CN112480249B - Preparation method and application of phosphorylated antibody product of AKT (alkyl ketene dimer) new substrate HIP-55 - Google Patents

Abstract

The invention discloses a preparation method and application of a phosphorylated antibody product of AKT new substrate HIP-55. The invention provides a method for preparing an HIP-55 protein S269 or T291 site phosphorylation antibody, which comprises the following steps: immunizing animals by using antigen synthetic peptide as immunogen, collecting antiserum, and purifying to obtain HIP-55 protein S269 or T291 site phosphorylation antibody; the antigen synthetic peptide is obtained by coupling the hapten synthetic peptide with carrier protein after connecting cysteine to the N end of the hapten synthetic peptide; the amino acid sequence of the hapten synthetic peptide is shown in SEQ ID No.1 or SEQ ID No.2, and a phosphate group is modified at a site corresponding to S269 or T291 of the HIP-55 protein. The HIP-55 phosphorylation antibody has good sensitivity and specificity, and can be used for detecting the interaction between HIP-55 and AKT, and further used for assisting in diagnosing myocardial infarction.

Description

Preparation method and application of phosphorylated antibody product of AKT new substrate HIP-55

Technical Field

The invention relates to the technical field of biology, in particular to a preparation method and application of a phosphorylated antibody product of AKT new substrate HIP-55.

Background

Since its first discovery, the serine/threonine kinase AKT (also known as protein kinase B or PKB), a proto-oncogene, has become a major focus of medical attention because it plays an important role in regulating a variety of different physiological or pathological functions, including metabolism, growth, proliferation, survival, transcription, and protein synthesis. AKT exerts important physiological or pathological functions mainly by regulating its various substrates. For example, AKT regulates cell cycle progression by directly phosphorylating AKT substrates p21 and p 27; AKT directly phosphorylates apoptosis promoting protein Bad or transcription factor FoxO to generate apoptosis inhibiting signal and promote cell survival; AKT plays an important role in regulating the carbohydrate metabolism of an organism by activating the substrate AS 160. Because AKT regulates various cellular functions by regulating its different substrate proteins and plays an important role in numerous biological processes, modulation of AKT and/or its substrate proteins are important targets for the treatment of human diseases.

HIP-55 (heterologous promoter kinase 1[ HPK1] -interacting protein of 55 kDa; also known as drebrin-like protein DBNL, mABP1 or SH3P7) is a protein comprising multiple functional domains. The structure mainly comprises an N-terminal F-actin protein binding domain and a C-terminal SH3 domain.

The protein properties of HIP-55 are not well understood at present, and no study has shown the relationship between HIP-55 and AKT. There are no reports related to the HIP-55 phosphorylated antibody.

Disclosure of Invention

The invention aims to provide a preparation method and application of a phosphorylated antibody product of a novel AKT substrate HIP-55.

In a first aspect, the invention claims a method for preparing an antibody phosphorylating the S269 site of HIP-55 protein.

The method for preparing the phosphorylated antibody at the S269 site of the HIP-55 protein, which is claimed by the invention, can comprise the following steps: and immunizing animals by taking the antigen synthetic peptide A as immunogen, collecting antiserum, and purifying to obtain the HIP-55 protein S269 site phosphorylation antibody.

The antigen synthetic peptide A is obtained by coupling a cysteine connected with the C end of the hapten synthetic peptide A with a carrier protein; the amino acid sequence of the hapten synthetic peptide A is shown in SEQ ID No.1, and the 6 th amino acid residue S is modified with a phosphate group.

In a second aspect, the invention claims a method for preparing an antibody phosphorylated at the T291 site of the HIP-55 protein.

The method for preparing the T291 locus phosphorylation antibody of the HIP-55 protein, which is claimed by the invention, can comprise the following steps: and immunizing animals by taking the antigen synthetic peptide B as immunogen, collecting antiserum, and purifying to obtain the HIP-55 protein T291 site phosphorylation antibody.

The antigen synthetic peptide B is obtained by coupling the hapten synthetic peptide B with carrier protein after the N end of the hapten synthetic peptide B is connected with cysteine; the amino acid sequence of the hapten synthetic peptide B is shown in SEQ ID No.2, and the 7 th amino acid residue T is modified with a phosphate group.

In both the first and second aspects, the animal may be a rabbit (e.g., a Japanese big ear rabbit). The carrier protein may be hemocyanin (KLH).

In a third aspect, the invention claims antibodies to phosphorylation of HIP-55 proteins.

The HIP-55 protein phosphorylation antibody claimed by the invention can be any one of the following antibodies:

(A1) (ii) preparing a phosphorylated antibody at the S269 site of the HIP-55 protein using the method described in the first aspect hereinbefore;

(A2) an antibody phosphorylated at the T291 site of the HIP-55 protein prepared by the method described in the second aspect above.

In a fourth aspect, the invention claims an antigen-synthesizing peptide.

The antigen synthetic peptide claimed by the invention can be any one of the following:

(B1) an antigen-synthesizing peptide a as hereinbefore described in the first aspect;

(B2) the antigen as described in the second aspect hereinbefore synthesizes peptide B.

In a fifth aspect, the invention claims the use of an antigen-synthesizing peptide as described in the fourth aspect hereinbefore for the preparation of an antibody to phosphorylate the HIP-55 protein as described in the third aspect hereinbefore.

In a sixth aspect, the invention claims the use of the HIP-55 protein phosphorylation antibody described in the third aspect hereinbefore for detecting the phosphorylation status of the S269 site and/or the T291 site of the HIP-55 protein.

Wherein, the phosphorylation state of the S269 site and/or the T291 site of the HIP-55 protein can be whether the S269 site and/or the T291 site of the HIP-55 protein are/is phosphorylated or not, and can also be the phosphorylation level of the HIP-55 protein.

In a seventh aspect, the invention claims the use of an antibody to phosphorylate a HIP-55 protein as described in the third aspect hereinbefore for the detection of the interaction of a HIP-55 protein with AKT.

In an eighth aspect, the invention claims the use of the HIP-55 protein in any one of:

(C1) as AKT substrate;

(C2) interact with AKT.

The (C1) -the (C2) is realized by depending on the phosphorylation of the S269 site and/or the T291 site of the HIP-55 protein.

In a ninth aspect, the present invention claims the use of the HIP-55 protein phosphorylation antibody described in the third aspect in the preparation of a product for diagnosing or assisting in diagnosing myocardial infarction.

Wherein the product may be a kit.

In a specific embodiment of the invention, the amino acid sequence of the HIP-55 protein is specifically SEQ ID No. 3. Accordingly, the nucleotide sequence of said DNA capable of being translated into said HIP-55 protein, i.e.the DBNL gene, is in particular SEQ ID No. 4.

Experiments prove that the HIP-55 protein S269/T291 site phosphorylation antibody prepared by the method has good sensitivity and specificity, and can be used for detecting the HIP-55 protein S269/T291 site phosphorylation state. The invention also finds that the HIP-55 is a substrate of AKT, and the HIP-55 protein S269/T291 site phosphorylation antibody can be used for detecting the interaction between HIP-55 and AKT, and further used for assisting in the diagnosis of myocardial infarction.

Drawings

FIG. 1 is a plasmid map of recombinant vector pRP.EX3d-. alpha.MHC > hDBNL (WT)/flag > hrGFP.

FIG. 2 is a graph of the titer of specific phosphorylated antibodies at the S269 site and the T291 site of HIP-55. A is an S269 site-specific phosphorylated antibody of HIP-55, which is capable of recognizing a polypeptide sequence phosphorylated at serine 269 (S269) of HIP-55, but not recognizing a non-phosphorylated polypeptide sequence, and the antibody titer is >1: 200000. B is a T291 site-specific phosphorylated antibody of the HIP-55, which can recognize a polypeptide sequence phosphorylated by threonine 291 (T291) of the HIP-55 but does not recognize a polypeptide sequence without phosphorylation, and the antibody titer is greater than 1: 200000.

FIG. 3 shows the detection of specific phosphorylated antibodies at the S269 and T291 sites of HIP-55. A is the sensitivity and specificity of HIP-55S269 phosphorylated antibody. B is the sensitivity and specificity of the HIP-55T 291 phosphorylation antibody. C is the specificity of HIP-55S269 and T291 phosphorylated antibody. D is that when EGF stimulation is given, the phosphorylation level of HIP-55 can be correctly identified by using the HIP-55S269 phosphorylation antibody and the HIP-55T 291 phosphorylation antibody, respectively, and GST-HIP-55AA cannot be identified by the HIP-55S269 phosphorylation antibody and the HIP-55T 291 phosphorylation antibody (S269A/T291A).

FIG. 4 shows the expression of HIP-55 in heart tissue of a myocardial infarction model mouse. A is mRNA expression level; b is the protein expression level.

FIG. 5 is a graph of the effect of HIP-55 knockdown on myocardial infarction injury. A is evidence for genotyping HIP-55 whole-body knockdown mice. B is evidence of the protein level of HIP-55 in whole body knockdown mice. And C is TTC staining for detecting myocardial infarction area of the mice. D is TUNEL staining to detect cardiomyocyte apoptosis in myocardial infarction. E is the ratio of the cardiac tibia after myocardial infarction. And F is cardiac ultrasound.

FIG. 6 is a graph of the effect of heart-specific HIP-55 overexpression on myocardial infarction injury. A is evidence for genotyping heart-specific HIP-55 overexpressing mice. B is evidence of protein levels in heart-specific HIP-55 overexpressing mice. C is TTC staining for detecting myocardial infarction area. D is TUNEL staining to detect cardiomyocyte apoptosis in myocardial infarction. E is the ratio of the cardiac tibia after myocardial infarction. And F is cardiac ultrasound.

FIG. 7 is a graph showing the effect of HIP-55 on the activity of HPK1/JNK pathway. A is the interaction of HIP-55 and HPK 1. B is HIP-55 inhibiting HPK1 activity. And C is the obvious down-regulation of the expression level of the HIP-55 in 293A cells stably knocking down the HIP-55. D is a significant increase in starvation-induced JNK activation when HIP-55 expression is reduced. E is that starvation-induced JNK activation was significantly reduced when HIP-55 was overexpressed. JNK is obviously activated when F is myocardial infarction, and the activation of the JNK can be obviously further increased by HIP-55 knockout. G is heart-specific HIP-55 overexpression can obviously inhibit JNK activation during myocardial infarction.

FIG. 8 shows the detailed mechanism of HIP-55 in inhibiting HPK1 and HPK1 downstream JNK kinases. A is 14-3-3tau which is able to bind to GST-HIP-55 but not to GST-HIP-55-AA. B is that HIP-55 inhibits the activity of HPK1 kinase and depends on the formation of a complex between HIP-55 and 14-3-3 tau. C is that when HIP-55 expression is reduced, starvation-induced JNK activation is significantly increased; and when GST-HIP-55 is overexpressed, the hunger-induced JNK activation is obviously weakened; whereas starvation-induced JNK activation was not altered when GST-HIP-55-AA was overexpressed.

FIG. 9 shows that AKT phosphorylation of HIP-55 controls HIP-55/14-3-3tau complex formation. A is HIP-55 capable of interacting with AKT. B is a kinase experiment using a phosphorus 32 marker to confirm that HIP-55 is a substrate for AKT, and S269 and T291 of HIP-55 are sites phosphorylated by AKT. C for the general AKT substrate antibody confirmed that HIP-55 is the substrate of AKT, S269 and T291 of HIP-55 are sites phosphorylated by AKT. D is EGF stimulation which can increase the phosphorylation level of the S269 and T291 sites of HIP-55. E is EGF which increases HIP-55 phosphorylation by AKT kinase.

FIG. 10 shows that the AKT/HIP-55/HPK1 signaling pathway is necessary to protect against myocardial infarction. A is evidence for genotyping heart-specific HIP-55-AA overexpressing mice. B is evidence of protein levels in heart-specific HIP-55-AA overexpressing mice. C is compared with heart-specific over-expression of HIP-55WT, and heart-specific over-expression of HIP-55AA can not inhibit the activation of JNK kinase during myocardial infarction. D is compared with heart-specific over-expression HIP-55WT, TTC staining shows that heart-specific HIP-55-AA over-expression cannot inhibit the reduction of myocardial infarction area of mice. E is compared to heart-specific over-expressed HIP-55WT, TUNEL staining showed that heart-specific HIP-55-AA overexpression was not able to inhibit decreased cardiomyocyte apoptosis during myocardial infarction. F is the reduction of the post-myocardial-infarction ratio of cardiac-specific HIP-55-AA due to its inability to overexpress HIP-55WT as compared to cardiac-specific. G is cardiac ultrasound.

In each figure, denotes a p-value of less than 0.05; denotes a p value of less than 0.01. EF denotes left ventricular ejection fraction. FS represents the left ventricular short axis shortening rate. Scr is an abbreviation for Scramble, representing the control for the HIP-55 knock-down group. KD is an abbreviation for HIP-55KD, representing the HIP-55 knock-down group. OE is an abbreviation for overexpression, indicating HIP-55 overexpression. WT means a wild type. AA denotes the HIP-55 protein S269A and T291A mutants.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 phosphorylated antibody of AKT substrate HIP-55, and preparation method and application thereof

A method of material

1. Preparation of HIP-55 phosphorylated antibodies

(1) Preparation of immunogens

Designing and synthesizing modified polypeptide KERAM (pS) TTS-C aiming at the S269 site of the HIP-55 protein, wherein C at the C end is cysteine, dissolving the modified polypeptide KERAM (pS) in a PBS buffer solution, and coupling the modified polypeptide KERAM (pS) to hemocyanin (KLH) by utilizing the sulfydryl of the cysteine to immunize experimental-grade Japanese big ear rabbits.

