KR102281973B1 - Polycistronic Expression System for Plants - Google Patents

Abstract

Disclosed herein is a polycistronic expression system applicable to plants. The polycistronic expression system according to the present specification makes it possible to integrate several genes into one place in the plant genome, and it is possible to maintain the expression level of several genes at a certain level or more and to control them at once, and the entire plant engineering process It has the advantage of performing more efficiently and reducing time.

Description

Polycistronic Expression System for Plants

Disclosed herein is a polycistronic expression system applicable to plants.

In conventional plant engineering, when transforming several genes, using individual vectors, several of them were injected at once or each several times to prepare a transformed plant.

Therefore, each vector showed a lot of difference in the expression amount depending on which part of the genome was integrated, and because of this, individuals showing desired traits (ie, plant traits that can appear through the expression of several genes) There was a technical limit that required a lot of time and money in the selection process.

Baltes, N. J., J. Gil-Humanes, T. Cermak, P. A. Atkins and D. F. Voytas. 2014. DNA Replicons for Plant Genome Engineering. The Plant Cell 26: 151-163. Liu, Z., O. Chen, J. B. J. Wall, M. Zheng, Y. Zhou, L. Wang, H. Ruth Vaseghi, L. Qian and J. Liu. 2017. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Scientific Reports 7: 2193. Stavolone L et al (2003) Cestrum yellow leaf curling virus (CmYLCV) promoter: a new strong constitutive promoter for heterologous gene expression in a wide variety of crops. Plant Mol Biol 53:703-713. Nagaya S, Kawamura K, Shinmyo A, Kato K (2010) The HSP terminator of Arabidopsis thaliana increases gene expression in plant cells. Plant Cell Physiol 51:328-332.

In one aspect, the present specification aims to provide a polycistronic gene expression system applicable to plant engineering.

In one aspect, the technology disclosed herein provides a backbone vector for preparing a polycistronic expression vector, which consists of a sequence of one of SEQ ID NOs: 2 to 5, and is used to prepare a vector for polycistronic expression for plants. .

In another aspect, the technology disclosed herein uses a backbone vector in which a second restriction enzyme recognition site is inserted into a binary vector, and two overhang sequences at the cleavage site by the second restriction enzyme of the backbone vector is located, the two overhang sequences are located in the forward strand and the reverse strand, respectively, and the following (1) promoter; (2) a nucleotide sequence encoding one or more 2A peptides; (3) two or more target gene modules; And (4) a terminator element is inserted, it provides a vector for polycistronic expression for plants.

(1) a promoter cleaved by a second restriction enzyme and comprising two overhang sequences complementary to an overhang sequence located in the backbone vector and an overhang sequence located in the target gene module after cleavage, respectively;

(2) located between the target gene modules, cleaved by the second restriction enzyme, and comprising two overhang sequences complementary to the overhang sequence located in the target gene module and the overhang sequence located in another target gene module after cleavage , a nucleotide sequence encoding one or more 2A peptides;

(3) between the promoter and the nucleotide sequence encoding the 2A peptide, or between the nucleotide sequence encoding two 2A peptides, or between the nucleotide sequence encoding the 2A peptide and the terminator, and is cleaved by a second restriction enzyme; two overhang sequences complementary to two of the overhang sequence located in the promoter after cleavage, the overhang sequence located in the nucleotide sequence encoding the 2A peptide, and the overhang sequence located in the terminator; two target gene-specific sequences respectively linked to the two complementary overhang sequences; and two or more target gene modules comprising a target gene; and

(4) A terminator cleaved by the second restriction enzyme and comprising two overhang sequences complementary to the overhang sequence located in the backbone vector and the overhang sequence located in the target gene module after cleavage, respectively.

In an exemplary embodiment, the two overhang sequences in the promoter may be complementary to an overhang sequence located on the reverse strand of the backbone vector and an overhang sequence located at the forward 5' end of the first target gene module, respectively.

In an exemplary embodiment, two overhang sequences in the nucleotide sequence encoding the 2A peptide are, respectively, an overhang sequence located at the reverse 5' end of the first gene module of interest and a forward 5' end of the second gene module of interest. It may be complementary to the overhang sequence.

In an exemplary embodiment, the two overhang sequences in the target gene module are complementary to i) an overhang sequence located at the reverse 5' end of the promoter and an overhang sequence located at the forward 5' end of the nucleotide sequence encoding the 2A peptide, respectively or ii) an overhang sequence located at the reverse 5' end of the nucleotide sequence encoding the first 2A peptide and an overhang sequence located at the forward 5' end of the nucleotide sequence encoding the second 2A peptide, respectively, iii) It may be complementary to an overhang sequence located at the reverse 5' end of the nucleotide sequence encoding the 2A peptide, and an overhang sequence located at the forward 5' end of the terminator, respectively.

In an exemplary embodiment, the two overhang sequences in the terminator may be complementary to an overhang sequence located in the forward strand of the backbone vector and an overhang sequence located in the reverse 5' end of the target gene module, respectively.

In an exemplary embodiment, the binary vector may be a pLSLR vector.

In an exemplary embodiment, the backbone vector may have a sequence of one of SEQ ID NOs: 2 to 5.

In an exemplary embodiment, the second restriction enzyme may be BasI.

In an exemplary embodiment, all of the overhang sequences may include 4 bases.

In an exemplary embodiment, the two overhang sequences located in the backbone vector may be 5'-ATAG-3' in the reverse strand and 5'-TAAG-3' in the forward strand.

In an exemplary embodiment, the elements inserted into the vector for polycistronic expression are: a promoter - a first target gene module - a nucleotide sequence encoding the first 2A peptide - a second target gene module - a second 2A peptide It may be inserted in the order of the nucleotide sequence - the third target gene module - the terminator.

In an exemplary embodiment, the promoter may include 5'-CTAT-3' at the 5' end of the forward direction and 5'-GGTT-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the first target gene module may include 5'-AACC-3' at the 5' end of the forward direction and 5'-CCTC-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the first 2A peptide comprises an overhang sequence 5'-GAGG-3' at the 5' end of the forward direction and 5'-AGGG-3' at the 5' end of the reverse direction. it could be

In an exemplary embodiment, the second target gene module may include 5'-CCCT-3' at the 5' end of the forward direction and 5'-TAGC-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the second 2A peptide comprises a 5'-GCTA-3' at the 5' end of the forward direction and a 5'-GGGT-3' overhang sequence at the 5' end of the reverse direction. it could be

In an exemplary embodiment, the third target gene module may include 5'-ACCC-3' at the 5' end of the forward direction and 5'-ATAT-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the terminator may include an overhang sequence of 5'-ATAT-3' at the 5' end of the forward direction and 5'-CTTA-3' at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the first 2A peptide and the nucleotide sequence encoding the second 2A peptide may have the sequences of SEQ ID NOs: 22 and 23, respectively, except for the overhang sequence.

In an exemplary embodiment, the promoter and the terminator may have the sequences of SEQ ID NOs: 24 and 25, respectively, except for the overhang sequence.

In another aspect, the technology disclosed herein comprises a backbone vector having one of SEQ ID NOs: 2-5; a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 6 is inserted; a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 7 is inserted; a cloning vector into which the promoter sequence of SEQ ID NO: 8 is inserted; a cloning vector into which the terminator sequence of SEQ ID NO: 9 is inserted; a first target gene module; a second target gene module; and a third target gene module, wherein the first target gene module comprises a sequence of SEQ ID NOs: 10 and 11, a first target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 10 and 11, and A first target gene, wherein the second target gene module comprises a sequence of SEQ ID NOs: 12 and 13, a second target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 12 and 13, and a second A target gene, wherein the third target gene module comprises a sequence of SEQ ID NOs: 14 and 15, a third target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 14 and 15, and a third target gene It provides a vector for polycistronic expression for plants, comprising a.

In an exemplary embodiment, the cloning vector may be one or more selected from the group consisting of pLUG-Prime, pCR2.1, and pGEM-T.

