaa taacatcaaa gtcttttgtg actaccttat tgtgctctgc agcatctcct 300

cctaaaacga cagctgtaaa tgagctattt tctaagatat cagagtattt tccattagtt 360

ttaacatctg ttccttttag agctgcacta aaggccgctt caacatcatt acttttagaa 420

cttgtttcta gtttgacaaa aacagttcga ccataggcta cgttactcac aaagagtggc 480

ggagcttcat tgctgacacc ttttcgttgc aactctttaa aggtcactga tttatcaaac 540

acatccgcag gattattagg aaggtttgct gatacggtgt aaaaaatttg cttgtatgct 600

gcaatcatca ccttcttttc accttttgaa atcgacttga aatcaatgcc taaagtacca 660

tctaagattt tgctattaac atttagagct gcttcaatct gtgacttaga atataccatt 720

gattcagtat attgtgttct ggcaggaagc gtattaccac cagaataatt atcatgccat 780

tggttaacaa gattatcaat agctgttgaa acattggcat aggtagggtc attgacctca 840

accgttgctt tgtctcccat acctggtaaa tcaatatgga ttttttgtgg gtttcgcttg 900

gtgactaccg cgtctggttt gttttcggta aaacctttat tagccagctg aagggctgct 960

ggataggtcc tatcagtgac agagtcaatg atggaaatat cgactggtgt agtgttgata 1020

ttttttttct ttctttcaat gacaataaat ttatcagctt tcttaacgcc ttctttagga 1080

acaaaatttt caatggtttc accattttta gcaagtactt caagctcatt ataatttagt 1140

gaataaatct tgtcattgat ttcttcagtg tgatcttctt cgctcttttt tttgtcttct 1200

gacttttttt cttctttttc tgcagattct agtggcattt ctttgggagc aagcttaatc 1260

atatcgttag agttaagcat atcatccgtt ttctgacctg ctttttcagt agttagctca 1320

c 1321

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 6

atgatgatga tgatggtg 18

<210> 7

<211> 255

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 7

ggccaggtta gcgtcgagga actctttcaa ctgaccttta gacagtgcac ccactttggt 60

tgccgccact tcaccgtttt tgaacagcag cagagtcggg ataccacgga tgccatattt 120

cggcgcagtg ccagggtttt gatcgatgtt cagttttgca acggtcagtt tgccctgata 180

ttcgtcagcg atttcatcca gaatcggggc gatcattttg cacggaccgc accactctgc 240

ccagaaatcg acgag 255

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 8

catatggcca gaaccagaac c 21

<210> 9

<211> 129

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 9

ggatccgata tcagccatgg ccttgtcgtc gtcgtcggta cccagatctg ggctgtccat 60

gtgctggcgt tcgaatttag cagcagcggt ttctttcata ccagaaccgc gtggcaccag 120

accagaaga 129

<210> 10

<211> 1744

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 10

taaaatcact tcttttcctt tgtcatcata attgatttca tcccaaggat ttcatattga 60

gcaacatacg cgccttgatg agacaggtta atttttccac tagtgtactc ggtagatgtt 120

gtttcaacgt attcagttct gttattgaca cccgcaattt tattattttt aaggaaaaca 180

ctggtgtatg aaataggata agctgggttt tttctactga aggtagcatt gtctttgata 240

acgtttctaa taacatcaaa gtcttttgtg actaccttat tgtgctctgc agcatctcct 300

cctaaaacga cagctgtaaa tgagctattt tctaagatat cagagtattt tccattagtt 360

ttaacatctg ttccttttag agctgcacta aaggccgctt caacatcatt acttttagaa 420

cttgtttcta gtttgacaaa aacagttcga ccataggcta cgttactcac aaagagtggc 480

ggagcttcat tgctgacacc ttttcgttgc aactctttaa aggtcactga tttatcaaac 540

acatccgcag gattattagg aaggtttgct gatacggtgt aaaaaatttg cttgtatgct 600

gcaatcatca ccttcttttc accttttgaa atcgacttga aatcaatgcc taaagtacca 660

tctaagattt tgctattaac atttagagct gcttcaatct gtgacttaga atataccatt 720

gattcagtat attgtgttct ggcaggaagc gtattaccac cagaataatt atcatgccat 780

tggttaacaa gattatcaat agctgttgaa acattggcat aggtagggtc attgacctca 840

accgttgctt tgtctcccat acctggtaaa tcaatatgga ttttttgtgg gtttcgcttg 900