Designing and synthesizing a modified polypeptide C-FLQKQL (pT) QPE aiming at the T291 locus of the HIP-55 protein, wherein the C at the N end is cysteine, dissolving the polypeptide in a PBS (phosphate buffer solution), coupling the polypeptide to hemocyanin (KLH) by using the cysteine, and immunizing an experimental-grade Japanese big-ear rabbit.

SEQ ID No.1：KERAM(pS)TTS。

SEQ ID No.2：FLQKQL(pT)QPE。

(2) Immunization protocol

As shown in table 1.

TABLE 1 immunization protocol

Number of immunizations	Immune cycle	Immunity dose	Immunologic adjuvant	Immunizing animal conditions
					First immunization	1 day	1.4mg	Complete Freund's adjuvant	Good effect
Second immunization	19 days	0.7mg	Incomplete Freund's adjuvant	Good effect
					Third immunization	47 days	0.7mg	Incomplete Freund's adjuvant	Good effect
Fourth immunization	61 days	0.7mg	Incomplete Freund's adjuvant	Is good
					Fifth immunization	82 days	0.7mg	Incomplete Freund's adjuvant	Good effect
Blood sampling for immunized animals	94 days			Normal blood sampling

Note: the column of "immunization dose" is based on the mass of the polypeptide.

(3) Antigen affinity purification

Coupling phosphorylated synthetic peptide coupling protein (namely immunogen in step 1) and agarose to be used as chromatography filler for affinity purification, obtaining all antibodies aiming at phosphorylated antigen epitope and removing low-sequence complexity epitope antibody with low affinity by changing pH and ion concentration; subsequently, non-phosphorylated synthetic peptide was used to couple carrier protein (i.e., as compared to the immunogen in step 1), and only the phosphorylated modified S and T was replaced with non-phosphorylated S and T) was coupled to agarose as a chromatographic packing for affinity separation, to remove non-phosphorylated epitope antibodies that bound non-specifically in phosphorylated antibodies.

(4) Antibody detection

Titer determination of antiserum after immunization: phosphorylation modified peptides (i.e. KERAM (pS) TTS-C and C-FLQKQL (pT) QPE) at 269 site and 291 site of HIP-55 and control peptides (i.e. KERAMSTTS-C and C-FLQKQLTQPE) were dropped on a cellulose acetate membrane as antigens at a ratio of 100 ng/drop and air-dried, after sealing skim milk powder at room temperature for 1 hour, the corresponding antibodies were diluted with concentration gradient (1: 1000, 1:5000, 1: 10000, 1:50000, 1: 100000, 1:200000 dilution), and the binding titer of the antibodies to the antigens was determined by Dot blot assay (Dot blot).

2. Preparation and identification of HIP-55 gene knock-out mouse

Selecting a C57BL/6 mouse, and preparing the HIP-55 gene whole-body knockout mouse by using a TALEN technology. The mouse HIP-55 homologous gene (mDBNL, mouse drebrin like) is positioned on mouse chromosome 11 (GenBank numbering: NM-001146309.1; Ensembl numbering: ENSMUSG00000020476), 13 exons are in total, and the first exon and (or) the second exon are selected as TALEN knockout targets. TALEN mRNAs generated by in vitro transcription were injected into fertilized eggs for HIP-55 knock-out mouse generation. The 22 bases on the first exon of the Gabrb1 gene are knocked out, and the 5 base sequence on the first exon of the HIP-55 gene is 5'-CATCCGTGTGGCTGGCACAGGA-3'. After the sequence on the first exon of the gene is knocked out, the nucleotide sequence of the first exon is 5 '-ttacctatgaaggcaacagcaatga- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -ggtgagtatgaacccaaacaacagta-3'.

The specific operation steps are as follows: and designing and constructing a TALEN vector according to the HIP-55 gene information, and carrying out in-vitro transcription on the constructed TALEN vector. The obtained transcribed mRNA aiming at different sites is respectively injected into fertilized eggs of the C57BL/6 strain, and the fertilized eggs after microinjection are returned to the oviduct of the surrogate mother mouse. The resulting F0 knockout mice were crossed with wild-type C57BL/6 to breed F1 HIP-55 heterozygotes. The F1 generation of target genotype mice were bred to generate F2 generation of HIP-55 heterozygote mice, and then subjected to DNA sequencing for genotype analysis. Subsequent generation of HIP-55 homozygous mice.

The experimental mice are bred in the experimental animal center of the department of medicine of Beijing university (room temperature 23 ℃, relative humidity 65%, alternate light and shade for 12 hours), and the newborn mice are subjected to genotype identification at the age of 2 weeks, and the selected genotype is HIP-55 ^+/+ And HIP-55 ^-/- The male mice are bred to 12-16 weeks old, and then the next experiment is carried out.

The HIP-55 gene knockout mouse genotype is identified according to the following steps:

(1) extracting a DNA genome: mice were trimmed about 2 weeks old for 0.3cm of rat tail and placed in EP tubes, each of which was dosed with Mix (500. mu.l SNET + 10. mu.l proteinase K; SNET formulation shown in Table 2) and shaken overnight (8 hours) at 55 ℃. Shaking the EP tube vigorously the next day until the rat tail is completely dissolved. 5M NaCl (58.5g NaCl +200mL deionized water) was added to each EP tube, mixed by vigorous shaking, allowed to stand on ice for 15 minutes and centrifuged (4 ℃,12000rpm,15 minutes) to take 500. mu.l of the supernatant (without aspiration to the bottom pellet) into a new EP tube. An equal volume of phenol-chloroform isoamyl alcohol (lower organic phase) was added to a new EP tube and extracted and mixed well to a uniform pink color. After centrifugation at 12000rpm for 15 minutes at 4 ℃ 300. mu.l of the upper aqueous phase (without removing the lower impurities) were taken in a fresh EP tube. To a new EP tube, 300. mu.l of isopropanol of equal volume was added, gently inverted 20 times, mixed well and placed on ice. After 10 minutes the supernatant was centrifuged (4 ℃,12000rpm,15 minutes) and discarded. Add 500. mu.l 70% ethanol, gently invert the mixture upside down, suspend the feathered DNA, wash the DNA pellet, centrifuge (4 ℃, 7500rpm, 5 minutes), discard the supernatant, and vacuum pump dry. An appropriate amount of deionized water (10-30 μ l after mixing and centrifugation at 4 ℃ for one hour to facilitate more DNA dissolution) is added according to the size of the DNA, so that the DNA concentration is approximately 100-200 ng/mL.

TABLE 2 SNET formulation

(2) And (3) PCR: the PCR program was set up as follows: 30 seconds at 98.0 ℃; 98.0 ℃ for 5 seconds; 65.0 ℃ for 5 seconds; 72.0 ℃ for 7 seconds (30 cycles); 72.0 ℃ for 1 minute; 4.0 ℃.

The PCR primer sequences were as follows:

Forward：5’-AAGTGCTGGGATTAAAGGCGTGC-3’；

Reverse：5’-GTCACTGTAGCTGAGCTGGAGGAAGA-3’。

the PCR system is shown in Table 3.

TABLE 3 PCR System

(3) Enzyme digestion: the solution was mixed with the system shown in Table 4 and left overnight at 37 ℃ for 30 minutes or 4 ℃.

TABLE 4 enzyme digestion System

(4) The enzyme digestion product runs glue

Preparing glue: dissolving 1.5% Agrose gel in 0.5 × TBE by microwave oven, and adding Gene finder to make the final concentration to 0.1% when the temperature is reduced to 70 deg.C.

Sampling: mu.l of the cleaved product + 1. mu.l of an electrophoresis Mix (electrophoresis Mix formulation: 6 XLoading buffer: Gene finder ═ 9:1 was mixed in a sample plate, and 5. mu.l of the mixture was sampled.

Electrophoresis: 120V for 30 minutes.

After enzyme digestion, if a single band (one band in all) appears at 399bp, the single band is a homozygote of the HIP-55 knockout; if one band (three bands in total) appears at 399bp, 227bp and 172bp respectively, the HIP-55 knockout heterozygote is obtained; if one band (two bands in total) appears at 227bp and 172bp, the wild type is obtained.

3. Construction of Heart-specific overexpressing HIP-55 mice (HIP-55) ^Tg ) And mouse genotype identification

The process for preparing the transgenic mouse comprises the following steps:

(1) design and construction of recombinant expression vector

A promoter of a currently international and universal heart-specific overexpression gene, namely an alpha MHC promoter and a human DBNL gene (the nucleotide sequence of the DBNL gene is shown as SEQ ID No.4, the DBNL gene encodes a HIP-55 protein, the amino acid sequence of the HIP-55 protein is shown as SEQ ID No. 3) are constructed into a target vector pRP.Des3d by using Gateway technology, the obtained recombinant vector is named as pRP.EX3 d-alpha MHC > hDBNL (WT)/flag > hrGFP (the plasmid map is shown as figure 1), and the whole sequence is shown as SEQ ID No. 5.

(2) Preparation and identification of transgenic mice

The recombinant vector pRP.EX3d-alpha MHC > hDBNL (WT)/flag > hrGFP obtained above was digested with NotI to obtain linearized DNA, which was injected into fertilized eggs of 200 FVB/NCrlVr (abbreviated as FVB/N) mice, and the fertilized eggs after microinjection were returned to the oviduct of 4-5 surrogate mother mice.

Transgenic fountain (primary) mice were established and bred with wild-type mice. Different primers are designed according to the inserted gene fragment to ensure the accuracy of the identification of the obtained transgenic mice. And the mouse positive for PCR identification in the offspring is the heart-specific over-expression HIP-55 transgenic mouse.

The primer sequence for identifying heart-specific over-expression HIP-55 transgenic mice is as follows:

Forward：5′-ATGACAGACAGATCCCTCCTATCTCC-3′；

Reverse：5′-GCCTTCATAGGTAAAGAGAGCCCAGTCG-3′。

4. preparation of myocardial infarction model

Ligation of anterior descending coronary artery: 12-16 week-old male mice weighing about 30g are administered with 1% pentobarbital solution (1 atropine per 20 ml) by intraperitoneal injection at a dose of 0.60ml/100g for anesthesia. After the mice are anesthetized, under the irradiation of a heat light source, the mice are connected with a small animal respirator (the peak value of the airway pressure is 14.40cm H) after the oral trachea cannula ₂ O, the respiratory rate is 110 times/minute, the ventilation volume is 1L/min, the inhalation-exhalation ratio is 1:1), the right lateral position of the mouse is fully exposed to the front of the left chest, the four limbs of the mouse are fixed on a circulation heating operating table, and the mouse is connected with a small animal electrocardiogram detector to record the change of an electrocardiogram of the operating center. Depilating the operation area, sterilizing with 75% alcohol, cutting skin between the third and the fourth ribs near the left side of the sternum, separating hypodermis, pectoralis major and pectoralis minor muscle layer by layer, cutting intercostal muscle to expose thoracic cavity, placing chest opener between the third and the fourth ribs to fully expose heart, carefully lifting and cutting pericardium, separating pericardium, and pushing lung and thymus away with cotton. Under the irradiation of a cold light source, the Left anterior descending coronary artery (LAD) is searched through careful observation under a stereoscopic microscope, and a blood vessel with obviously different refractive indexes on the surface of the cardiac muscle, namely the anterior descending coronary artery, can be found by adjusting light and combining an anatomical position (starting from the lower edge of the Left atrial appendage and reaching the apex of the heart). A7-0 suture needle with a thread is adopted to penetrate through the surface layer of the myocardium at a position 2-3mm below the lower edge of the left auricle, the penetration depth and the ligation width are about 1mm, and a 2mm thread end is padded before ligation so as to prevent the blood vessel from being pinched off by ligation force. The ST segment of the normal electrocardiogram of the mouse before the operation is not raised, the color of the heart muscle and the apex of the left ventricle can be seen to be white after ligation, and the left auricle is full. Observing the electrocardiogram, it can be seen that the ST segment of the II lead is horizontally elevated from the baseline, the arch back is continuously elevated along with the prolonging of the time, and the J point is elevated and even fused with the R wave, which leads to the broadening of the QRS wave. The change of the electrocardiogram shows that the myocardial infarction model is successfully prepared. After confirming that the operation is successful, closing the thoracic cavity layer by layer, squeezing the thoracic cavity to exhaust gas before closing the thoracic cavity, and then suturing the rib and the muscle by using the line of No. 6-0 and the line of No. 5-0 with the skin of the broken seam. The control group (Sham group) mice were treated in exactly the same manner as the myocardial infarction mice except that LAD was not ligated with 6-0 line. Placing the mice in a breeding cage after the mice recover and are automatically extubated, placing cotton balls soaked with normal saline into the cage for the mice to suck due to weakness of the mice after operation, taking heat preservation measures, observing and recording the conditions of the mice every day。

5. Cardiac ultrasound

Removing the chest precursor hair of the mouse by using depilatory cream, inducing the mouse to be anesthetized by using 2% isoflurane, maintaining the anesthetized state by using 1% isoflurane, coating a little conductive adhesive on the contact parts of the right upper limb and the two lower limbs of the mouse and an electrocardiogram electrode of the mouse plate, and fixing the mouse plate in a supine position at the constant temperature of 37 ℃ (maintaining the body temperature). The change curve of the motion of the anterior and posterior walls of the left ventricle (the detection depth of an ultrasonic probe is 2cm, the detection frequency is 17.5MHz, and the scanning speed is 100mm/s) is detected by a Vevo770 ultrasonic system (Visual sonic Inc, Toronto, Canada) small animal ultrasonic instrument at the level of the papillary muscle of the short axial section beside the sternum, and the heart rate and the electrocardiogram of the mouse are synchronously detected.