In another aspect, the technology disclosed herein provides a plant transformed with a vector for polycistronic expression for the plant.

In another aspect, the technology disclosed herein is a method for preparing a vector for polycistronic expression for the plant, comprising the steps of inserting a second restriction enzyme recognition site into a binary vector to prepare a backbone vector; preparing a cloning vector into which a promoter sequence having a second restriction enzyme recognition site is inserted; preparing a cloning vector into which a nucleotide sequence encoding a 2A peptide having a second restriction enzyme recognition site is inserted; preparing a target gene module having a second restriction enzyme recognition site; preparing a cloning vector into which a terminator sequence having a second restriction enzyme recognition site is inserted; The backbone vector, the cloning vector into which the promoter sequence is inserted, the cloning vector into which the nucleotide sequence encoding the 2A peptide is inserted, the target gene module, and the cloning vector into which the terminator sequence is inserted, are mixed, and then a second restriction enzyme and ligase to provide a method for producing a vector for polycistronic expression in plants, comprising the step of simultaneously performing the enzymatic digestion and ligation process.

In one aspect, the technology disclosed herein has the effect of providing a polycistronic gene expression system applicable to plant engineering. The polycistronic gene expression system can integrate several genes into one place in the plant genome, and it is possible to maintain the expression level of several genes at a certain level or more and control them at once, and it is possible to improve the overall plant engineering process. It has the advantage of performing efficiently and saving time.

1 shows a schematic of a binary vector compatible with Golden Gate cloning. Blue box sequences indicate BasI-mediated golden gate cloning sites, and black nucleotide sequences indicate overhangs remaining in the vector after BasI enzyme digestion.
Figure 2 shows a schematic of a self-replicating binary vector compatible with Golden Gate cloning. Blue box sequences indicate BasI-mediated golden gate cloning sites, and black nucleotide sequences indicate overhangs remaining in the vector after BasI enzyme digestion.
3 shows a schematic diagram of the golden gate cloning-mediated module assembly process.
4 shows a schematic of the resulting 2A peptide-mediated polycistronic gene expression vector.
5 shows the results of polycistronic gene expression in plant cells using pGO-DV1-nptII.
6 shows the results of polycistronic gene expression in plant cells using pGO-DV2-nptII.

Hereinafter, the present invention will be described in detail.

In one aspect, the technology disclosed herein provides a backbone vector for preparing a polycistronic expression vector, which consists of a sequence of one of SEQ ID NOs: 2 to 5, and is used to prepare a vector for polycistronic expression for plants. .

In another aspect, the technology disclosed herein uses a backbone vector in which a second restriction enzyme recognition site is inserted into a binary vector, and two overhang sequences at the cleavage site by the second restriction enzyme of the backbone vector is located, the two overhang sequences are located in the forward strand and the reverse strand, respectively, and the following (1) promoter; (2) a nucleotide sequence encoding one or more 2A peptides; (3) two or more target gene modules; And (4) a terminator element is inserted, it provides a vector for polycistronic expression for plants.

(1) a promoter cleaved by a second restriction enzyme and comprising two overhang sequences complementary to an overhang sequence located in the backbone vector and an overhang sequence located in the target gene module after cleavage, respectively;

(2) located between the target gene modules, cleaved by the second restriction enzyme, and comprising two overhang sequences complementary to the overhang sequence located in the target gene module and the overhang sequence located in another target gene module after cleavage , a nucleotide sequence encoding one or more 2A peptides;

(3) between the promoter and the nucleotide sequence encoding the 2A peptide, or between the nucleotide sequence encoding two 2A peptides, or between the nucleotide sequence encoding the 2A peptide and the terminator, and is cleaved by a second restriction enzyme; two overhang sequences complementary to two of the overhang sequence located in the promoter after cleavage, the overhang sequence located in the nucleotide sequence encoding the 2A peptide, and the overhang sequence located in the terminator; two target gene-specific sequences respectively linked to the two complementary overhang sequences; and two or more target gene modules comprising a target gene; and

(4) A terminator cleaved by the second restriction enzyme and comprising two overhang sequences complementary to the overhang sequence located in the backbone vector and the overhang sequence located in the target gene module after cleavage, respectively.

The target gene module includes two overhang sequences; two target gene-specific sequences respectively linked to the two overhang sequences; and a gene of interest.

As used herein, the 'target gene' refers to a gene to be expressed in a plant.

As used herein, the 'target gene-specific sequence' refers to a sequence having a fragment complementary to a part of the target gene so as to hybridize with the target gene. The target gene-specific sequence is located one in the forward strand and one in the reverse strand, and has fragments complementary to the forward and reverse 3' end regions of the target gene, respectively.

As used herein, the term 'two overhang sequences' means located in the forward strand and the reverse strand, respectively.

In this specification, 'first', 'second', etc. mean used to distinguish one element from another.

In an exemplary embodiment, the two overhang sequences in the promoter may be complementary to an overhang sequence located on the reverse strand of the backbone vector and an overhang sequence located at the forward 5' end of the first target gene module, respectively.

In an exemplary embodiment, two overhang sequences in the nucleotide sequence encoding the 2A peptide are, respectively, an overhang sequence located at the reverse 5' end of the first gene module of interest and a forward 5' end of the second gene module of interest. It may be complementary to the overhang sequence.

In an exemplary embodiment, the two overhang sequences in the target gene module include: i) when the target gene module is located between the promoter and the nucleotide sequence encoding the 2A peptide, an overhang sequence located at the 5' end of the reverse of the promoter, respectively and an overhang sequence located at the forward 5' end of the nucleotide sequence encoding the 2A peptide, or ii) when the target gene module is located between the nucleotide sequence encoding two 2A peptides, each encoding the first 2A peptide is complementary to an overhang sequence located at the reverse 5' end of the nucleotide sequence and an overhang sequence located at the forward 5' end of the nucleotide sequence encoding the second 2A peptide, or iii) the nucleotide sequence encoding the 2A peptide of the target gene module and When positioned between terminators, it may be complementary to an overhang sequence positioned at the reverse 5' end of the nucleotide sequence encoding the 2A peptide, and an overhang sequence positioned at the forward 5' end of the terminator, respectively.

In an exemplary embodiment, the two overhang sequences in the terminator may be complementary to an overhang sequence located in the forward strand of the backbone vector and an overhang sequence located in the reverse 5' end of the target gene module, respectively.

A backbone vector may be manufactured using a general binary vector such as pCAMBIA, and in an exemplary embodiment, the binary vector may be a pLSLR vector. By using the pLSLR vector, it is possible to manufacture a self-replicating binary vector, which has the effect of increasing the expression level of a target gene.

In an exemplary embodiment, the backbone vector may be one in which the sequence of SEQ ID NO: 1 including the second restriction enzyme recognition site is inserted.

In an exemplary embodiment, the backbone vector may have a sequence of one of SEQ ID NOs: 2 to 5.

In an exemplary embodiment, the second restriction enzyme may be BasI.

In an exemplary embodiment, all of the overhang sequences may include 4 bases.

In an exemplary embodiment, the two overhang sequences located in the backbone vector may be 5'-ATAG-3' in the reverse strand and 5'-TAAG-3' in the forward strand.

In an exemplary embodiment, the elements inserted into the vector for polycistronic expression are: a promoter - a first target gene module - a nucleotide sequence encoding the first 2A peptide - a second target gene module - a second 2A peptide It may be inserted in the order of the nucleotide sequence - the third target gene module - the terminator.

In an exemplary embodiment, the promoter may include 5'-CTAT-3' at the 5' end of the forward direction and 5'-GGTT-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the first target gene module may include 5'-AACC-3' at the 5' end of the forward direction and 5'-CCTC-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the first 2A peptide comprises an overhang sequence 5'-GAGG-3' at the 5' end of the forward direction and 5'-AGGG-3' at the 5' end of the reverse direction. it could be

In an exemplary embodiment, the second target gene module may include 5'-CCCT-3' at the 5' end of the forward direction and 5'-TAGC-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the second 2A peptide comprises a 5'-GCTA-3' at the 5' end of the forward direction and a 5'-GGGT-3' overhang sequence at the 5' end of the reverse direction. it could be

In an exemplary embodiment, the third target gene module may include 5'-ACCC-3' at the 5' end of the forward direction and 5'-ATAT-3' overhang sequence at the 5' end of the reverse direction.