gtgactaccg cgtctggttt gttttcggta aaacctttat tagccagctg aagggctgct 960

ggataggtcc tatcagtgac agagtcaatg atggaaatat cgactggtgt agtgttgata 1020

ttttttttct ttctttcaat gacaataaat ttatcagctt tcttaacgcc ttctttagga 1080

acaaaatttt caatggtttc accattttta gcaagtactt caagctcatt ataatttagt 1140

gaataaatct tgtcattgat ttcttcagtg tgatcttctt cgctcttttt tttgtcttct 1200

gacttttttt cttctttttc tgcagattct agtggcattt ctttgggagc aagcttaatc 1260

atatcgttag agttaagcat atcatccgtt ttctgacctg ctttttcagt agttagctca 1320

cggatccgat atcagccatg gccttgtcgt cgtcgtcggt acccagatct gggctgtcca 1380

tgtgctggcg ttcgaattta gcagcagcgg tttctttcat accagaaccg cgtggcacca 1440

gaccagaaga atgatgatga tgatggtgca tatggccaga accagaaccg gccaggttag 1500

cgtcgaggaa ctctttcaac tgacctttag acagtgcacc cactttggtt gccgccactt 1560

caccgttttt gaacagcagc agagtcggga taccacggat gccatatttc ggcgcagtgc 1620

cagggttttg atcgatgttc agttttgcaa cggtcagttt gccctgatat tcgtcagcga 1680

tttcatccag aatcggggcg atcattttgc acggaccgca ccactctgcc cagaaatcga 1740

cgag 1744

Claims (10)

1. A streptolysin O fusion protein, wherein said fusion protein comprises:

streptolysin O;

a His-tag protein; and

trx tag proteins.

2. The fusion protein of claim 1, wherein the fusion protein has the structure of formula I-1:

trx tag protein-L1-His tag protein-L2-streptolysin O

(I-1)

Wherein the content of the first and second substances,

l1 and L2 are each independently a null or a linking peptide;

"-" is a covalent bond (e.g., a peptide bond).

3. A polynucleotide comprising a polynucleotide sequence encoding the fusion protein of claim 1 or a complement thereof.

4. The polynucleotide of claim 3, wherein said polynucleotide has the nucleotide sequence set forth in SEQ ID No. 10;

the polynucleotide has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO. 10; or

The polynucleotide is complementary with the nucleotide sequence shown in SEQ ID NO. 10.

5. A vector comprising the polynucleotide of claim 1.

6. The vector of claim 5, wherein the nucleotide sequence of the plasmid vector has the nucleotide sequence set forth in SEQ ID NO. 4;

the nucleotide sequence of the plasmid vector has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence set forth in SEQ ID NO. 4; or

The nucleotide sequence of the plasmid vector is complementary with the nucleotide sequence shown in SEQ ID NO. 4.

7. A host cell comprising the vector of claim 3 or having integrated into its chromosome an exogenous polynucleotide according to claim 2.

8. A composition comprising the fusion protein of claim 1, the polynucleotide of claim 2, the vector of claim 3, or the host cell of claim 4.

9. Use of the fusion protein of claim 1, the polynucleotide of claim 2, the vector of claim 3, or the host cell of claim 4 for the preparation of a medicament, vaccine, or diagnostic agent;

the medicine or the vaccine is used for preventing and/or treating streptococcus pyogenes infection;

the diagnostic reagent is used for diagnosing streptolysin O.

10. A method of making the fusion protein of claim 1, comprising the steps of:

(a) culturing the host cell of claim 4, thereby expressing the fusion protein of claim 1;

(b) optionally isolating or purifying said fusion protein.

Images