The ultrasonic probe is placed in front of the sternum of the mouse, and the positions of the probe and the mouse plate are adjusted until the short axis section of the heart of the mouse clearly shows the front and back walls of the transverse section of the left ventricle and the structure of papillary muscle. Switching to M-mode, recording the motion change of the anterior and posterior ventricular walls, and measuring the length of each radial line of the ventricular structure by applying vevo770 v3.0.0 software, wherein the radial line comprises left ventricular end diastolic anterior wall thickness (LVAW; d), left ventricular end diastolic ventricular inner diameter (LVID; d), left ventricular end diastolic wall thickness (LVPW; d), left ventricular end systolic anterior wall thickness (LVLVLVLVID; s), left ventricular end systolic anterior wall thickness (LVPW), LVPW, LVP. And calculating the left ventricular Ejection Fraction (EF) and the short axis shortening (FS) according to the above parameters, wherein the calculation formula is as follows:

FS＝(LVID；d-LVID；s)/LVID；s×100％

EF＝(EDV-ESV)/EDV×100％

wherein:

EDV＝(7.0/(2.4+LVID；d))×LVID；d ³

ESV＝(7.0/(2.4+LVID；s))×LVID；s ³

6. evans Blue-TTC dyeing

Myocardial infarct size was assessed 1 day after myocardial infarction using Evans blue-TTC double staining method, non-ligated non-ischemic areas were stained blue, viable myocardium in the area at risk of cardiac ischemia (AAR) was stained red and infarcted myocardium was white. The dyeing principle is as follows: after Evans Blue (Sigma) dye was injected into the heart through the apex, the coronary arteries were ligated and the myocardium was not perfused with Evans Blue and therefore did not stain, whereas the non-ligated non-ischemic normal areas could be perfused normally and therefore stained Blue. Triphenyltetrazolium chloride (TTC, Sigma) is a redox species with a standard redox potential of 80mV that is soluble in water to form a colorless solution. TTC is reduced to form red water-insoluble triphenyl, and is therefore commonly used to detect dehydrogenases. TTC is a proton acceptor of a pyridine-nucleoside structural enzyme system in a respiratory chain, and can react with dehydrogenase in normal tissues to be reduced to be red, while dehydrogenase activity in necrotic tissues is reduced, so that the necrotic tissues cannot be dyed red, and the necrotic tissues are white. The specific operation steps are as follows: 1% Evans Blue solution and 1% TTC solution are prepared by using 1 x Phosphate Buffer Solution (PBS), the Ewins Blue solution is prepared for use at present and is protected from light, animals are anesthetized, 0.2mL of 1% Evans Blue is injected from the apex of the heart after the chest is opened, normal cardiac muscle is dyed Blue quickly, the heart is taken immediately (generally for about 5 seconds), the heart is placed into precooled 1 x PBS, residual blood in the heart is washed out, and water on the heart is sucked by using filter paper. Freezing the heart in a refrigerator at-80 deg.C for 15min, removing the part above the ligature, transversely cutting the myocardium below the ligature into 5-6 pieces (about 1mm thick) along the direction perpendicular to the long axis of the left chamber (LV), sequentially placing each piece of myocardium in a 96-well plate, adding preheated 1% TTC solution into the well in advance, incubating in an incubator at 37 deg.C in the dark for 10min, wherein the myocardium in the dead area (IA) is white, and the ischemic non-infarcted myocardium is red. The stained myocardial sections were fixed in 4% neutral formaldehyde overnight, the sections were placed in sequence on clean glass slides the next day, and scanned using a scanner EPSON Scan Perf V700(24 true color, 2400 dpi). Thereafter, the myocardial slices were sequentially weighed, and the weight of each myocardial slice was calculated as a percentage of the total weight of all slices. Performing area statistical analysis by using Image-Pro Plus 6.0, respectively calculating the area of the left ventricle (total myocardium, LV), the area of an ischemic danger zone (red myocardium + white myocardium, AAR) and the area of an infarcted zone (white myocardium, IA) in each myocardium, performing weight correction by multiplying the area of each zone in each slice by the percentage (%) of the weight of the myocardium, finally superposing the corrected corresponding areas in each slice, using AAR/LV as an index for evaluating whether the ligation positions are consistent or not, and using IA/AAR as an index for evaluating the myocardial infarction area.

7. Heart to shank ratio

After weighing the mice, Body weights (Body Weight, BW) were recorded and anesthetized. Opening the chest cavity, taking out the left lung and the right lung, and weighing the total weight of the left lung and the right lung; the Heart was perfused with ice PBS, the blood in the Heart chamber was washed, the Heart was removed, excess blood vessels and connective tissue at the bottom of the Heart were trimmed in ice PBS and the Heart was blotted dry with filter paper, weighed and recorded (Heart Weight, HW). The Tibia was removed and the Length of the Tibia was measured with a vernier caliper (Tibia Length, TL). The cardio-tibial ratio (HW/TL) is calculated from the above parameters.

8. Preparation of tissue sections

Mouse heart tissue was fixed in 4% paraformaldehyde solution (W/V%, 1 × PBS), taken out after 8 hours, and placed in 20% sucrose solution (W/V%, 1 × PBS). Then the mixture is put into 50 percent (2 hours), 70 percent (3 hours) and 80 percent (3 hours) ethanol solution for gradient dehydration, and finally the mixture is put into 90 percent ethanol and n-butanol mixed solution (volume ratio is 1:1) for overnight. The next day, 95% ethanol plus n-butanol solution (45 min 2 times), n-butanol (30 min), butanol (20 min) were sequentially added, then the excess surface liquid was blotted with filter paper, and finally the tissue block was embedded by dipping in paraffin for 2 hours. The paraffin sections were 5 μm thick, placed on a slide and put into a dry oven to be baked (60 ℃ C., 2 hours) for staining.

9. TUNEL staining for detection of cardiac tissue apoptosis

Paraffin sections of the heart were deparaffinized, and cardiomyocyte apoptosis was detected using the TUNEL kit (Roche,11684795910), the specific procedures were performed according to the kit instructions. Nuclei were then stained with DAPI (sigma, D9542) and incubated for 60 minutes. Fluorescence is observed under an inverted fluorescence microscope and images are collected, green fluorescence is apoptotic cardiomyocytes, and blue fluorescence is cell nuclei.

10. Total protein extraction from cardiac tissue

Shearing the myocardial tissue frozen in liquid nitrogen, placing in an EP tube, adding 1ml of lysis solution, adding 3 big magnetic beads and 15 small magnetic beads, mixing, homogenizing for 3 times for 20s each time by using a tissue homogenizer, and standing on ice for 15 minutes. Centrifuge at 12000rpm for 15 minutes at 4 ℃ and take the supernatant into an EP tube and store at-80 ℃. The lysate was purchased from solinebo, inc, and is collectively known as high performance RIPA tissue/cell lysate, cat # R0010.

11. Extraction of Total cellular protein

The cell culture was aspirated off, and the cells were washed twice with 1 × PBS pre-warmed at 37 ℃, 100 μ l of lysis buffer was added to one well of each six-well plate, after lysing the cells on ice for 15min, the samples were scraped off with a cell scraper and transferred into an EP tube, centrifuged after sonication (4 ℃,12000rpm,15min), the supernatant was aspirated, and frozen in a freezer at-80 ℃. The lysate was purchased from solinebo, inc, and is collectively known as high performance RIPA tissue/cell lysate, cat # R0010.

12. Western blotting experiment (Western blot)

(1) Sample processing

An appropriate amount of 5 × Loading Buffer was added to the protein-quantified sample to make it 1 × Loading Buffer. The protein was denatured by boiling at 100 ℃ for 5 min. Immediately loaded or stored at-80 ℃.

(2) SDS Polyacrylamide gel electrophoresis and Western blotting hybridization

SDS polyacrylamide gels (see Table 5) were prepared, requiring 10ml of separation gel and 5ml of stacking gel for one gel.

TABLE 5 SDS Polyacrylamide gel formulations

Sampling: the first well was loaded with 3.5. mu.l of protein Marker, and the remaining wells were loaded with a typical loading of 30. mu.g based on protein quantification.

Electrophoresis: and (3) carrying out electrophoresis at a voltage of 80V, when the Marker is separated and the bromophenol blue enters the separation gel, increasing the voltage to 120V, and continuing the electrophoresis until the bromophenol blue reaches the bottom of the separation gel for about 2-3 h.

Film transferring: 6 pieces of filter paper with the same size as the gel and 1 piece of NC membrane are cut, an electrophoresis transfer device is installed according to the BIO-RAD product specification and then connected with a power supply, and the electrophoresis is transferred for 2 hours in a 200mA constant current ice bath.

And (3) sealing: after the end of the electrophoretic transfer, the membrane was blocked in 5ml of 5% BSA or 5% milk at room temperature 240r for 1 h.

Incubating the primary antibody: the blocked NC membrane was placed in an antibody incubation chamber, 6ml of appropriate primary antibody (diluted with blocking solution) was added, and the membrane was placed flat on a shaker platform gently shaken (240r) overnight at 4 ℃.

Washing the membrane: after the primary antibody is incubated, the membrane is washed 3 times by TBST at 320r for 10 min/time.

Incubation of secondary antibody: secondary antibodies were made with 5% milk and incubated for one hour at room temperature (240 r).

Rinsing: after the secondary antibody incubation is finished, the membrane is washed by TBST for 3 times, 320r and 10 min/time again.

And (3) developing: western Blot hypersensitivity luminescent solution of Pierce company is adopted, and solution A and solution B are mixed according to the proportion of 1:1 and are prepared for use. And (4) emitting light in a dark room, and exposing, developing and fixing by adopting an X film. Wherein, the exposure and development time depends on the signal strength.

And (4) result storage: and after the film is air-dried, marking information such as number date, name, sample loading sequence, protein detection and the like. The gel imaging system performs gray scanning to analyze the film and stores the image.

If it is desired to reuse the same membrane for detection of additional proteins, it is necessary to elute with striping Buffer (320r, 30min) and wash the membrane with TBST (320r, 10 min. times.3). Primary and secondary antibodies were resealed and incubated.

13. Cardiac tissue RNA extraction

The Tridzol method is used for extracting RNA in tissues or cells, and RNA is easy to degrade by RNA enzyme, so a tip and a reagent without RNA enzyme are used in the whole operation process. Taking organization as an example: 50-100mg of frozen tissues are taken and placed in a special tissue homogenizing tube, 1ml of Tridzol and a proper amount of magnetic beads are added into each tube, then the tube is placed in a tissue homogenizing instrument, and a selection program is used for cracking the tissues. 12000rpm, 4 ℃, centrifugation for 15min, taking supernatant, placing in a new 1.5ml RNA enzyme-free EP tube, adding 200 mul chloroform into each tube, fully shaking and mixing uniformly, placing at room temperature for 5-10min, and then layering in the tube. Placing the EP tube in a centrifuge, centrifuging at 12000rpm for 15min at 4 ℃, taking about 400 μ l of upper aqueous phase (note that the middle layer is white and contains protein, DNA and the like, and the lower layer is organic phase and can not be absorbed), transferring to a new EP tube, adding isopropanol with the same volume, lightly mixing, standing at room temperature for 10min, separating out RNA precipitate, centrifuging at 12000rpm for 4 min, and discarding the supernatant. 1ml of 75% ethanol was added to the tube, and the EP tube was gently inverted upside down for ten times to wash out the isopropanol and other organic impurities on the RNA precipitate. 7500rpm, 4 deg.C, centrifuging for 5min, discarding the supernatant, repeating the above steps and washing RNA once again, and sucking the residual liquid in the tube with a vacuum pump. And opening the tube cover of the EP tube, and drying in an ultra-clean workbench for about 15min until the RNA becomes transparent. Add 20-50. mu.l (slightly adjusted according to the size of RNA) DEPC water to the tube to dissolve RNA, measure the RNA concentration and then split the solution, store at-80 ℃. The extraction procedure of cellular RNA is similar to that of tissue: the medium was discarded, washed twice with PBS, 1ml of Tridzol was added to one well of each six-well plate, the cells were lysed well by pipetting, and after 10min on ice, the Tridzol was transferred to a 1.5ml rnase-free EP tube. The subsequent steps are the same as the extraction of tissue RNA.

14. Real-time fluorescent Quantitative PCR (Quantitative Real-time PCR, qPCR)

(1) Reverse transcription

The RNA is reverse transcribed into cDNA before the next PCR amplification step. Reverse transcription was performed using a kit ImProm-II reverse transcription System (Promega). Reverse transcription of RNA is as follows: 1000ng of RNA was placed in an EP tube dedicated to PCR, and 1. mu.l of DEPC water and Random Primer were added to constitute a system of 11. mu.l. The EP tubes were incubated at 70 ℃ for 5min to denature the RNA, followed by incubation at 0 ℃ for 5min, after which 9. mu.l of reverse transcription Mix was added to each tube and the mixture was mixed and centrifuged at low speed.

The reverse transcription reaction system is shown in Table 6.

TABLE 6 reverse transcription reaction System

Reverse transcription was performed according to the following procedure: 5min at 25 ℃; 1h at 42 ℃; 15min at 70 ℃. The reverse transcribed product can be stored at-30 ℃.

(2)qPCR

The qPCR can realize real-time fluorescence quantification, and the length of an amplified product is about 200bp generally. The RT-PCR is semi-quantitative PCR, and the amplification length can reach 500bp-600 bp.