In an exemplary embodiment, the terminator may include an overhang sequence of 5'-ATAT-3' at the 5' end of the forward direction and 5'-CTTA-3' at the 5' end of the reverse direction.

In an exemplary embodiment, the nucleotide sequence encoding the first 2A peptide and the nucleotide sequence encoding the second 2A peptide may have the sequences of SEQ ID NOs: 22 and 23, respectively, except for the overhang sequence.

SEQ ID NO: 22 (forward)

5'-GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGG-3'

SEQ ID NO: 23 (forward)

5'-CTAATTTTTCTCTTCTTAAGCAAGCTGGGATGTTGAAGAAAATCCTGG-3'

In an exemplary embodiment, the promoter and the terminator may have the sequences of SEQ ID NOs: 24 and 25, respectively, except for the overhang sequence.

SEQ ID NO: 24 (forward)

5'-CTGGCAGACAAAGTGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAG-3 '

SEQ ID NO: 25 (forward)

5'-GAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTTGTTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATATAATGAATAAACAAAATGTTTCTATATGATCCATTGTGAATGATTGTATGATCCATTGTGAATGTTTTTGATTGGATAGATCTTGTG'

In another aspect, the technology disclosed herein comprises a backbone vector having one of SEQ ID NOs: 2-5; a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 6 is inserted; a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 7 is inserted; a cloning vector into which the promoter sequence of SEQ ID NO: 8 is inserted; a cloning vector into which the terminator sequence of SEQ ID NO: 9 is inserted; a first target gene module; a second target gene module; and a third target gene module, wherein the first target gene module comprises a sequence of SEQ ID NOs: 10 and 11, a first target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 10 and 11, and A first target gene, wherein the second target gene module comprises a sequence of SEQ ID NOs: 12 and 13, a second target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 12 and 13, and a second A target gene, wherein the third target gene module comprises a sequence of SEQ ID NOs: 14 and 15, a third target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 14 and 15, and a third target gene It provides a vector for polycistronic expression for plants, comprising a.

In an exemplary embodiment, the cloning vector may be one or more selected from the group consisting of pLUG-Prime, pCR2.1, and pGEM-T.

The vector for polycistronic expression according to the present specification has the effect of expressing several genes by one promoter by modularizing each element of the promoter, 2A peptide, target gene, and terminator and inserting it into the backbone vector. Between the target genes, there is a 2A peptide (18-22aa length, self-cleaving peptide), which is separated after translation and polycistronic gene expression is possible.

In another aspect, the technology disclosed herein provides a plant transformed with a vector for polycistronic expression for the plant.

In another aspect, the technology disclosed herein is a method for preparing a vector for polycistronic expression for the plant, comprising the steps of inserting a second restriction enzyme recognition site into a binary vector to prepare a backbone vector; preparing a cloning vector into which a promoter sequence having a second restriction enzyme recognition site is inserted; preparing a cloning vector into which a nucleotide sequence encoding a 2A peptide having a second restriction enzyme recognition site is inserted; preparing a target gene module having a second restriction enzyme recognition site; preparing a cloning vector into which a terminator sequence having a second restriction enzyme recognition site is inserted; The backbone vector, the cloning vector into which the promoter sequence is inserted, the cloning vector into which the nucleotide sequence encoding the 2A peptide is inserted, the target gene module, and the cloning vector into which the terminator sequence is inserted, are mixed, and then a second restriction enzyme and ligase to provide a method for producing a vector for polycistronic expression in plants, comprising the step of simultaneously performing the enzymatic digestion and ligation process.

The backbone vector, cloning vector and target gene module have double strands.

In an exemplary embodiment, the second restriction enzyme recognition site may include a nucleotide sequence recognized by a BasI restriction enzyme.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Experimental example 1. Module Preparation

(1) binary vector

Plasmid storage and distribution The pLSLR vector was acquired from Addgene, a non-profit organization, and used (Baltes et al., 2014).

For high expression of the selectable marker gene in the pLSLR vector, a pLSLR_35sHSP vector was constructed in which the 35s promoter was replaced with the 35s HSP intron promoter. Thereafter, the pLSLR_35sHSP vector was digested with SalI and PmeI, and a binary vector pGO-DV1 into which a BasI-mediated golden gate cloning site was inserted was constructed. Thereafter, pGO-DV1-nptII was prepared by replacing the hygromycin resistance gene (hpt), which is a selection marker, with the neomycin resistance gene (nptII) in pGO-DV1 (see FIG. 1 ). The BasI-mediated golden gate cloning site contains the sequence of SEQ ID NO: 1 (forward 5'-CTATNGAGACCGAGGTCTCNTAAG-3'). In this experimental example, the G base was used in the N base site of SEQ ID NO: 1.

In addition, a self-replicating binary vector pGO-DV2 was constructed in which the pLSLR_35sHSP vector was digested with PmlI and XhoI and a BasI-mediated golden gate cloning site was inserted between the upstream LIR and SIR. Thereafter, pGO-DV2-nptII was constructed in which the selection marker hygromycin resistance gene (hpt) was replaced with neomycin resistance gene (nptII) in pGO-DV2 (see FIG. 2 ). The BasI-mediated golden gate cloning site contains the sequence of SEQ ID NO: 1 (forward 5'-CTATNGAGACCGAGGTCTCNTAAG-3'). In this experimental example, the G base was used in the N base site of SEQ ID NO: 1.

Table 1 below shows the total nucleotide sequences (SEQ ID NOs: 2 to 5, respectively, forward) of the constructed vectors pGO-DV1, pGO-DV1-nptII, pGO-DV2, and pGO-DV2-nptII. The sequence of underlined shaded boxes indicates the insertion site, ie the BsaI-mediated Golden Gate cloning site. Similarly, in the present experimental example, the N base sites of SEQ ID NOs: 2 to 5 are applied to the G base.

(2) T2A module vector and P2A module vector

The nucleotide sequences of T2A and P2A are described in Liu et al. (2017). The sequence is a codon optimized for Nicotiana tabacum using the Codon Usage Database (http://www.kazusa.or.jp/codon/). T2A and P2A modules containing BasI enzyme sites at the 5' and 3' ends were synthesized and cloned into the pLUG-Prime vector.

Table 2 below shows the nucleotide sequences (SEQ ID NOs: 6 and 7, respectively, forward) of the T2A and P2A modules compatible with Golden Gate cloning. The sequence in the underlined shaded box represents the BasI enzyme site. In this experimental example, the G base was used for the N base positions of SEQ ID NOs: 6 and 7. The overhang sequence remaining after enzymatic cleavage is originally included in the T2A and P2A nucleotide sequences. Accordingly, the technology disclosed herein expresses the first target gene, T2A, the second target gene, P2A, and the third target gene as one ORF. to provide the effect of enabling accurate polycistronic expression.

T2A module 5'- GGTCTCN GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT NGAGACC -3' P2A module 5'- GGTCTCN GCTACTAATTTTTCTCTTCTTAAGCAAGCTGGAGATGTTGAAGAAAATCCTGGACCC NGAGACC -3'

(3) promoter module vector and terminator module vector

The nucleotide sequence of the CmYLCV promoter is described in Stavolone et al. (2003). A promoter module including a BasI enzyme site and an insertion site determining an overhang sequence at each 5' and 3' end was synthesized, and then cloned into the pLUG-Prime vector.

The nucleotide sequence of AtHSP 3'UTR is described in Nagaya et al. (2010) and used as a terminator. A terminator module including a BasI enzyme site and an insertion site determining an overhang sequence at each 5' and 3' end was synthesized, and then cloned into the pLUG-Prime vector.