Diluting cDNA: mu.l of the cDNA template obtained by reverse transcription was diluted to 100. mu.l (optionally, it was further diluted by a factor of more).

A PCR reaction mixture was prepared as shown in table 7:

TABLE 7Q-PCR and RT-PCR reaction systems

Q-PCR: the 8-tube containing the above reaction solution was placed in a Real Time PCR apparatus, and Real-Time quantitative PCR was performed using ABI PRISM 7700 sequence detection System (Applied Biosystems). The PCR program used the two-step method, set up as follows: at 95 ℃ for 2 min; (95 ℃ for 15s,60 ℃ for 1 min). times.40 cycles. CT value obtained, application 2 ^-△△Ct The method performs data analysis.

RT-PCR: the 8-channel tube containing the above reaction solution was placed in a conventional PCR apparatus (DNA Engine sessions # PTC0200G) and the PCR procedure was as follows: 94 ℃ for 3 min; (94 ℃ for 20s,60 ℃ for 20s,72 ℃ for 3.5min) x 35 cycles, 10 ℃,5 min; 4 ℃ forever. The products obtained by RT-PCR were subjected to agarose gel electrophoresis, and bands were observed.

The sequences of the primers used in Q-PCR in this experiment are shown in Table 8.

TABLE 8Q-PCR primers

15. Interaction (GST pull down)

293A cells transfected with the plasmid of interest were lysed with GST pull down lysate (1% ethylphenylpolyethylene glycol (NP-40), 150mM sodium chloride (NaCl), 100mM 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 5mM sodium pyrophosphate (Na) ₄ P ₂ O ₇ ) 5mM sodium fluoride (NaF), 2mM sodium orthovanadate (Na) ₃ VO ₄ ) 1mM phenylmethylsulfonyl fluoride (PMSF), 10mg/L Aprotinin (Aprotinin). The cell lysate was centrifuged at 12000rpm at 4 ℃ for 20min and the supernatant was transferred to a new EP tube. Add 20. mu.l of Glutathione-Sepharose 4B beads (GE Healthcare), spin bind at 4 ℃ for 4h, centrifuge at 750rpm to collect the beads, wash the beads 3 times with GST pull down lysate, aspirate the supernatant, add an appropriate amount of 2X loading buffer to the beads, and centrifuge at 800rpm after boiling at 100 ℃ for 10min to collect the supernatant for subsequent Western blot detection.

16. Plasmid construction

(1) Construction of pcDNA3.1-N-GST-HIP-55 recombinant plasmid

Primers were designed with reference to the mRNA sequence (NM-001014436.3) of the humanized DBNL gene published at NCBI using cDNA from HEK293A cells as a template, and PCR amplification was performed, wherein the sequences of the upstream primer GST-HIP-55-F and the downstream primer GST-HIP-55-R are shown in Table 9. Wherein, the upstream primer and the downstream primer respectively comprise restriction enzyme cutting sites of EcoRI and XhoI. The primers were synthesized by Biotechnology engineering (Shanghai) Inc. The PCR amplification product is the DBNL gene coding region (the sequence is shown as SEQ ID No. 4), the PCR reaction is shown in Table 10, the PCR amplification system is shown in Table 11, and then the amplified DBNL gene fragment is recovered. The recovered DBNL gene fragment is connected to pcDNA3.1+ N-GST (TEV) vector (Nanjing Kingsler company) by using a seamless cloning technology to construct eukaryotic expression pcDNA3.1-N-GST-HIP-55 recombinant plasmid (abbreviated as GST-HIP-55 plasmid). Meanwhile, pcDNA3.1+ N-GST (TEV) (abbreviated as GST plasmid) was used as a control plasmid for GST-HIP-55. The specific operation is as follows:

1) linearized pcDNA3.1+ N-GST (TEV) vector. The pcDNA3.1+ N-GST (TEV) vector (see Table 12 for the linearization system) was linearized by the EcoRI and XhoI double digestion method, digested in a water bath at 37 ℃ for 1 hour, and then incubated in a water bath at 65 ℃ for 20 minutes for heat inactivation.

TABLE 9 PCR primer sequences

Name (R)	Sequence 5 '-3'
		GST-HIP-55-F	CAGGGCGGATCCGAATTCATGGCGGCGAACCTGAGC
GST-HIP-55-R	GGGCCCTCTAGACTCGAGTTACTCAATGAGCTCCACGTA
		GST-HIP-55-S269A-R	GACTGGAGATGGAGGTGGTGGCCATGGCCCTCTCCTTC
GST-HIP-55-S269A-F	GAAGGAGAGGGCCATGGCCACCACCTCCATCTCCAGTC
		GST-HIP-55-T291A-R	GTGGGTCTCTGGTTGGGCTAGCTGCTTCTGCAGG
GST-HIP-55-T291A-F	CCTGCAGAAGCAGCTAGCCCAACCAGAGACCCAC
		HIP-55-His-F	CCGCGCGGCAGCCATATGATGGCGGCGAACCTGAGC
HIP-55-His-R	TATTATTATCTCGAGCTCAATGAGCTCCACGTA
		HPK1-Flag-F	CCCAAGCTGGCTAGCATGGACGTCGTGGACCCT
HPK1-Flag-R	GTAGTCACTTAAGCTTGGCAGGCCTGTAATCC
		HA-14-3-3-F	ACCGAGCTCGGATCCATGGAGAAGACTGAG
HA-14-3-3-R	GTATCTAGACTCGAGGGGTTTTCAGCCCCTTC

TABLE 10 PCR amplification reaction System

TABLE 11 amplification procedure

TABLE 12 linearized pcDNA3.1+ N-GST (TEV) vector System

Name (R)	Dosage of
		Carrier	lμg
10x NEBuffer 2.1(NEB Corp.)	5μ1
		EcoRI	1.5μl
XhoI	1.5μl
		ddH 2 O	Trim to a total of 50ul

2) The linearized pcDNA3.1+ N-GST (TEV) vector was recovered by gel.

And (3) performing electrophoresis by using 1% macroporous agarose gel, and performing gel electrophoresis on the vector product subjected to enzyme digestion and the PCR product subjected to the target gene at the same time to perform a gel recovery experiment. The kit used in the gel recovery experiment was a general agarose gel DNA recovery kit (gel recovery kit: Tiangen, DP209), and the gel recovery procedures were as described in the specification. And (5) measuring the concentration of the carrier and the target gene fragment after the glue is recovered.

3) The vector is ligated to the fragment of interest. The DBNL gene was ligated into the linearized pcDNA3.1+ N-GST (TEV) vector using the "seamless cloning technique" (kit: Tiangen EasyGeno single fragment recombinant cloning kit, VI201), the procedure being as described in the description.

4) DH5 alpha competent cell transformation

50 μ l of DH5 α competent cells (Dingguo, MCC001-1) were thawed on ice. The above-mentioned 10ul ligation product was added, gently mixed and ice-cooled for 30 min. Followed by incubation at 42 ℃ for 90 seconds and then quickly transferred to ice for 2 min. Then, 50m of non-resistant LB medium was added to each EP tube, mixed gently, and cultured on a shaker at 37 ℃ for 1 hour at 200rpm to revive competent cells. After 1 hour, the supernatant and the pellet were gently mixed, and the transformed competent cells were transferred to agar plates containing the corresponding antibiotics and spread out uniformly. The plate was then placed in a 37 ℃ incubator and after l hours the plate was inverted and incubated overnight.

5) Plasmid sequencing identification and plasmid large extraction

Individual colonies on solid agar plates were picked up in 10ml of liquid LB medium containing antibiotics and incubated overnight at 37 ℃ with a shaker at 200 rpm. 5ml of this was transferred to sequencing. After the sequencing result is returned and the Blast alignment is correct, the remaining 5ml of the bacterial solution is put into 1 liter of liquid LB culture medium containing antibiotics and cultured overnight in a shaker at 37 ℃ and 200 rpm. Plasmid concentration was determined using endotoxin-free plasmid macroextraction kit (Tiangen, DP120) with the procedure as described in the instruction.

(2) Construction of recombinant plasmid pcDNA3.1-N-GST-HIP-55-S269A

And (2) respectively carrying out two times of PCR amplification by taking the constructed GST-HIP-55 plasmid as a template, wherein the PCR amplification comprises the following specific steps: PCR amplification was performed using the forward primer GST-HIP-55-F and the reverse primer GST-HIP-55-S269A-R (see Table 9 for sequence); PCR amplification was performed using the forward primer GST-HIP-55-S269A-F and the reverse primer GST-HIP-55-R (see Table 9 for sequence); and two PCR products are respectively recovered; then, the two recovered PCR product fragments are recombined and connected with the linearized pcDNA3.1+ N-GST (TEV) vector in a seamless cloning way, and DH5 alpha competent cell transformation and plasmid sequencing identification are carried out to obtain plasmid big extraction, thus obtaining eukaryotic expression pcDNA3.1-N-GST-HIP-55-S269A recombinant plasmid (abbreviated as GST-HIP-55-S269A plasmid).

(3) Construction of pcDNA3.1-N-GST-HIP-55-T291A recombinant plasmid

And (2) respectively carrying out two times of PCR amplification by taking the constructed GST-HIP-55 plasmid as a template, wherein the PCR amplification comprises the following specific steps: PCR amplification was performed using the forward primer GST-HIP-55-F and the reverse primer GST-HIP-55-T291A-R (see Table 9 for sequence); PCR amplification was performed using the forward primer GST-HIP-55-T291A-F and the reverse primer GST-HIP-55-R (see Table 9 for sequence); and two PCR products are respectively recovered; then, the two recovered PCR product fragments are recombined and connected with the linearized pcDNA3.1+ N-GST (TEV) vector in a seamless cloning way, and then the DNA 5 alpha competent cell transformation and plasmid sequencing identification are carried out to greatly extract the plasmid, thus obtaining the eukaryotic expression pcDNA3.1-N-GST-HIP-55-T291A recombinant plasmid (abbreviated as GST-HIP-55-T291A plasmid).

(4) Construction of pcDNA3.1-N-GST-HIP-55-S269A/T291A recombinant plasmid

The GST-HIP-55-S269A plasmid constructed above was used as a template, and two PCR amplifications were performed, as follows: PCR amplification was performed using the forward primer GST-HIP-55-F and the reverse primer GST-HIP-55-T291A-R (see Table 9 for sequence); PCR amplification was performed using the forward primer GST-HIP-55-T291A-F and the reverse primer GST-HIP-55-R (see Table 9 for sequence); and two PCR products are respectively recovered; then, the two recovered PCR product fragments are recombined and connected with the linearized pcDNA3.1+ N-GST (TEV) vector in a seamless cloning way, and DH5 alpha competent cell transformation and plasmid sequencing identification are carried out to greatly improve the plasmid, thus obtaining the eukaryotic expression pcDNA3.1-N-GST-HIP-55-S269A/T291A recombinant plasmid (abbreviated as GST-HIP-55-AA plasmid).

(5) Flag-HPK1 plasmid construction

A cDNA of HEK293A cells is taken as a template, primers are designed by referring to an mRNA sequence (NM-007181.6) of a humanized MAP4K1 gene (MAP4K1 gene encodes HPK1 protein) published on NCBI, and PCR amplification is carried out, wherein the sequences of an upstream primer HPK1-Flag-F and a downstream primer HPK1-Flag-R are shown in Table 9. Wherein, the upstream primer and the downstream primer respectively comprise enzyme cutting sites of NheI and HindIII. The primer is synthesized by the company of Biotechnology engineering (Shanghai), a sequence obtained after PCR synthesis is MAP4K1 (the sequence is shown as SEQ ID No. 6), then the amplified MAP4K1 gene fragment is recovered by glue, the recovered MAP4K1 gene fragment is connected to pcDNA3.1+ C-DYK vector (Nanjing Kingssy product) by utilizing a seamless cloning technology, and eukaryotic expression pcDNA3.1-HPK1-Flag recombinant plasmid (abbreviated as Flag-HPK1 plasmid) is constructed. And after the construction is finished, sequencing and identifying the plasmid and greatly extracting the plasmid.

(6) Construction of HA-14-3-3 plasmid

A cDNA of HEK293A cells is taken as a template, a primer is designed by referring to an mRNA sequence (NM-006826.4) of a humanized YWHAQ gene (the YWHAQ gene encodes 14-3-3Tau protein) published on NCBI, and PCR amplification is carried out, wherein the sequences of an upstream primer HA-14-3-3-F and a downstream primer HA-14-3-3-R primer are shown in Table 9. Wherein, the upstream primer and the downstream primer respectively comprise BamHI and XhoI enzyme cutting sites. The primer is synthesized by a biological engineering (Shanghai) corporation, a sequence obtained after PCR synthesis is YWHAQ (the sequence is shown as SEQ ID No. 7), then the amplified YWHAQ gene fragment is recovered by glue, and the recovered YWHAQ gene fragment is connected to a pcDNA3.1-N-HA vector (Nanjing Kingsry company product) by utilizing a seamless cloning technology to construct a eukaryotic expression pcDNA3.1-14-3-3Tau-HA recombinant plasmid (abbreviated as HA-14-3-3 plasmid). And after the construction is finished, carrying out sequencing identification on the plasmid and greatly extracting the plasmid.

(7) Construction of prokaryotic-related plasmids

The eukaryotic expression GST-HIP-55 plasmid containing the HIP-55 gene is used as a template, pET-28a (+) (product of Nanjing Kingsry company) is used as a vector, and a prokaryotic expression pET-28a (+) -HIP-55-His plasmid is constructed by utilizing a seamless cloning technology.

The eukaryotic expression GST-HIP-55-S269A plasmid containing the HIP-55 gene is used as a template, pET-28a (+) is used as a vector, and a prokaryotic expression pET-28a (+) -HIP-55-S269A-His plasmid is constructed by using a seamless cloning technology.

The eukaryotic expression GST-HIP-55-T291A plasmid containing the HIP-55 gene is used as a template, pET-28a (+) is used as a vector, and a prokaryotic expression pET-28a (+) -HIP-55-T291A-His plasmid is constructed by utilizing a seamless cloning technology.

The eukaryotic expression GST-HIP-55-AA plasmid containing the HIP-55 gene is used as a template, pET-28a (+) is used as a vector, and a prokaryotic expression pET-28a (+) -HIP-55-AA-His plasmid is constructed by utilizing a seamless cloning technology.

The specific operation steps are as follows:

1) the pET-28a (+) vector was linearized. The pET-28a (+) vector was linearized by the NdeI and XhoI double digestion method (see Table 13 for the linearized system), digested in a water bath at 37 ℃ for 1 hour, and then incubated in a water bath at 65 ℃ for 20 minutes for heat inactivation.

TABLE 13 linearized pET-28a (+) vector System

Name (R)	Dosage of
		Carrier	lμg
10x NEBuffer 2.1(NEB Corp.)	5μ1
		NdeI	1.5μl
Xhol	1.5μl
		ddH 2 O	Trim to a total of 50ul

2) The linearized pET-28a (+) vector described above was recovered by gel, the procedure of which was described in the gel recovery kit.

3) Respectively taking the four constructed eukaryotic GST-HIP-55 plasmids as templates, carrying out PCR amplification by using a common upstream primer HIP-55-His-F and a common downstream primer HIP-55-His-R (the sequences are shown in Table 9), and respectively recovering four PCR products; and then carrying out seamless cloning recombination connection on the four recovered PCR product fragments and the linearized pET-28a (+) vector, carrying out DH5 alpha competent cell transformation and plasmid sequencing identification and carrying out plasmid big extraction to obtain prokaryotic expression pET-28a (+) -HIP-55-His (abbreviated as HIP-55-His), pET-28a (+) -HIP-55-S269A-His (abbreviated as HIP-55-269S 269A-His), pET-28a (+) -HIP-55-T291A-His (abbreviated as HIP-55-T291A-His) and pET-28a (+) -HIP-55-AA-His (abbreviated as HIP-55-AA-His).

17. Protein expression and purification

(1) BL21 competent cell transformation

The operation steps are as follows: 50 μ l of BL21 competent cells (gold whole, CD601-02) +1 μ l of plasmid (100ng) → ice bath 30min → 42 ℃ incubation for 90 sec → rapid transfer to ice for 3min → addition of non-resistant LB medium 100ul, incubation at 37 ℃ 200rpm for 1 hour → mixing, and then spreading 50 μ l of competent cells on a plate → incubation at 37 ℃ overnight.

(2) Bacterial culture

Single colony colonies were picked from solid agar plates and cultured overnight at 37 ℃ in 200ml LB medium (containing 50. mu.g/ml ampicillin) for 12 hours, 10m of the bacterial suspension 1 was inoculated into 1 liter of LB medium (containing 50. mu.g/ml ampicillin), shaken in a shaker at 37 ℃ until the OD of the bacteria became 0.8 to 1.0 (measured at 600 nm), and then induced overnight at 26 ℃ with 0.3mM IPTG inducer.

(3) Bacterial liquid collection

Transferring the bacterial liquid in the large bottle into a bacterial bottle, centrifuging at 4000rpm for 30min, and after all the bacterial liquid is centrifuged. The cells were resuspended in His buffer (25mM Tris-HCl, pH 7.5, 150mM NaCl).

(4) Bacterial thallus disruption

1) High-pressure crushing: the high pressure breaker was pre-cooled to 4 ℃ in advance, the pressure was set to 1300bar, and the power valve pointer was at position 22. And pouring the bacterial thallus suspended by the His buffer in the step into a sample inlet of a high-pressure crusher. Crushing for 3 times under high pressure until the bacteria do not have the phenomenon of wiredrawing. (crushing to work on ice)

2) High-speed centrifugation: the disrupted bacteria were transferred to a high-speed centrifuge tube and centrifuged at 12000rpm at 4 ℃ for 50 min. The supernatant was retained and used for the next His beads binding.

(5)His beads binding

1) The beads were added in a proportion of 1ml of beads capable of binding 10mg of protein.

2) The beads were washed once with 5 volumes of deionized water. (ethanol for removing preservation beads)

3) The beads were washed once more with 5 volumes of His buffer.

4) beads binding: taking the supernatant after high-speed centrifugation to combine with His beads, and vertically rotating and uniformly mixing in a chromatography cabinet at 4 ℃ for 2 hours.

(6)His beads Wash

1) After binding of proteins to beads for 2 hours, the supernatant after binding to beads was centrifuged at low speed at 800rpm for 5 min.

2) Transferring the centrifuged beads to a chromatographic column, performing Wash by using His buffer, and performing reaction according to the following steps of 1: wash was performed 3 times at a ratio of 200.

(7) Protein elution

1) 10ml of 1M imidazole was prepared, and dissolved in His buffer, followed by adjustment of pH to 8.0.

2) The prepared imidazole stock was diluted with His buffer to 20mM, 50mM, 100mM, 200mM, 300mM, respectively.

3) Gradient Elution, namely sequentially adding the prepared imidazole into a chromatographic column containing His beads, uniformly mixing for 5min by using a vertical mixing instrument, collecting the eluted liquid, respectively marking as Elution l, 2, 3, 4 and 5, respectively taking 10 mu l of sample for electrophoresis detection, and finally taking the eluted His beads sample for detection.

4) SDS-PAGE electrophoresis, Coomassie blue staining to detect the expression amount and purity of the protein.

(8) Protein concentration

The eluted protein supernatant was transferred to a concentration column (Millipore) and concentrated by centrifugation at 4000rpm at 4 ℃.

During concentration, HN buffer was exchanged (20mM Hepes pH 7.5, 100mM NaCl, 1mM DTT) in order to remove either imidazole or glutathione. The protein is typically concentrated to about lmg/ml to 10 mg/ml. And taking a proper amount of the concentrated protein sample, and detecting the concentration of the concentrated protein by electrophoresis. Mixing the rest protein samples, subpackaging in clean EP tube, adding 15% glycerol, rapidly freezing in liquid nitrogen, and storing in-80 deg.C refrigerator.

18. In vitro phosphorylation experiments

Recombinant purified 100ng of His-HIP-55 or His-HIP-55S 269A or His-HIP-55T 291A or His-HIP-55AA protein (prepared specifically as described above) was mixed with 20ng of AKT kinase protein (Abcam, ab205801) in a kinase reaction buffer (50mM 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), 5mM magnesium chloride (MgCl. RTM.)) ₂ ) 10mM Dithiothreitol (DTT), 10. mu. Ci [ gamma-32P ]]ATP), 30 ℃ for 15min, and the reaction was stopped with a Loading Buffer in an immunoblot. Protein samples were then electrophoresed on SDS-PAGE gels, followed by autoradiography to detect the level of phosphorylation of the HIP-55 protein.

19. Kinase Activity assay

The kinase activity of HPK1 was determined using ADP-Glo from Promega ^TM The kit detection of Kinase Assay (cat # V6930) is carried out according to the kit instructions. The HPK1 kinase used in the experiment is obtained by enriching 293A cell lysate of over-expression Flag-HPK1 by using a Flag pull down method, and the specific operation is as follows: 293A cells transfected with Flag-HPK1 plasmid were lysed with GST pull down lysate as described previously. The cell lysate was centrifuged at 12000rpm at 4 ℃ for 20min and the supernatant was transferred to a new EP tube. After adding 20. mu.l of anti-Flag M2 affinity gel beads (Sigma Co., cat # A2220), spin-binding at 4 ℃ for 4h, centrifuging at 750rpm to collect the beads, washing the beads 3 times with GST pull down lysate, and removing the supernatant, the beads were loaded with Flag-HPK1 kinase, and the beads containing kinase were subjected to the subsequent kinase activity assay.

20. Commercial antibody

AKT, P-AKT (S473), P-AKT-substrate, GST, JNK, phosphorylated JNK (T182/Y185), GAPDH antibody was purchased from cell signaling technology, lnc. HIP-55 antibodies were purchased from proteintech groups. Flag antibodies were purchased from sigma. The 14-3-3 antibody was purchased from Santa Cruz Biotechnology.

21. Data processing

The metrology data for the above experimental results are expressed as mean + -SEM. Data statistics were analyzed using Prism 5.0 software. Pairwise comparisons between groups were performed by t-test on independent samples, and P <0.05 was considered statistically different.

Second, results and analysis

1. The HIP-55 protein phosphorylation antibody has good sensitivity and specificity

Dot blot assay (Dot blot) detects the binding titer of antibody and antigen, as shown in a in fig. 2, S269 phosphorylated antibody of HIP-55 can recognize the corresponding modified peptide but not the phosphate-free control peptide, and the antibody titer is greater than >1: 200000. As shown in fig. 2B, the T291 phosphorylated antibody of HIP-55 was able to recognize the corresponding modified peptide but not the phosphate-free control peptide and the antibody titer was >1: 200000.

We also used the prepared S269 site and T291 site-specific phosphorylated antibodies of HIP-55 to demonstrate that HIP-55 is a novel substrate for AKT, and that S269 site and T291 site are the corresponding substrate sites of HIP-55. As shown in A in FIG. 3, the phosphorylation of the HIP-55S269 site can be recognized by using the prepared phosphorylated antibody of HIP-55S269, while the phosphorylated antibody of HIP-55S269 cannot recognize the HIP-55S 269A, confirming the sensitivity and specificity of the phosphorylated antibody of HIP-55S 269. As shown in B in FIG. 3, the prepared HIP-55T 291 phosphorylation antibody can identify the phosphorylation of the HIP-55T 291 site, and the HIP-55T 291 phosphorylation antibody cannot identify the HIP-55T 291A, so that the sensitivity and specificity of the HIP-55T 291 phosphorylation antibody are confirmed. Further, we found that neither the HIP-55S269 nor the T291 phosphorylated antibody could recognize HIP-55S 269A/T291A (as shown by C in FIG. 3), further confirming the specificity of the HIP-55S269 and T291 phosphorylated antibodies. Epidermal Growth Factor (EGF) phosphorylates the HIP-55S269 and T291 sites. GST-HIP-55 plasmid or GST-HIP-55-AA plasmid was transfected into 293A cells as shown in D in FIG. 3. After EGF stimulation is given, the HIP-55 phosphorylation level can be correctly identified by using the HIP-55S269 phosphorylation antibody and the HIP-55T 291 phosphorylation antibody respectively, and GST-HIP-55-AA cannot be identified by the HIP-55S269 phosphorylation antibody and the HIP-55T 291 phosphorylation antibody (S269A/T291A), so that the sensitivity and the specificity of the prepared HIP-55S269 phosphorylation antibody and the HIP-55T 291 phosphorylation antibody are shown.

2. Significant upregulation of HIP-55 in Heart tissue of myocardial infarction model mice

Detecting the expression of the HIP-55 in heart tissues of a mouse in a myocardial infarction model. The results show that: as shown in a in fig. 4, the mRNA expression level of HIP-55 was significantly up-regulated in heart tissue of the myocardial infarction model mouse; as shown in B in FIG. 4, the protein expression level of HIP-55 was significantly up-regulated in heart tissue of a myocardial infarction model mouse.

3. HIP-55 knockout results in aggravation of myocardial infarction injury

The effect of HIP-55 knockout on myocardial infarction injury was examined. The results show that: in FIG. 5A is evidence for genotyping HIP-55 whole-body knockdown mice. In FIG. 5B is evidence of the protein level of HIP-55 in whole body knockdown mice. As shown in C in FIG. 5, TTC staining showed that HIP-55 knockdown resulted in increased myocardial infarction area in mice. As shown in D in FIG. 5, TUNEL staining showed that HIP-55 knockdown resulted in increased cardiomyocyte apoptosis upon myocardial infarction. As shown in FIG. 5E, the HIP-55 knockout resulted in an increase in the post myocardial infarction cardiac-tibial ratio, confirming that the HIP-55 knockout resulted in an increase in cardiac remodeling following myocardial infarction. As shown by F-heart ultrasound in FIG. 5, HIP-55 knockouts can lead to poor cardiac function following myocardial infarction.

4. Heart-specific HIP-55 overexpression results in reduced myocardial infarction injury

The effect of heart-specific HIP-55 overexpression on myocardial infarction injury was examined. The results show that: FIG. 6A shows evidence for genotyping heart-specific HIP-55 overexpressing mice. FIG. 6B shows evidence of the protein level of heart-specific HIP-55 overexpressing mice. TTC staining, shown as C in fig. 6, showed that heart-specific HIP-55 overexpression resulted in a reduction in myocardial infarct size in mice. As shown in fig. 6D, TUNEL staining showed that heart-specific HIP-55 overexpression resulted in decreased cardiomyocyte apoptosis in myocardial infarction. As shown in E in FIG. 6, heart-specific HIP-55 overexpression results in a reduction in the post-myocardial infarction cardiac-tibial ratio, confirming that heart-specific HIP-55 overexpression improves cardiac remodeling after myocardial infarction. Cardiac specific HIP-55 overexpression resulted in improved cardiac function after myocardial infarction, as shown by F cardiac ultrasound in figure 6.