Table 3 below shows the nucleotide sequences (SEQ ID NOs: 8 and 9, respectively, forward) of the CmYLCV promoter and AtHSP 3'UTR terminator modules compatible with Golden Gate cloning. In this experimental example, the G base was used for the N base positions of SEQ ID NOs: 8 and 9. The underlined shaded box sequences indicate the BasI enzyme sites, and the underlined italic sequences indicate the insertion sites that determine the overhang after BasI enzyme cleavage.

CmYLCV promoter module 5'- GGTCTCN CTAT CTGGCAGACAAAGTGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAG AACC NGAGACC -3 ' AtHSP _ 3'UTR terminator module 5'- GGTCTCN ATAT GAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTTGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATGTTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATTAAAGA TAAG NGAGACC -3 '

(4) gene module

In this experimental example, three genes (mCherry, eYFP, and eGFP) encoding fluorescent proteins were used to confirm the expression of 2A peptide-mediated polycistronic in plants. In addition, in order to confirm the expression of each gene at different positions in the polycistronic vector system, a gene module was prepared so that the ^{three genes could be inserted into the 1 st} , 2 ^nd , and 3 ^{rd gene positions in the vector.} In order to perform the simultaneous enzymatic cleavage and ligation process in the Golden Gate cloning system, a) a BasI enzyme site, b) an insertion site that determines the overhang sequence, and c) a gene-specific sequence of interest (i.e., the forward and A gene module containing a target gene was amplified by PCR using primers containing a sequence having a fragment complementary to each of the reverse 3' end regions. The overhang sequence made it possible to place the gene in the correct position in the vector. The primer used is a sequence specific for the gene of interest to be expressed at the 3' end of the sequence of SEQ ID NOs: 10 to 15, including the BasI enzyme site and the insertion site for determining the overhang sequence, and the sequence of SEQ ID NOs: 10-15 were used in combination (see Table 4). In this experimental example, the G base was used for the N base positions of SEQ ID NOs: 10, 12 and 14. In addition, a C base was used for the N bases of SEQ ID NOs: 11, 13 and 15.

SEQ ID NO: 10 (forward 5'-GGTCTCNAACC-3')

SEQ ID NO: 11 (reverse 5'-GGTCTCNCCTC-3')

SEQ ID NO: 12 (forward 5'-GGTCTCNCCCT-3')

SEQ ID NO: 13 (reverse 5'-GGTCTCNTAGC-3')

SEQ ID NO: 14 (forward 5'-GGTCTCNACCC-3')

SEQ ID NO: 15 (reverse 5'-GGTCTCNATAT-3')

Table 4 below shows the primers used to amplify gene modules compatible with Golden Gate cloning. As in SEQ ID NOs: 10 to 15, the N base positions in SEQ ID NOs: 16, 18 and 20 are G bases, and the N base positions in SEQ ID NOs: 17, 19 and 21 are C bases. The underlined shaded box sequence indicates the BasI enzyme site, and the underlined italic sequence indicates the insertion site that determines the overhang sequence. On the other hand, a sequence written in bold after an underlined italic indicates a gene-specific sequence of a fluorescent protein to be expressed.

primer sequence (5'→3') amplified gene in vector
module insertion site FP1st-Forward
(SEQ ID NO: 16) AC GGTCTCN AACC ATGGTGAGCAAGGGCGAG Between promoter and T2A
(1 ^st gene) FP1st-Reverse
(SEQ ID NO: 17) TG GGTCTCN CCTC CTTGTACAGCTCGTCCAT FP2nd-Forward
(SEQ ID NO: 18) AC GGTCTCN CCCT GTGAGCAAGGGCGAGGAG Between T2A and P2A
(2 ^nd gene) FP2nd-Reverse
(SEQ ID NO: 19) TG GGTCTCN TAGC CTTGTACAGCTCGTCCAT FP3rd-Forward
(SEQ ID NO: 20) AC GGTCTCN ACCC GTGAGCAAGGGCGAGGAG Between P2A and Terminator
(3 ^rd gene) FP3rd-Reverse
(SEQ ID NO: 21) TG GGTCTCN ATAT TTACTTGTACAGCTCGTCCAT

Experimental example 2. Vector Creation

Module assembly into the target vector was performed as follows. 150 ng of each module (YLCV promoter, T2A, P2A, AtHSP terminator, and fluorescent protein genes) and 150 ng of the target vector (pGO-DV1-nptII or pGO-DV2-nptII) were added to a 0.2 ml tube. Simultaneous enzymatic cleavage and ligation process in a thermocycler was performed using BsaI enzyme and T4 DNA ligase (running cycle: 10x (37 °C/5 min + 16 °C/10 min) + 50 °C/5 min + 80° C./5 min). After incubation, DH5α competent cells were transformed with the ligated construct, and the correctly assembled construct was amplified, selected, and purified. Finally, a total of six polycistronic expression vectors were constructed (see FIGS. 3 and 4 ).

As a result, 7 modules (1 promoter, 1 terminator, 3 genes, and 2 2A signals) were well assembled into binary vectors by the Golden Gate cloning approach, and the module assembly was transformed and purified by E. coli. It took only 3 days including the process. In a conventional vector construction process in which enzymatic digestion must be performed individually for each component, it would take 3 days to add one component to the vector, so it would take 21 days to add 7 components. Therefore, it was confirmed that the polycistronic expression vector according to the present specification provides the advantage of more efficiently performing the plant engineering process and reducing the time.

In addition, the Golden Gate cloning-mediated module assembly according to the present disclosure exhibited an efficiency very close to 100% (number of clones with correctly assembled construct/number of selected E. coli clones) x 100). Clones carrying constructs whose assembly was not performed correctly would not have been able to survive under antibiotic selective pressure.

Experimental example 3. Expression of Fluorescent Proteins in Tobacco Leaves and imaging

Agrobacterium tumefaciens strain LBA4404 ( Agrobacterium tumefaciens strain LBA4404) was transformed with the resulting construct. For the preparation of electrocompetent cells, in LB (Luria-Bertani) medium supplemented with streptomycin (20 μg/ml), Agrobacterium was cultured at 28° C. for 2 days with 250 rpm stirring. A 1/25 volume of fresh LB medium of the bacterial cell culture was inoculated and incubated at 28 °C with 250 rpm stirring until the _{OD 600 value reached 0.4.} After cooling on ice for 20 min, the cells were harvested by centrifugation at 4,000 rpm for 10 min at 4 °C and washed 3 times with cold water. The pellet was resuspended in cold 10% glycerol, aliquoted and stored at -80°C.

Agrobacterium carrying the above constructs were cultured for 2 days in LB medium supplemented with streptomycin (20 μg/ml) and kanamycin (50 μg/ml). Bacterial cells were harvested and adjusted to _{OD 600} 0.4 in resuspension solution (10 mM MgCl ₂ , 10 mM MES-KOH pH 5.6, 100 μM acetosyringone). After incubation at room temperature for 3 hours, the bacterial suspension was infiltrated into 4 to 5 week old Nicotiana tabacum leaves using a needleless syringe and incubated in a growth chamber for 5 days. Fluorescent protein expression was observed in tobacco leaves with an LSM5 Zeiss confocal laser scanning microscope using ZEN image analysis software (Carl Zeiss, Jena, Germany). The excitation/emission spectra were 488 nm/493-598 nm for eGFP, 514 nm/517-588 nm for eYFP, and 594 nm/599-650 nm for mCherry.

As a result, Golden Gate cloning and 2A signal peptide mediated polycistronic expression system successfully induced polycistronic expression in plant cells. Regardless of the gene location, the three fluorescent proteins in both vectors were expressed in plant cells, namely tobacco leaf cells (see FIGS. 5 and 6 ).

The fluorescence intensity directly related to the protein expression level was found to be 2.3- to 4.6-fold higher in the self-replicating vector pGO-DV2-nptII than in the pGO-DV1-nptII vector. This indicates that the use of the self-replicating vector pGO-DV2-nptII can further enhance the polycistronic expression level.

Above, a specific part of the present invention has been described in detail, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. It will be obvious. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Polycistronic Expression System for Plants <130> 19P270/IND <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Insertional site <400> 1 ctatngagac cgaggtctcn taag 24 <210> 2 <211> 9187 <212> DNA <213> Artificial Sequence <220> <223> pGO-DV1 vector <400> 2 caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt 60 gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc 120 gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc 180 gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct 240 ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc 300 gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga 360 ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc 420 ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg 480 ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg 540 aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat 600 gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt 660 gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga 720 gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt 780 tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg 840 ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg 900 cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga 960 cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg 1020 ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct 1080 agggcaaatt gccctagcag gggaaaaagg tcgaaaaggc ctctttcctg tggatagcac 1140 gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa 1200 gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga 1260 tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc 1320 ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct 1380 gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat 1440 ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga 1500 ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 1560 tctgacacat gcagctcccg gaaacggtca cagcttgtct gtaagcggat gccgggagca 1620 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 1680 agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt 1740 actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 1800 catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 1860 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 1920 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 1980 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 2040 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 2100 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 2160 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 2220 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 2280 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 2340 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 2400 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 2460 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 2520 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 2580 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 2640 agggattttg gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt 2700 tattttctcc caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc 2760 ttccccgata tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc 2820 cctgccgctt ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt 2880 gctgtctccc aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa 2940 aaaatcatac agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc 3000 cacatcggcc agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct 3060 attcgtatag ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata 3120 cagctcgata atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc 3180 atcggcctca ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt 3240 tggaacaggc agctttcctt ccagccatag catcatgtcc ttttcccgtt ccacatcata 3300 ggtggtccct ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac 3360 cagcttatat accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc 3420 gatcagtttt ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct 3480 tttctacagt atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca 3540 ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca 3600 aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca 3660 gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca 3720 aacccggcag cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc 3780 gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg 3840 gtgattttgt gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt 3900 gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt 3960 actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta 4020 ggaattagaa attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc 4080 ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact 4140 actcacacat tattatggag aaaatagagc ttgtcgatcg ttaattaatc acctccaaga 4200 tcccggacga gtgctggggc gtcggtttcc actatcggcg agtacttcta cacagccatc 4260 ggtccagacg gccgcgcttc tgcgggcgat ttgtgtacgc ccgacagtcc cggctccgga 4320 tcggacgatt gcgtcgcatc gaccctgcgc ccaagctgca tcatcgaaat tgccgtcaac 4380 caagctctga tagagttggt caagaccaat gcggagcata tacgcccgga gccgcggcga 4440 tcctgcaagc tccggatgcc tccgctcgaa gtagcgcgtc tgctgctcca tacaagccaa 4500 ccacggcctc cagaagaaga tgttggcgac ctcgtattgg gaatccccga acatcgcctc 4560 gctccagtca atgaccgctg ttatgcggcc attgtccgtc aggacattgt tggagccgaa 4620 atccgcgtgc acgaggtgcc ggacttcggg gcagtcctcg gcccaaagca tcagctcatc 4680 gagagcctgc gcgacggacg cactgacggt gtcgtccatc acagtttgcc agtgatacac 4740 atggggatca gcaatcgcgc atatgaaatc acgccatgta gtgtattgac cgattccttg 4800 cggtccgaat gggccgaacc cgctcgtctg gctaagatcg gccgcagcga tcgcatccat 4860 ggcctccgcg accggctgca gaacagcggg cagttcggtt tcaggcaggt cttgcaacgt 4920 gacaccctgt gcacggcggg agatgcaata ggtcaggctc tcgctgaatt ccccaatgtc 4980 aagcacttcc ggaatcggga gcgcggccga tgcaaagtgc cgataaacat aacgatcttt 5040 gtagaaacca tcggcgcagc tatttacccg caggacatat ccacgccctc ctacatcgaa 5100 gctgaaagca cgagattctt cgccctccga gagctgcatc aggtcggaca cgctgtcgaa 5160 cttttcgatc agaaacttct cgacagacgt cgcggtgagt tcaggctttt tcatcctagg 5220 ggacgcgtgg atcctctaga ggccgcttgg tatctgcatt acaatgaaat gagcaaagac 5280 tatgtgagta acactggtca acactaggga gaaggcatcg agcaagatac gtatgtaaag 5340 agaagcaata tagtgtcagt tggtagatac tagataccat caggaggtaa ggagagcaac 5400 aaaaaggaaa ctctttattt ttaaattttg ttacaacaaa caagcagatc aatgcatcaa 5460 aatactgtca gtacttattt cttcagacaa caatatttaa aacaagtgca tctgatcttg 5520 acttatggtc acaataaagg agcagagata aacatcaaaa tttcgtcatt tatatttatt 5580 ccttcaggcg ttaacaattt aacagcacac aaacaaaaac agaataggaa tatctaattt 5640 tggcaaataa taagctctgc agacgaacaa attattatag tatcgcctat aatatgaatc 5700 cctatactat tgacccatgt agtatgaagc ctgtgcctaa attaacagca aacttctgaa 5760 tccaagtgcc ctataacacc aacatgtgct taaataaata ccgctaagca ccaaattaca 5820 catttctcgt attgctgtgt aggttctatc ttcgtttcgt actaccatgt ccctatattt 5880 tgctgctaca aaggacggca agtaatcagc acaggcagaa cacgatttca gagtgtaatt 5940 ctagatccag ctaaaccact ctcagcaatc accacacaag agagcattca gagaaacgtg 6000 gcagtaacaa aggcagaggg cggagtgagc gcgtaccgaa gacggtagat ctgctagagt 6060 cagcttgtca gcgtgtcctc tccaaatgaa atgaacttcc ttatatagag gaagggtctt 6120 gcgaaggata gtgggattgt gcgtcatccc ttacgtcagt ggagatatca catcaatcca 6180 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg 6240 gtccatcttt gggaccactg tcggcagagg catcttcaac gatggccttt cctttatcgc 6300 aatgatggca tttgtaggag ccaccttcct tttccactat cttcacaata aagtgacaga 6360 tagctgggca atggaatccg aggaggtttc cggatattac cctttgttga aaagtctcaa 6420 tcggaccatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 6480 cgatgctcct cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttcaa 6540 cgatggcctt tcctttatcg caatgatggc atttgtagga gccaccttcc ttttccacta 6600 tcttcacaat aaagtgacag atagctgggc aatggaatcc gaggaggttt ccggatatta 6660 ccctttgttg aaaagtctca atcggacctg cagaagctca ccggtgcggt