5. HIP-55 inhibits HPK1/JNK pathway activity

And (3) detecting the effect of the HIP-55 on the activity of the HPK1/JNK pathway. First, the present inventionIt was confirmed that HIP-55 was able to interact with HPK 1. As shown in A in FIG. 7, simultaneous transfection of Flag-HPK1 and GST or GST-HIP-55 plasmid in 293A cells Using the GST pull down method, GST-HIP-55 protein was found to be able to interact with HPK1, while GST protein as a control was not able to interact with HPK1, indicating that HIP-55 was able to interact with HPK 1. After overexpression of the Flag-HPK1 plasmid, or both Flag-HPK1 and GST-HIP-55 plasmid in 293A cells, the Flag-HPK1 protein was enriched with Flag beads as shown in FIG. 7B. ADP-Glo from Promega was used ^TM And detecting the activity of the enriched Flag-HPK1 by using a Kinase Assay Kinase activity detection kit. The results show that HIP-55 can inhibit HPK1 activity. HPK1 promotes apoptosis primarily through downstream JNK kinase activation, and therefore the present invention is intended to continue to verify whether HIP-55 is also able to inhibit HPK1 downstream JNK kinase activity. According to the invention, firstly 293A cells for stably knocking down HIP-55 (see below) are constructed, the knocking-down efficiency is shown as C in figure 7, and the expression level of the HIP-55 in the 293A cells for stably knocking down HIP-55 is obviously reduced. Furthermore, the invention utilizes the serum-free starvation 293A cell to simulate the heart stem without blood perfusion state of the heart, the serum-free can induce JNK activation, and when the expression of HIP-55 is reduced, the starvation-induced JNK activation is obviously increased (D in figure 7); whereas starvation-induced JNK activation was significantly reduced when the GST-HIP-55 plasmid was overexpressed (E in FIG. 7), indicating that HIP-55 was able to inhibit serum-free induced JNK kinase activity. The invention also finds that JNK is obviously activated during myocardial infarction, and the activation of the JNK can be obviously further increased by HIP-55 knockout (F in figure 7); while cardiac specific HIP-55 overexpression can remarkably inhibit JNK activation during myocardial infarction (G in figure 7), which indicates that HIP-55 can inhibit cardiac JNK activation during myocardial infarction.

The construction method of the 293A cell for stably knocking down HIP-55 is as follows:

construction of recombinant vector pSilencer5.1-siRNA for RNA interference HIP-55: synthesizing a DNA molecule for coding HIP-55siRNA, wherein the nucleotide sequence of the DNA molecule is shown as follows; 5'-GATCCGCAGTGAACGTAGAGAATTGTTCAAGAGACAATTCTCTACGTTCACTGTTTTTTGGAAA-3', respectively; is formed by annealing two single-stranded DNAs, wherein the nucleotide sequence of one single-stranded DNA is F:5'-GATCCGCAGTGAACGTAGAGAATTGTTCAAGAGACAATTCTCTACGTTCACTGTT TTTTGGAAA-3', and the nucleotide sequence of the other single-stranded DNA is R:5'-AGCTTTTCCAAAAAACAGTGAACGTAGAGAATTGTCTCTTGAA CAATTCTCTACGTTCACTGCG-3'.

The RNA interference vector pSilencer5.1-siRNA is a vector for expressing HIP-55siRNA, which is obtained by inserting a DNA molecule coding the HIP-55siRNA into a position between BamHI and HindIII enzyme cutting sites of a vector pSilencer5.1(Invitrogen, AM 5782).

HIP-55siRNA：5’-gauccgcagu gaacguagag aauuguucaa gagacaauuc ucuacguuca cuguuuuuuggaaa-3’。

Control RNA interference vector pSilencer5.1-Scramble: in order to insert the DNA molecule encoding the Scramble siRNA between the BamHI and HindIII sites of the pSilencerr5.1 vector, a vector for expressing the Scramble siRNA was obtained.

Scramble siRNA：5’-gauccgcacu accgguugua uagguguuca agagacaccu auacaaaggu aguguuuugg aaa-3’。

Construction of HEK293A cell line stably knockdown HIP-55 and control HEK293A cells: the RNA interference vector pSilencer5.1-siRNA and the RNA control interference vector pSilencer5.1-Scramble obtained above were transfected into HEK293A cells by liposome method, and puromycin (puromycin, 1.25. mu.g/ml) was selected to select virus infection positive cell clones, thereby obtaining HEK293A/pSilencer5.1-siRNA and HEK293A/pSilencer5.1-Scramble cell lines.

6. HIP-55 inhibits the HPK1/JNK pathway by forming a complex with 14-3-3tau

Further we found that HIP-55 is able to form a complex with 14-3-3tau protein and we identified the binding sites for HIP-55 to 14-3-3tau protein as the S269 and T291 sites of HIP-55. As shown in A in FIG. 8, HA-14-3-3 plasmid was transfected simultaneously with GST-HIP-55 plasmid or GST-HIP-55-AA plasmid in 293A cells, and then it was confirmed that 14-3-3tau could bind to GST-HIP-55 but not to GST-HIP-55-AA using GST pull down method. Previous studies have shown that 14-3-3tau protein plays an important role in cardiomyocyte survival, so we guess whether HIP-55 plays a role in protecting cardiomyocytes by binding to 14-3-3tau protein. When the Flag-HPK1 plasmid is over-expressed in 293A cells, or both the Flag-HPK1 and GST-HIP-55 plasmids are over-expressed, or both the Flag-HPK1 and GST-HIP-55-AA plasmid, and Flag-HPK1 protein was enriched with Flag beads. ADP-Glo from Promega was used ^TM And detecting the activity of the enriched Flag-HPK1 by using a Kinase Assay Kinase activity detection kit. As shown in the B result in FIG. 8, HIP-55WT can inhibit HPK1 activity, while HIP-55AA cannot inhibit HPK1 activity, indicating that HIP-55 inhibits HPK1 kinase activity depending on the formation of a complex between HIP-55 and 14-3-3 tau. Meanwhile, as shown in fig. 8C, JNK activation was induced using serum-free starved 293A cells, and when HIP-55 expression was reduced, starvation-induced JNK activation was significantly increased; and when HIP-55WT is overexpressed, starvation-induced JNK activation is significantly attenuated; and when the HIP-55AA is over-expressed, the starvation-induced JNK activation is not changed, which indicates that the inhibition of the serum-free induced JNK kinase activity by the HIP-55 is dependent on the formation of a complex between the HIP-55 and 14-3-3 tau.

7. AKT phosphorylation of HIP-55 controls HIP-55/14-3-3tau complex formation

In most cases, AKT phosphorylates its substrate protein, and the phosphorylated substrate protein is capable of binding to 14-3-3 protein. We therefore hypothesized whether AKT controls the formation of a complex between HIP-55 and 14-3-3 tau. We first demonstrated that HIP-55 was able to interact with AKT, as shown in FIG. 9A, in 293A cells, transfected with GST or GST-HIP-55 plasmids. Using the GST pull down method, it was found that the GST-HIP-55 protein is able to interact with AKT, while the GST protein as a control is not able to interact with AKT, indicating that HIP-55 is able to interact with AKT. Further, we confirmed that HIP-55 is a substrate of AKT and the S269 and T291 sites of HIP-55 are phosphorylated by AKT, as shown in B in FIG. 9, HIP-55WT recombinant purified protein, or HIP-55-S269A (phosphorylation cannot occur after mutation of S269 site to A), or HIP-55-T291A (phosphorylation cannot occur after mutation of T291 site to A), or HIP-55-AA (phosphorylation cannot occur at both sites after mutation of S269A/T291A, S269 and T291 site to A) respectively is active and mixed with recombinant AKT kinase protein, and experiments with classical radio-kinase confirm that HIP-55 can be phosphorylated by AKT, indicating that HIP-55 is a substrate of AKT. While HIP-55-S269A, HIP-55-T291A and HIP-55-AA (S269A/T291A) were not phosphorylated by AKT, confirming that S269 and T291 of HIP-55 are sites phosphorylated by AKT. And we further confirmed in vivo that HIP-55 is a substrate for AKT at the S269 and T291 sites of HIP-55 (C in FIG. 9). As shown in D in FIG. 9, the phosphorylation level of HIP-55 was measured using EGF (known to activate AKT kinase) stimulation after transfection of GST-HIP-55 plasmid in cells, or after pretreatment with AKT inhibitor MK2206 before EGF stimulation, EGF stimulation was given to measure the phosphorylation level of HIP-55. As shown, EGF is capable of increasing phosphorylation of GST-HIP-55 (which antibody, when recognized by a p-AKT-sub antibody, gives specific recognition of the phosphorylation level of the AKT substrate protein), whereas EGF stimulation is not capable of increasing phosphorylation of HIP-55 after MK2206 administration, indicating that AKT is capable of phosphorylating HIP-55 intracellularly and EGF increases phosphorylation of HIP-55 by AKT kinase. Further, as shown in E in FIG. 9, GST-HIP-55 plasmid or GST-HIP-55-AA plasmid was simultaneously transfected in the cells, GST-HIP-55WT or GST-HIP-55-AA (S269A/T291A) protein was purified using GST pull down method, and phosphorylation level of HIP-55 was detected using p-AKT-sub antibody. When given an EGF stimulus known to activate AKT kinase, the phosphorylation levels of GST-HIP-55-WT (recognized by the p-AKT-sub antibody), while GST-HIP-55-AA is not recognized at all by the specific AKT substrate p-AKT-sub antibody, indicating that AKT phosphorylates the S269 and T291 sites of HIP-55, and EGF stimulation is able to increase the phosphorylation levels of the S269 and T291 sites of HIP-55.

8. The AKT/HIP-55/HPK1 signaling pathway is essential for protection against myocardial infarction

FIG. 10, panel A, is evidence for genotyping heart-specific HIP-55-AA overexpressing mice. FIG. 10B shows evidence of protein levels in heart-specific HIP-55-AA overexpressing mice. As shown in FIG. 10 at C, cardiac-specific overexpression of HIP-55-AA was unable to inhibit JNK kinase activation at myocardial infarction compared to cardiac-specific overexpression of HIP-55 WT. TTC staining showed that heart-specific HIP-55-AA overexpression was not able to inhibit the reduction in myocardial infarct size in mice compared to heart-specific overexpression of HIP-55WT, shown as D in FIG. 10. As shown in E in FIG. 10, TUNEL staining showed that cardiac-specific HIP-55-AA overexpression was not able to inhibit decreased cardiomyocyte apoptosis in myocardial infarction, as compared to cardiac-specific overexpression of HIP-55 WT. FIG. 10F shows that cardiac-specific HIP-55-AA overexpression was not able to improve cardiac remodeling after myocardial infarction, as evidenced by the reduction in the post-myocardial infarction cardiac-tibial ratio when compared to cardiac-specific HIP-55WT overexpression. Cardiac ultrasound G in FIG. 10 shows that cardiac-specific HIP-55-AA overexpression does not improve cardiac function after myocardial infarction compared to cardiac-specific overexpression of HIP-55 WT.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> third Hospital of Beijing university (third clinical medical college of Beijing university)

Preparation method and application of phosphorylated antibody product of <120> AKT new substrate HIP-55