ccgcgtaact 6720 ataacggtcc taaggtagcg aaagcttgtc gacctatnga gaccgaggtc tcntaaggtt 6780 taaactatca gtgtttgaca ggatatattg gcgggtaaac ctaagagaaa agagcgttta 6840 ttagaataac ggatatttaa aagggcgtga aaaggtttat ccgttcgtcc atttgtatgt 6900 gcatgccaac cacagggttc ccctcgggat caaagtactt tgatccaacc cctccgctgc 6960 tatagtgcag tcggcttctg acgttcagtg cagccgtctt ctgaaaacga catgtcgcac 7020 aagtcctaag tacgcgaca ggctgccgcc ctgccctttt cctggcgttt tcttgtcgcg 7080 tgttttagtc gcataaagta gaatacttgc gactagaacc ggagacatta cgccatgaac 7140 aagagcgccg ccgctggcct gctgggctat gcccgcgtca gcaccgacga ccaggacttg 7200 accaaccaac gggccgaact gcacgcggcc ggctgcacca agctgttttc cgagaagatc 7260 accggcacca ggcgcgaccg cccggagctg gccaggatgc ttgaccacct acgccctggc 7320 gacgttgtga cagtgaccag gctagaccgc ctggcccgca gcacccgcga cctactggac 7380 attgccgagc gcatccagga ggccggcgcg ggcctgcgta gcctggcaga gccgtgggcc 7440 gacaccacca cgccggccgg ccgcatggtg ttgaccgtgt tcgccggcat tgccgagttc 7500 gagcgttccc taatcatcga ccgcacccgg agcgggcgcg aggccgccaa ggcccgaggc 7560 gtgaagtttg gcccccgccc taccctcacc ccggcacaga tcgcgcacgc ccgcgagctg 7620 atcgaccagg aaggccgcac cgtgaaagag gcggctgcac tgcttggcgt gcatcgctcg 7680 accctgtacc gcgcacttga gcgcagcgag gaagtgacgc ccaccgaggc caggcggcgc 7740 ggtgccttcc gtgaggacgc attgaccgag gccgacgccc tggcggccgc cgagaatgaa 7800 cgccaagagg aacaagcatg aaaccgcacc aggacggcca ggacgaaccg tttttcatta 7860 ccgaagagat cgaggcggag atgatcgcgg ccgggtacgt gttcgagccg cccgcgcacg 7920 gctcaaccgt gcggctgcat gaaatcctgg ccggtttgtc tgatgccaag ctggcggcct 7980 ggccggccag cttggccgct gaagaaaccg agcgccgccg tctaaaaagg tgatgtgtat 8040 ttgagtaaaa cagcttgcgt catgcggtcg ctgcgtatat gatgcgatga gtaaataaac 8100 aaatacgcaa ggggaacgca tgaaggttat cgctgtactt aaccagaaag gcgggtcagg 8160 caagacgacc atcgcaaccc atctagcccg cgccctgcaa ctcgccgggg ccgatgttct 8220 gttagtcgat tccgatcccc agggcagtgc ccgcgattgg gcggccgtgc gggaagatca 8280 accgctaacc gttgtcggca tcgaccgccc gacgattgac cgcgacgtga aggccatcgg 8340 ccggcgcgac ttcgtagtga tcgacggagc gccccaggcg gcggacttgg ctgtgtccgc 8400 gatcaaggca gccgacttcg tgctgattcc ggtgcagcca agcccttacg acatatgggc 8460 caccgccgac ctggtggagc tggttaagca gcgcattgag gtcacggatg gaaggctaca 8520 agcggccttt gtcgtgtcgc gggcgatcaa aggcacgcgc atcggcggtg aggttgccga 8580 ggcgctggcc gggtacgagc tgcccattct tgagtcccgt atcacgcagc gcgtgagcta 8640 cccaggcact gccgccgccg gcacaaccgt tcttgaatca gaacccgagg gcgacgctgc 8700 ccgcgaggtc caggcgctgg ccgctgaaat taaatcaaaa ctcatttgag ttaatgaggt 8760 aaagagaaaa tgagcaaaag cacaaacacg ctaagtgccg gccgtccgag cgcacgcagc 8820 agcaaggctg caacgttggc cagcctggca gacacgccag ccatgaagcg ggtcaacttt 8880 cagttgccgg cggaggatca caccaagctg aagatgtacg cggtacgcca aggcaagacc 8940 attaccgagc tgctatctga atacatcgcg cagctaccag agtaaatgag caaatgaata 9000 aatgagtaga tgaattttag cggctaaagg aggcggcatg gaaaatcaag aacaaccagg 9060 caccgacgcc gtggaatgcc ccatgtgtgg aggaacgggc ggttggccag gcgtaagcgg 9120 ctgggttgtc tgccggccct gcaatggcac tggaaccccc aagcccgagg aatcggcgtg 9180 acggtcg 9187 <210> 3 <211> 8960 <212> DNA <213> Artificial Sequence <220> <223> pGO-DV1-nptII vector <400> 3 caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt 60 gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc 120 gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc 180 gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct 240 ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc 300 gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga 360 ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc 420 ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg 480 ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg 540 aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat 600 gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt 660 gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga 720 gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt 780 tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg 840 ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg 900 cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga 960 cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg 1020 ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct 1080 agggcaaatt gccctagcag gggaaaaagg tcgaaaaggc ctctttcctg tggatagcac 1140 gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa 1200 gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga 1260 tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc 1320 ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct 1380 gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat 1440 ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga 1500 ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 1560 tctgacacat gcagctcccg gaaacggtca cagcttgtct gtaagcggat gccgggagca 1620 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 1680 agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt 1740 actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 1800 catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 1860 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 1920 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 1980 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 2040 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 2100 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 2160 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 2220 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 2280 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 2340 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 2400 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 2460 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 2520 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 2580 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 2640 agggattttg gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt 2700 tattttctcc caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc 2760 ttccccgata tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc 2820 cctgccgctt ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt 2880 gctgtctccc aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa 2940 aaaatcatac agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc 3000 cacatcggcc agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct 3060 attcgtatag ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata 3120 cagctcgata atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc 3180 atcggcctca ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt 3240 tggaacaggc agctttcctt ccagccatag catcatgtcc ttttcccgtt ccacatcata 3300 ggtggtccct ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac 3360 cagcttatat accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc 3420 gatcagtttt ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct 3480 tttctacagt atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca 3540 ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca 3600 aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca 3660 gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca 3720 aacccggcag cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc 3780 gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg 3840 gtgattttgt gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt 3900 gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt 3960 actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta 4020 ggaattagaa attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc 4080 ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact 4140 actcacacat tattatggag aaaatagagc ttgtcgatcg ttaattaatc agaagaactc 4200 gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga gcggcgatac cgtaaagcac 4260 gaggaagcgg tcagcccatt cgccgccaag ctcttcagca atatcagggg tagccaacgc 4320 tatgtcctga tagcggtccg ccacacccag ccggccacag tcgatgaatc cagaaaagcg 4380 gccattttcc accatgatat tcggcaagca ggcatcgcca tgtgtcacga cgagatcctc 4440 gccgtcgggc atgcgcgcct tgagcctggc gaacagttcg gctggcgcga gcccctgatg 4500 ctcttcgtcc agatcatcct gatcgacaag accggcttcc atccgagtac gtgctcgctc 4560 gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc ggatcaagcg tatgcagccg 4620 ccgcattgca tcagccatga tggatacttt ctcggcagga gcaaggtgag atgacaggag 4680 atcctgcccc ggcacttcgc ccaatagcag ccagtccctt cccgcttcag tgacaacgtc 4740 gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac gatagccgcg ctgcctcgtc 4800 ctggagttca ttcagggcac cggacaggtc ggtcttgaca aaaagaaccg ggcgcccctg 4860 cgctgacagc cgaaacacgg cggcatcaga gcagccgatt gtctgttgtg cccagtcata 4920 gccgaatagc ctctccaccc aagcggccgg agaacctgcg tgcaatccat cttgttcaat 4980 ccccatccta ggggacgcgt ggatcctcta gaggccgctt ggtatctgca ttacaatgaa 5040 atgagcaaag actatgtgag taacactggt caacactagg gagaaggcat cgagcaagat 5100 acgtatgtaa agagaagcaa tatagtgtca gttggtagat actagatacc atcaggaggt 5160 aaggagagca acaaaaagga aactctttat ttttaaattt tgttacaaca aacaagcaga 5220 tcaatgcatc aaaatactgt cagtacttat ttcttcagac aacaatattt aaaacaagtg 5280 catctgatct tgacttatgg tcacaataaa ggagcagaga taaacatcaa aatttcgtca 5340 tttatattta ttccttcagg cgttaacaat ttaacagcac acaaacaaaa acagaatagg 5400 aatatctaat tttggcaaat aataagctct gcagacgaac aaattattat agtatcgcct 5460 ataatatgaa tccctatact attgacccat gtagtatgaa gcctgtgcct aaattaacag 5520 caaacttctg aatccaagtg ccctataaca ccaacatgtg cttaaataaa taccgctaag 5580 caccaaatta cacattctc gtattgctgt gtaggttcta tcttcgtttc gtactaccat 5640 gtccctatat tttgctgcta caaaggacgg caagtaatca gcacaggcag aacacgattt 5700 cagagtgtaa ttctagatcc agctaaacca ctctcagcaa tcaccacaca agagagcatt 5760 cagagaaacg tggcagtaac aaaggcagag ggcggagtga gcgcgtaccg aagacggtag 5820 atctgctaga gtcagcttgt cagcgtgtcc tctccaaatg aaatgaactt ccttatatag 5880 aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat 5940 cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc 6000 tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttca acgatggcct 6060 ttcctttatc gcaatgatgg catttgtagg agccaccttc cttttccact atcttcacaa 6120 taaagtgaca gatagctggg caatggaatc cgaggaggtt tccggatatt accctttgtt 6180 gaaaagtctc aatcggacca tcacatcaat ccacttgctt tgaagacgtg gttggaacgt 6240 cttctttttc cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag 6300 aggcatcttc aacgatggcc tttcctttat cgcaatgatg gcatttgtag gagccacctt 6360 ccttttccac tatcttcaca ataaagtgac agatagctgg gcaatggaat ccgaggaggt 6420 ttccggatat taccctttgt tgaaaagtct caatcggacc tgcagaagct caccggtgcg 6480 gtccgcgtaa ctataacggt cctaaggtag cgaaagcttg tcgacctatn gagaccgagg 6540 tctcntaagg tttaaactat cagtgtttga caggatatat tggcgggtaa acctaagaga 6600 aaagagcgtt tattagaata atcggatatt taaaagggcg tgaaaaggtt tatccgttcg 6660 tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg gatcaaagta ctttgatcca 6720 acccctccgc tgctatagtg cagtcggctt ctgacgttca gtgcagccgt cttctgaaaa 6780 cgacatgtcg cacaagtcct aagttacgcg acaggctgcc gccctgccct tttcctggcg 6840 ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact tgcgactaga accggagaca 6900 ttacgccatg aacaagagcg ccgccgctgg cctgctgggc tatgcccgcg tcagcaccga 6960 cgaccaggac ttgaccaacc aacgggccga actgcacgcg gccggctgca ccaagctgtt 7020 ttccgagaag atcaccggca ccaggcgcga ccgcccggag ctggccagga tgcttgacca 7080 cctacgccct ggcgacgttg tgacagtgac caggctagac cgcctggccc gcagcacccg 7140 cgacctactg gacattgccg agcgcatcca ggaggccggc gcgggcctgc gtagcctggc 7200 agagccgtgg gccgacacca ccacgccggc cggccgcatg gtgttgaccg tgttcgccgg 7260 cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc gcgaggccgc 7320 caaggcccga ggcgtgaagt ttggcccccg ccctaccctc accccggcac agatcgcgca 7380 cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg cactgcttgg 7440 cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc gaggaagtga cgcccaccga 7500 ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc gaggccgacg ccctggcggc 7560 cgccgagaat gaacgccaag aggaacaagc atgaaaccgc accaggacgg ccaggacgaa 7620 ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg cggccgggta cgtgttcgag 7680 ccgcccgcgc acggctcaac cgtgcggctg catgaaatcc tggccggttt gtctgatgcc 7740 aagctggcgg cctggccggc cagcttggcc gctgaagaaa ccgagcgccg ccgtctaaaa 7800 aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta tatgatgcga 7860 tgagtaaata aacaaatacg caaggggaac gcatgaaggt tatcgctgta cttaaccaga 7920 aaggcgggtc aggcaagacg accatcgcaa cccatctagc ccgcgccctg caactcgccg 7980 gggccgatgt tctgttagtc gattccgatc cccagggcag tgcccgcgat tgggcggccg 8040 tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt gaccgcgacg 8100 tgaaggccat cggccggcgc gacttcgtag tgatcgacgg agcgccccag gcggcggact 8160 tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat tccggtgcag ccaagccctt 8220 acgacatatg ggccaccgcc gacctggtgg agctggttaa gcagcgcatt gaggtcacgg 8280 atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg cgcatcggcg 8340 gtgaggttgc cgaggcgctg gccgggtacg agctgcccat tcttgagtcc cgtatcacgc 8400 agcgcgtgag ctacccaggc actgccgccg ccggcacaac cgttcttgaa tcagaacccg 8460 agggcgacgc tgcccgcgag gtccaggcgc tggccgctga aattaaatca aaactcattt 8520 gagttaatga ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg ccggccgtcc 8580 gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc cagccatgaa 8640 gcgggtcaac tttcagttgc cggcggagga tcacaccaag ctgaagatgt acgcggtacg 8700 ccaaggcaag accattaccg agctgctatc tgaatacatc gcgcagctac cagagtaaat 8760 gagcaaatga ataaatgagt agatgaattt tagcggctaa aggaggcggc atggaaaatc 8820 aagaacaacc aggcaccgac gccgtggaat gccccatgtg tggaggaacg ggcggttggc 8880 caggcgtaag cggctgggtt gtctgccggc cctgcaatgg cactggaacc cccaagcccg 8940 aggaatcggc gtgacggtcg 8960 <210> 4 <211> 11296 <212> DNA <213> Artificial Sequence <220> <223> pGO-DV2 vector <400> 4 caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt 60 gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc 120 gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc 180 gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct 240 ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc 300 gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga 360 ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc 420 ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg 480 ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg 540 aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat 600 gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt 660 gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga 720 gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt 780 tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg 840 ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg 900 cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga 960 cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg 1020 ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct 1080 agggcaaatt gccctagcag gggaaaaagg tcgaaaaggc ctctttcctg tggatagcac 1140 gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa 1200 gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga 1260 tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc 1320 ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct 1380 gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat 1440 ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga 1500 ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 1560 tctgacacat gcagctcccg gaaacggtca cagcttgtct gtaagcggat gccgggagca 1620 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 1680 agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt 1740 actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 1800 catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 1860 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 1920 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 1980 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 2040 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 2100 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 2160 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 2220 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 2280 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 2340 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 