<130> GNCLN202183

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 9

<212> PRT

<213> Artificial sequence

<400> 1

Lys Glu Arg Ala Met Ser Thr Thr Ser

1 5

<210> 2

<211> 10

<212> PRT

<213> Artificial sequence

<400> 2

Phe Leu Gln Lys Gln Leu Thr Gln Pro Glu

1 5 10

<210> 3

<211> 430

<212> PRT

<213> Homo sapiens

<400> 3

Met Ala Ala Asn Leu Ser Arg Asn Gly Pro Ala Leu Gln Glu Ala Tyr

1 5 10 15

Val Arg Val Val Thr Glu Lys Ser Pro Thr Asp Trp Ala Leu Phe Thr

20 25 30

Tyr Glu Gly Asn Ser Asn Asp Ile Arg Val Ala Gly Thr Gly Glu Gly

35 40 45

Gly Leu Glu Glu Met Val Glu Glu Leu Asn Ser Gly Lys Val Met Tyr

50 55 60

Ala Phe Cys Arg Val Lys Asp Pro Asn Ser Gly Leu Pro Lys Phe Val

65 70 75 80

Leu Ile Asn Trp Thr Gly Glu Gly Val Asn Asp Val Arg Lys Gly Ala

85 90 95

Cys Ala Ser His Val Ser Thr Met Ala Ser Phe Leu Lys Gly Ala His

100 105 110

Val Thr Ile Asn Ala Arg Ala Glu Glu Asp Val Glu Pro Glu Cys Ile

115 120 125

Met Glu Lys Val Ala Lys Ala Ser Gly Ala Asn Tyr Ser Phe His Lys

130 135 140

Glu Ser Gly Arg Phe Gln Asp Val Gly Pro Gln Ala Pro Val Gly Ser

145 150 155 160

Val Tyr Gln Lys Thr Asn Ala Val Ser Glu Ile Lys Arg Val Gly Lys

165 170 175

Asp Ser Phe Trp Ala Lys Ala Glu Lys Glu Glu Glu Asn Arg Arg Leu

180 185 190

Glu Glu Lys Arg Arg Ala Glu Glu Ala Gln Arg Gln Leu Glu Gln Glu

195 200 205

Arg Arg Glu Arg Glu Leu Arg Glu Ala Ala Arg Arg Glu Gln Arg Tyr

210 215 220

Gln Glu Gln Gly Gly Glu Ala Ser Pro Gln Arg Thr Trp Glu Gln Gln

225 230 235 240

Gln Glu Val Val Ser Arg Asn Arg Asn Glu Gln Glu Ser Ala Val His

245 250 255

Pro Arg Glu Ile Phe Lys Gln Lys Glu Arg Ala Met Ser Thr Thr Ser

260 265 270

Ile Ser Ser Pro Gln Pro Gly Lys Leu Arg Ser Pro Phe Leu Gln Lys

275 280 285

Gln Leu Thr Gln Pro Glu Thr His Phe Gly Arg Glu Pro Ala Ala Ala

290 295 300

Ile Ser Arg Pro Arg Ala Asp Leu Pro Ala Glu Glu Pro Ala Pro Ser

305 310 315 320

Thr Pro Pro Cys Leu Val Gln Ala Glu Glu Glu Ala Val Tyr Glu Glu

325 330 335

Pro Pro Glu Gln Glu Thr Phe Tyr Glu Gln Pro Pro Leu Val Gln Gln

340 345 350

Gln Gly Ala Gly Ser Glu His Ile Asp His His Ile Gln Gly Gln Gly

355 360 365

Leu Ser Gly Gln Gly Leu Cys Ala Arg Ala Leu Tyr Asp Tyr Gln Ala

370 375 380

Ala Asp Asp Thr Glu Ile Ser Phe Asp Pro Glu Asn Leu Ile Thr Gly

385 390 395 400

Ile Glu Val Ile Asp Glu Gly Trp Trp Arg Gly Tyr Gly Pro Asp Gly

405 410 415

His Phe Gly Met Phe Pro Ala Asn Tyr Val Glu Leu Ile Glu

420 425 430

<210> 4

<211> 1290

<212> DNA

<213> Homo sapiens

<400> 4

atggcggcga acctgagccg gaacgggcca gcgctgcaag aggcctacgt gcgggtggtc 60

accgagaagt ccccgaccga ctgggctctc tttacctatg aaggcaacag caatgacatc 120

cgcgtggctg gcacagggga gggtggcctg gaggagatgg tggaggagct caacagcggg 180

aaggtgatgt acgccttctg cagagtgaag gaccccaact ctggactgcc caaatttgtc 240

ctcatcaact ggacaggcga gggcgtgaac gatgtgcgga agggagcctg tgccagccac 300

gtcagcacca tggccagctt cctgaagggg gcccatgtga ccatcaacgc acgggccgag 360

gaggatgtgg agcctgagtg catcatggag aaggtggcca aggcttcagg tgccaactac 420

agctttcaca aggagagtgg ccgcttccag gacgtgggac cccaggcccc agtgggctct 480

gtgtaccaga agaccaatgc cgtgtctgag attaaaaggg ttggtaaaga cagcttctgg 540

gccaaagcag agaaggagga ggagaaccgt cggctggagg aaaagcggcg ggccgaggag 600

gcacagcggc agctggagca ggagcgccgg gagcgtgagc tgcgtgaggc tgcacgccgg 660

gagcagcgct atcaggagca gggtggcgag gccagccccc agaggacgtg ggagcagcag 720

caagaagtgg tttcaaggaa ccgaaatgag caggagtctg ccgtgcaccc gagggagatt 780

ttcaagcaga aggagagggc catgtccacc acctccatct ccagtcctca gcctggcaag 840

ctgaggagcc ccttcctgca gaagcagctc acccaaccag agacccactt tggcagagag 900

ccagctgctg ccatctcaag gcccagggca gatctccctg ctgaggagcc ggcgcccagc 960

actcctccat gtctggtgca ggcagaagag gaggctgtgt atgaggaacc tccagagcag 1020

gagaccttct acgagcagcc cccactggtg cagcagcaag gtgctggctc tgagcacatt 1080

gaccaccaca ttcagggcca ggggctcagt gggcaagggc tctgtgcccg tgccctgtac 1140

gactaccagg cagccgacga cacagagatc tcctttgacc ccgagaacct catcacgggc 1200

atcgaggtga tcgacgaagg ctggtggcgt ggctatgggc cggatggcca ttttggcatg 1260

ttccctgcca actacgtgga gctcattgag 1290

<210> 5

<211> 11257

<212> DNA

<213> Artificial sequence

<400> 5

ggtaccgagc tcttacgcgt gctagcatca actttgtata gaaaagttgg gatcctgcaa 60

ggtcacacaa gggtctccac ccaccaggtg ccctagtctc aatttcagtt tccatgcctt 120

gttctcacaa tgctggcctc cccagagcta atttggactt tgtttttatt tcaaaagggc 180

ctgaatgagg agtagatctt gtgctaccca gctctaaggg tgcccgtgaa gccctcagac 240

ctggagcctt tgcaacagcc ctttaggtgg aagcagaata aagcaatttt ccttaaagcc 300

aaaatcctgc ctctagactc ttcttctctg acctcggtcc ctgggctcta gggtggggag 360

gtggggcttg gaagaagaag gtggggaagt ggcaaaagcc gatccctagg gccctgtgaa 420

gttcggagcc ttccctgtac agcactggct catagatcct cctccagcca aacatagcaa 480

gaagtgatac ctcctttgtg acttccccag gcccagtacc tgtcaggttg aaacaggatt 540

tagagaagcc tctgaactca cctgaactct gaagctcatc caccaagcaa gcacctaggt 600

gccactgcta gttagtatcc tacgctgata atatgcagag ctgggccaca gaagtcctgg 660

ggtgtaggaa ctgaccagtg acttttcagt cggcaaaggt atgaccccct cagcagatgt 720

agtaatgtcc ccttagatcc catcccaggc aggtctctaa gaggacatgg gatgagagat 780

gtagtcatgt ggcattccaa acacagctat ccacagtgtc ccttgcccct tccacttagc 840

caggaggaca gtaaccttag cctatctttc ttcctcccca tcctcccagg acacaccccc 900

tggtctgcag tattcatttc ttccttcacg tcccctctgt gacttccatt tgcaaggctt 960

ttgacctctg cagctgctgg aagatagagt ttggccctag gtgtggcaag ccatctcaag 1020

agaaagcaga caacaggggg accagatttt ggaaggatca ggaactaaat cactggcggg 1080

cctgggggta gaaaaaagag tgagtgagtc cgctccagct aagccaagct agtccccgag 1140

atactctgcc acagctgggc tgctcggggt agctttagga atgtgggtct gaaagacaat 1200

gggattggaa gacatctctt tgagtctccc ctcaacccca cctacagaca cactcgtgtg 1260

tggccagact cctgttcaac agccctctgt gttctgacca ctgagctagg caaccagagc 1320

atgggccctg tgctgaggat gaagagttgg ttaccaatag caaaaacagc aggggaggga 1380

gaacagagaa cgaaataagg aaggaagaag gaaaggccag tcaatcagat gcagtcagaa 1440

gagatgggaa gccaacacac agcttgagca gaggaaacag aaaagggaga gattctgggc 1500

ataaggaggc cacagaaaga agagcccagg ccccccaagt ctcctcttta taccctcatc 1560

ccgtctccca attaagccca ctcttcttcc tagatcagac ctgagctgca gcgaagagac 1620

ccgtagggag gatcacactg gatgaaggag atgtgtggag aagtccaggg caacctaaga 1680

gccagagcct aaaagagcaa gagataaagg tgcttcaaag gtggccaggc tgtgcacaca 1740

gagggtcgag gactggtggt agagcctcaa gataaggatg atgctcagaa tgggcggggg 1800

gggggattct ggggggggga gagagaaggt gagaaggagc ctggaacaga gaatctggaa 1860

gcgctggaaa cgataccata aagggaagaa cccaggctac ctttagatgt aaatcatgaa 1920

agacagggag aagggaagct ggagagagta gaaggacccc ggggcaagac atggaagcaa 1980

ggacaagcca ggttgagcgc tccgtgaaat cagcctgctg aaggcagagc cctggtatga 2040

gcaccagaac agcagaggct agggttaatg tcgagacagg gaacagaagg tagacacagg 2100

aacagacaga gacgggggag ccaggtaaca aaggaatggt ccttctcacc tgtggccaga 2160

gcgtccatct gtgtccacat actctagaat gttcatcaga ctgcagggct ggcttgggag 2220

gcagctggaa agagtatgtg agagccaggg gagacaaggg ggcctaggaa aggaagaaga 2280

gggcaaacca ggccacacaa gagggcagag cccagaactg agttaactcc ttccttgttg 2340

catcttccat aggaggcagt gggaactctg tgaccaccat cccccatgag cccccactac 2400

ccataccaag tttggcctga gtggcattct aggttccctg aggacagagc ctggcctttg 2460

tctcttggac ctgacccaag ctgacccaat gttctcagta ccttatcatg ccctcaagag 2520

cttgagaacc aggcagtgac atattaggcc atgggctaac cctggagctt gcacacagga 2580

gcctcaagtg acctccaggg acacagctgc agacaggtgg cctttatccc caaagagcaa 2640

ccatttggca taggtggctg caaatgggaa tgcaaggttg aatcaggtcc cttcaagaat 2700

actgcatgca agacctaaga cccctggaga gaggggtatg ctcctgcccc cacccaccat 2760

aaggggagtg aactatccta gggggctggc gaccttgggg agacaccaca ttactgagag 2820

tgctgagccc agaaaaactg accgccctgt gtcctgccca cctccacact ctagagctat 2880

attgagaggt gacagtagat agggtgggag ctggtagcag ggagagtgtt cctgggtgtg 2940

agggtgtagg ggaaagccag agcaggggag tctggctttg tctcctgaac acaatgtcta 3000

cttagttata acaggcatga cctgctaaag acccaacatc tacgacctct gaaaagacag 3060

cagccctgga ggacaggggt tgtctctgag ccttgggtgc ttgatggtgc cacaaaggag 3120

ggcatgagtg tgagtataag gccccaggag cgttagagaa gggcacttgg gaaggggtca 3180

gtctgcagag cccctatcca tggaatctgg agcctggggc caactggtgt aaatctctgg 3240

gcctgccagg cattcaaagc agcacctgca tcctctggca gcctggggag gcggaaggga 3300

gcaacccccc acttataccc tttctccctc agccccagga ttaacacctc tggccttccc 3360

ccttcccacc tcccatcagg agtggagggt tgcagaggga gggtaaaaac ctacatgtcc 3420

aaacatcatg gtgcacgata tatggatcag tatgtgtaga ggcaagaaag gaaatctgca 3480

ggcttaactg ggttaatgtg taaagtctgt gtgcatgtgt gtgtgtctga ctgaaaacgg 3540

gcatggctgt gcagctgttc agttctgtgc gtgaggttac cagactgcag gtttgtgtgt 3600

aaattgccca aggcaaagtg ggtgaatccc ttccatggtt taaagagatt ggatgatggc 3660

ctgcatctca aggaccatgg aaaatagaat ggacactcta tatgtgtctc taagctaagg 3720

tagcaaggtc tttggaggac acctgtctag agatgtgggc aacagagact acagacagta 3780

tctgtacaga gtaaggagag agaggagggg gtgtagaatt ctcttactat caaagggaaa 3840

ctgagtcgtg cacctgcaaa gtggatgctc tccctagaca tcatgacttt gtctctgggg 3900

agccagcact gtggaacttc aggtctgaga gagtaggagg ctcccctcag cctgaagcta 3960

tgcagatagc cagggttgaa agggggaagg gagagcctgg gatgggagct tgtgtgttgg 4020

aggcagggga cagatattaa gcctggaaga gaaggtgacc cttacccagt tgttcaactc 4080

acccttcaga ttaaaaataa ctgaggtaag ggcctgggta ggggaggtgg tgtgagacgc 4140

tcctgtctct cctctatctg cccatcggcc ctttggggag gaggaatgtg cccaaggact 4200

aaaaaaaggc catggagcca gaggggcgag ggcaacagac ctttcatggg caaaccttgg 4260

ggccctgctg tcctcctgtc acctccagag ccaagggatc aaaggaggag gagccaggac 4320

aggagggaag tgggagggag ggtcccagca gaggactcca aatttaggca gcaggcatat 4380

gggatgggat ataaaggggc tggagcactg agagctgtca gagatttctc caacccaggt 4440

aagagggagt ttcgggtggg ggctcttcac ccacaccaga cctctcccca cctagaagga 4500

aactgccttt cctggaagtg gggttcaggc cggtcagaga tctgacaggg tggccttcca 4560

ccagcctggg aagttctcag tggcaggagg tttccacaag aaacactgga tgccccttcc 4620

cttacgctgt cttctccatc ttcctcctgg ggatgctcct ccccgtcttg gtttatcttg 4680

gctcttcgtc ttcagcaaga tttgccctgt gctgtccact ccatctttct ctactgtctc 4740

cgtgccttgc cttgccttct tgcgtgtcct tcctttccac ccatttctca cttcaccttt 4800

tctccccttc tcatttgtat tcatccttcc ttccttcctt ccttccttcc ttccttcctt 4860

ccttccttcc tttctccctt ccttccttcc ttccttcctt ccttccttcc ttccttcctg 4920

tgtcagagtg ctgagaatca cacctggggt tcccaccctt atgtaaacaa tcttccagtg 4980

agccacagct tcagtgctgc tgggtgctct cttaccttcc tcaccccctg gcttgtcctg 5040

ttccatcctg gtcaggatct ctagattggt ctcccagcct ctgctactcc tcttcctgcc 5100

tgttcctctc tctgtccagc tgcgccactg tggtgcctcg ttccagctgt ggtccacatt 5160

cttcaggatt ctctgaaaag ttaaccaggt gagaatgttt cccctgtaga cagcagatca 5220

cgattctccc ggaagtcagg cttccagccc tctctttctc tgcccagctg cccggcactc 5280

ttagcaaacc tcaggcaccc ttaccccaca tagacctctg acagagaagc aggcacttta 5340

catggagtcc tggtgggaga gccataggct acggtgtaaa agaggcaggg aagtggtggt 5400

gtaggaaagt caggacttca catagaagcc tagcccacac cagaaatgac agacagatcc 5460

ctcctatctc ccccataaga gtttgagtcg accaagtttg tacaaaaaag caggctgcca 5520

ccatggcggc gaacctgagc cggaacgggc cagcgctgca agaggcctac gtgcgggtgg 5580

tcaccgagaa gtccccgacc gactgggctc tctttaccta tgaaggcaac agcaatgaca 5640

tccgcgtggc tggcacaggg gagggtggcc tggaggagat ggtggaggag ctcaacagcg 5700

ggaaggtgat gtacgccttc tgcagagtga aggaccccaa ctctggactg cccaaatttg 5760

tcctcatcaa ctggacaggc gagggcgtga acgatgtgcg gaagggagcc tgtgccagcc 5820

acgtcagcac catggccagc ttcctgaagg gggcccatgt gaccatcaac gcacgggccg 5880

aggaggatgt ggagcctgag tgcatcatgg agaaggtggc caaggcttca ggtgccaact 5940

acagctttca caaggagagt ggccgcttcc aggacgtggg accccaggcc ccagtgggct 6000

ctgtgtacca gaagaccaat gccgtgtctg agattaaaag ggttggtaaa gacagcttct 6060

gggccaaagc agagaaggag gaggagaacc gtcggctgga ggaaaagcgg cgggccgagg 6120

aggcacagcg gcagctggag caggagcgcc gggagcgtga gctgcgtgag gctgcacgcc 6180

gggagcagcg ctatcaggag cagggtggcg aggccagccc ccagaggacg tgggagcagc 6240

agcaagaagt ggtttcaagg aaccgaaatg agcaggagtc tgccgtgcac ccgagggaga 6300

ttttcaagca gaaggagagg gccatgtcca ccacctccat ctccagtcct cagcctggca 6360

agctgaggag ccccttcctg cagaagcagc tcacccaacc agagacccac tttggcagag 6420

agccagctgc tgccatctca aggcccaggg cagatctccc tgctgaggag ccggcgccca 6480

gcactcctcc atgtctggtg caggcagaag aggaggctgt gtatgaggaa cctccagagc 6540

aggagacctt ctacgagcag cccccactgg tgcagcagca aggtgctggc tctgagcaca 6600

ttgaccacca cattcagggc caggggctca gtgggcaagg gctctgtgcc cgtgccctgt 6660

acgactacca ggcagccgac gacacagaga tctcctttga ccccgagaac ctcatcacgg 6720

gcatcgaggt gatcgacgaa ggctggtggc gtggctatgg gccggatggc cattttggca 6780

tgttccctgc caactacgtg gagctcattg aggactacaa ggacgacgat gacaagtaaa 6840

cccagctttc ttgtacaaag tgggcccctc tccctccccc ccccctaacg ttactggccg 6900

aagccgcttg gaataaggcc ggtgtgcgtt tgtctatatg ttattttcca ccatattgcc 6960

gtcttttggc aatgtgaggg cccggaaacc tggccctgtc ttcttgacga gcattcctag 7020

gggtctttcc cctctcgcca aaggaatgca aggtctgttg aatgtcgtga aggaagcagt 7080

tcctctggaa gcttcttgaa gacaaacaac gtctgtagcg accctttgca ggcagcggaa 7140

ccccccacct ggcgacaggt gcctctgcgg ccaaaagcca cgtgtataag atacacctgc 7200

aaaggcggca caaccccagt gccacgttgt gagttggata gttgtggaaa gagtcaaatg 7260

gctctcctca agcgtattca acaaggggct gaaggatgcc cagaaggtac cccattgtat 7320

gggatctgat ctggggcctc ggtgcacatg ctttacatgt gtttagtcga ggttaaaaaa 7380

acgtctaggc cccccgaacc acggggacgt ggttttcctt tgaaaaacac gatgataata 7440

tggccacaac catggtgagc aagcagatcc tgaagaacac cggcctgcag gagatcatga 7500

gcttcaaggt gaacctggag ggcgtggtga acaaccacgt gttcaccatg gagggctgcg 7560

gcaagggcaa catcctgttc ggcaaccagc tggtgcagat ccgcgtgacc aagggcgccc 7620

ccctgccctt cgccttcgac atcctgagcc ccgccttcca gtacggcaac cgcaccttca 7680

ccaagtaccc cgaggacatc agcgacttct tcatccagag cttccccgcc ggcttcgtgt 7740

acgagcgcac cctgcgctac gaggacggcg gcctggtgga gatccgcagc gacatcaacc 7800

tgatcgagga gatgttcgtg taccgcgtgg agtacaaggg ccgcaacttc cccaacgacg 7860

gccccgtgat gaagaagacc atcaccggcc tgcagcccag cttcgaggtg gtgtacatga 7920

acgacggcgt gctggtgggc caggtgatcc tggtgtaccg cctgaacagc ggcaagttct 7980

acagctgcca catgcgcacc ctgatgaaga gcaagggcgt ggtgaaggac ttccccgagt 8040

accacttcat ccagcaccgc ctggagaaga cctacgtgga ggacggcggc ttcgtggagc 8100

agcacgagac cgccatcgcc cagctgacca gcctgggcaa gcccctgggc agcctgcacg 8160

agtgggtgta acaactttat tatacatagt tgatggccgg ccgcttcgag cagacatgat 8220

aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa aatgctttat 8280

ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt ataagctgca ataaacaagt 8340

taacaacaac aattgcattc attttatgtt tcaggttcag ggggaggtgt gggaggtttt 8400

ttaaagcaag taaaacctct acaaatgtgg taaaatcgat aaggatccgt cgaccgatgc 8460

ccttgagagc cttcaaccca gtcagctcct tccggtgggc gcggggcatg actatcgtcg 8520

ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg gcagcgctct 8580

tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 8640

gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 8700

atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 8760

ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 8820

cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 8880

tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 8940

gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 9000

aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 9060

tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 9120

aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 9180

aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 9240

ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 9300

ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 9360

atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 9420

atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa 9480

tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag 9540

gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg 9600

tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga 9660

gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag 9720

cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa 9780

gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc 9840

atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca 9900

aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg 9960

atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat 10020

aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc 10080

aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg 10140

gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg 10200

gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt 10260

gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca 10320

ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata 10380

ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac 10440

atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa 10500

gtgccacctg acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc 10560

agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc 10620

tttctcgcca cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg 10680

ttccgattta gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca 10740

cgtagtgggc catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc 10800

tttaatagtg gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct 10860

tttgatttat aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa 10920

caaaaattta acgcgaattt taacaaaata ttaacgttta caatttccca ttcgccattc 10980

aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagccc 11040

aagctaccat gataagtaag taatattaag gtacgggagg tacttggagc ggccgcaata 11100

aaatatcttt attttcatta catctgtgtg ttggtttttt gtgtgaatcg atagtactaa 11160

catacgctct ccatcaaaac aaaacgaaac aaaacaaact agcaaaatag gctgtcccca 11220

gtgcaagtgc aggtgccaga acatttctct atcgata 1 1257

<210> 6

<211> 2499

<212> DNA

<213> Homo sapiens

<400> 6

atggacgtcg tggaccctga cattttcaat agagaccccc gggaccacta tgacctgcta 60

cagcggctgg gtggcggcac gtatggggaa gtctttaagg ctcgagacaa ggtgtcaggg 120

gacctggtgg cactgaagat ggtgaagatg gagcctgatg atgatgtctc cacccttcag 180

aaggaaatcc tcatattgaa aacttgccgg cacgccaaca tcgtggccta ccatgggagt 240

tatctctggt tgcagaaact ctggatctgc atggaattct gtggggctgg ttctctccag 300

gacatctacc aagtgacagg ctccctgtca gagctccaga ttagctatgt ctgccgggaa 360

gtgctccagg gactggccta tttgcactca cagaagaaga tacacaggga catcaaggga 420

gctaacatcc tcatcaatga tgctggggag gtcagattgg ctgactttgg catctcggcc 480

cagattgggg ctacactggc cagacgcctc tctttcattg ggacacccta ctggatggct 540

ccggaagtgg cagctgtggc cctgaaggga ggatacaatg agctgtgtga catctggtcc 600

ctgggcatca cggccatcga actggccgag ctacagccac cgctctttga tgtgcaccct 660

ctcagagttc tcttcctcat gaccaagagt ggctaccagc ctccccgact gaaggaaaaa 720

ggcaaatggt cggctgcctt ccacaacttc atcaaagtca ctctgactaa gagtcccaag 780

aaacgaccca gcgccaccaa gatgctcagt catcaactgg tatcccagcc tgggctgaat 840

cgaggcctga tcctggatct tcttgacaaa ctgaagaatc ccgggaaagg accctccatt 900

ggggacattg aggatgagga gcccgagcta ccccctgcta tccctcggcg gatcagatcc 960

acccaccgct ccagctctct ggggatccca gatgcagact gctgtcggcg gcacatggag 1020

ttcaggaagc tccgaggaat ggagaccaga cccccagcca acaccgctcg cctacagcct 1080

cctcgagacc tcaggagcag cagccccagg aagcaactgt cagagtcgtc tgacgatgac 1140

tatgacgacg tggacatccc cacccctgca gaggacacac ctcctccact tccccccaag 1200

cccaagttcc gttctccatc agacgagggt cctgggagca tgggggatga tgggcagctg 1260

agcccggggg tgctggtccg gtgtgccagt gggcccccac caaacagccc ccgtcctggg 1320

cctcccccat ccaccagcag cccccacctc accgcccatt cagaaccctc actctggaac 1380

ccaccctccc gggagcttga caagccccca cttctgcccc ccaagaagga aaagatgaag 1440

agaaagggat gtgcccttct cgtaaagttg ttcaatggct gccccctccg gatccacagc 1500

acggccgcct ggacacatcc ctccaccaag gaccagcacc tgctcctggg ggcagaggaa 1560

ggcatcttca tcctgaaccg gaatgaccag gaggccacgc tggaaatgct ctttcctagc 1620

cggactacgt gggtgtactc catcaacaac gttctcatgt ctctctcagg aaagaccccc 1680

cacctgtatt ctcatagcat ccttggcctg ctggaacgga aagagaccag agcaggaaac 1740

cccatcgctc acattagccc ccaccgccta ctggcaagga agaacatggt ttccaccaag 1800

atccaggaca ccaaaggctg ccgggcgtgc tgtgtggcgg agggtgcgag ctctgggggc 1860

ccgttcctgt gcggtgcatt ggagacgtcc gttgtcctgc ttcagtggta ccagcccatg 1920

aacaaattcc tgcttgtccg gcaggtgctg ttcccactgc cgacgcctct gtccgtgttc 1980

gcgctgctga ccgggccagg ctctgagctg cccgctgtgt gcatcggcgt gagccccggg 2040

cggccgggga agtcggtgct cttccacacg gtgcgctttg gcgcgctctc ttgctggctg 2100

ggcgagatga gcaccgagca caggggaccc gtgcaggtga cccaggtaga ggaagatatg 2160

gtgatggtgt tgatggatgg ctctgtgaag ctggtgaccc cggaggggtc cccagtccgg 2220

ggacttcgca cacctgagat ccccatgacc gaagcggtgg aggccgtggc tatggttgga 2280

ggtcagcttc aggccttctg gaagcatgga gtgcaggtgt gggctctagg ctcggatcag 2340

ctgctacagg agctgagaga ccctaccctc actttccgtc tgcttggctc ccccaggctg 2400

gagtgcagtg gcacgatctc gcctcactgc aacctcctcc tcccaggttc aagcaattct 2460

cctgcctcag cctcccgagt agctgggatt acaggcctg 2499

<210> 7

<211> 735

<212> DNA

<213> Homo sapiens

<400> 7

atggagaaga ctgagctgat ccagaaggcc aagctggccg agcaggccga gcgctacgac 60

gacatggcca cctgcatgaa ggcagtgacc gagcagggcg ccgagctgtc caacgaggag 120

cgcaacctgc tctccgtggc ctacaagaac gtggtcgggg gccgcaggtc cgcctggagg 180

gtcatctcta gcatcgagca gaagaccgac acctccgaca agaagttgca gctgattaag 240

gactatcggg agaaagtgga gtccgagctg agatccatct gcaccacggt gctggaattg 300

ttggataaat atttaatagc caatgcaact aatccagaga gtaaggtctt ctatctgaaa 360

atgaagggtg attacttccg gtaccttgct gaagttgcgt gtggtgatga tcgaaaacaa 420

acgatagata attcccaagg agcttaccaa gaggcatttg atataagcaa gaaagagatg 480

caacccacac acccaatccg cctggggctt gctcttaact tttctgtatt ttactatgag 540

attcttaata acccagagct tgcctgcacg ctggctaaaa cggcttttga tgaggccatt 600

gctgaacttg atacactgaa tgaagactca tacaaagaca gcaccctcat catgcagttg 660

cttagagaca acctaacact ttggacatca gacagtgcag gagaagaatg tgatgcggca 720

gaaggggctg aaaac 735

Claims (1)

1. The application of the phosphorylation antibody of the S269 site and/or the T291 site of the HIP-55 protein in the preparation of products for assisting in diagnosing myocardial infarction;

   the amino acid sequence of the HIP-55 protein is SEQ ID No. 3.

Images