2400 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 2460 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 2520 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 2580 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 2640 agggattttg gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt 2700 tattttctcc caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc 2760 ttccccgata tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc 2820 cctgccgctt ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt 2880 gctgtctccc aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa 2940 aaaatcatac agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc 3000 cacatcggcc agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct 3060 attcgtatag ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata 3120 cagctcgata atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc 3180 atcggcctca ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt 3240 tggaacaggc agctttcctt ccagccatag catcatgtcc ttttcccgtt ccacatcata 3300 ggtggtccct ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac 3360 cagcttatat accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc 3420 gatcagtttt ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct 3480 tttctacagt atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca 3540 ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca 3600 aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca 3660 gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca 3720 aacccggcag cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc 3780 gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg 3840 gtgattttgt gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt 3900 gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt 3960 actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta 4020 ggaattagaa attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc 4080 ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact 4140 actcacacat tattatggag aaaatagagc ttgtcgatcg ttaattaatc acctccaaga 4200 tcccggacga gtgctggggc gtcggtttcc actatcggcg agtacttcta cacagccatc 4260 ggtccagacg gccgcgcttc tgcgggcgat ttgtgtacgc ccgacagtcc cggctccgga 4320 tcggacgatt gcgtcgcatc gaccctgcgc ccaagctgca tcatcgaaat tgccgtcaac 4380 caagctctga tagagttggt caagaccaat gcggagcata tacgcccgga gccgcggcga 4440 tcctgcaagc tccggatgcc tccgctcgaa gtagcgcgtc tgctgctcca tacaagccaa 4500 ccacggcctc cagaagaaga tgttggcgac ctcgtattgg gaatccccga acatcgcctc 4560 gctccagtca atgaccgctg ttatgcggcc attgtccgtc aggacattgt tggagccgaa 4620 atccgcgtgc acgaggtgcc ggacttcggg gcagtcctcg gcccaaagca tcagctcatc 4680 gagagcctgc gcgacggacg cactgacggt gtcgtccatc acagtttgcc agtgatacac 4740 atggggatca gcaatcgcgc atatgaaatc acgccatgta gtgtattgac cgattccttg 4800 cggtccgaat gggccgaacc cgctcgtctg gctaagatcg gccgcagcga tcgcatccat 4860 ggcctccgcg accggctgca gaacagcggg cagttcggtt tcaggcaggt cttgcaacgt 4920 gacaccctgt gcacggcggg agatgcaata ggtcaggctc tcgctgaatt ccccaatgtc 4980 aagcacttcc ggaatcggga gcgcggccga tgcaaagtgc cgataaacat aacgatcttt 5040 gtagaaacca tcggcgcagc tatttacccg caggacatat ccacgccctc ctacatcgaa 5100 gctgaaagca cgagattctt cgccctccga gagctgcatc aggtcggaca cgctgtcgaa 5160 cttttcgatc agaaacttct cgacagacgt cgcggtgagt tcaggctttt tcatcctagg 5220 ggacgcgtgg atcctctaga ggccgcttgg tatctgcatt acaatgaaat gagcaaagac 5280 tatgtgagta acactggtca acactaggga gaaggcatcg agcaagatac gtatgtaaag 5340 agaagcaata tagtgtcagt tggtagatac tagataccat caggaggtaa ggagagcaac 5400 aaaaaggaaa ctctttattt ttaaattttg ttacaacaaa caagcagatc aatgcatcaa 5460 aatactgtca gtacttattt cttcagacaa caatatttaa aacaagtgca tctgatcttg 5520 acttatggtc acaataaagg agcagagata aacatcaaaa tttcgtcatt tatatttatt 5580 ccttcaggcg ttaacaattt aacagcacac aaacaaaaac agaataggaa tatctaattt 5640 tggcaaataa taagctctgc agacgaacaa attattatag tatcgcctat aatatgaatc 5700 cctatactat tgacccatgt agtatgaagc ctgtgcctaa attaacagca aacttctgaa 5760 tccaagtgcc ctataacacc aacatgtgct taaataaata ccgctaagca ccaaattaca 5820 catttctcgt attgctgtgt aggttctatc ttcgtttcgt actaccatgt ccctatattt 5880 tgctgctaca aaggacggca agtaatcagc acaggcagaa cacgatttca gagtgtaatt 5940 ctagatccag ctaaaccact ctcagcaatc accacacaag agagcattca gagaaacgtg 6000 gcagtaacaa aggcagaggg cggagtgagc gcgtaccgaa gacggtagat ctgctagagt 6060 cagcttgtca gcgtgtcctc tccaaatgaa atgaacttcc ttatatagag gaagggtctt 6120 gcgaaggata gtgggattgt gcgtcatccc ttacgtcagt ggagatatca catcaatcca 6180 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg 6240 gtccatcttt gggaccactg tcggcagagg catcttcaac gatggccttt cctttatcgc 6300 aatgatggca tttgtaggag ccaccttcct tttccactat cttcacaata aagtgacaga 6360 tagctgggca atggaatccg aggaggtttc cggatattac cctttgttga aaagtctcaa 6420 tcggaccatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 6480 cgatgctcct cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttcaa 6540 cgatggcctt tcctttatcg caatgatggc atttgtagga gccaccttcc ttttccacta 6600 tcttcacaat aaagtgacag atagctgggc aatggaatcc gaggaggttt ccggatatta 6660 ccctttgttg aaaagtctca atcggacctg cagaagctca ccggtgcggt ccgcgtaact 6720 ataacggtcc taaggtagcg aaagcttgtc gactatcgga cgagctcaaa gtttaacgcg 6780 ttagcagaag gcatgttgtt gtgactccga ggggttgcct caaactctat cttataaccg 6840 gcgtggaggc atggaggcag gggtattttg gtcattttaa tagatagtgg aaaatgacgt 6900 ggaatttact taaagacgaa gtctttgcga caaggggggg cccacgccga atttaatatt 6960 accggcgtgg ccccccctta tcgcgagtgc tttagcacga gcggtccaga tttaaagtag 7020 aaaatttccc gcccactagg gttaaaggtg ttcacactat aaaagcatat acgatgtgat 7080 ggtatttgat ggagcgtata ttgtatcagg tatttccgtt ggatacgaat tattcgtacg 7140 accctcggcg cgccgagaac ttccagagct ttgggtacgt cacctatnga gaccgaggtc 7200 tcntaagtcg agcgcgtagt cctcggtaat atcgcagaac aaaagtacct gatatcgagt 7260 gtacttcaag tcagtgggaa atcaataaaa tgattatttt atgaatatat ttcattgtgc 7320 aagtagatag aaattacata tgttacataa cacacgaaat aaacaaaaaa agacaatcca 7380 aaaacaaaca ccccaaaaaa aataatcact ttagataaac tcgtatgagg agaggcacgt 7440 tcagtgactc gacgattccc gagcaaaaaa agtctccccg tcacacatgt agtgggtgac 7500 gcaattatct ttaaagtaat ccttctgttg acttgtcatt gataacatcc agtcttcgtc 7560 aggattgcaa agaattatag aagggatccc accttttatt ttcttctttt ttccatattt 7620 agggttgaca gtgaaatcag actggcaacc tattaattgc ttccacaatg ggacgaactt 7680 gaaggggatg tcgtcgatga tattataggt ggcgtgttca tcgtagttgg tgaaatcgat 7740 ggtaccgttc caatagttgt gtcgtccgag acttctagcc caggtggtct ttccggtacg 7800 agttggtccg cagatgtaga ggctggggtg tcggattcca ttccttccat tgtccttgtt 7860 aaatcggcca tccattcaag gtcagattga gcttgttggt atgagacagg atgtatgtaa 7920 gtataagcgt ctatgcttac atggtataga tgggtttccc tccaggagtg tagatcttcg 7980 tggcagcgaa gatctgattc tgtgaagggc gacacatacg gttcaggttg tggagggaat 8040 aatttgttgg ctgaatattc cagccattga agctttgttg cccattcatg agggaattct 8100 tccttgatca tgtcaagata ttcctcctta gacgttgcag tctggataat agttctccat 8160 cgtgcgtcag atttgcgagg agaaacctta tgatctcgga aatctcctct ggttttaata 8220 tctccgtcct ttgatatgta atcaaggact tgtttagagt ttctagctgg ctggatatta 8280 gggtgatttc cttcaaaatc gaaaaaagaa ggatccctaa tacaaggttt tttatcaagc 8340 tggagaagag catgatagtg ggtagtgcca tcttgatgaa gctcagaagc aacaccaagg 8400 aagaaaataa gaaaaggtgt gagtttctcc cagagaaact ggaataaatc atctctttga 8460 gatgagcact tgggataggt aaggaaaaca tatttagatt ggagtctgaa gttcttacta 8520 gcagaaggca tgttgttgtg actccgaggg gttgcctcaa actctatctt ataaccggcg 8580 tggaggcatg gaggcagggg tattttggtc attttaatag atagtggaaa atgacgtgga 8640 atttacttaa agacgaagtc tttgcgacaa gggggggccc acgccgaatt taatattacc 8700 ggcgtggccc ccccttatcg cgagtgcttt agcacgagcg gtccagattt aaagtagaaa 8760 atttcccgcc cactagggtt aaaggtgttc acactataaa agcatatacg atgtgatggt 8820 atttgatgga gcgtatattg tatcaggtat ttccgttgga tacgaattat tcgtacgacc 8880 ctcatagttt aaactatcag tgtttgacag gatatattgg cgggtaaacc taagagaaaa 8940 gagcgtttat tagaataacg gatatttaaa agggcgtgaa aaggtttatc cgttcgtcca 9000 tttgtatgtg catgccaacc acagggttcc cctcgggatc aaagtacttt gatccaaccc 9060 ctccgctgct atagtgcagt cggcttctga cgttcagtgc agccgtcttc tgaaaacgac 9120 atgtcgcaca agtcctaagt tacgcgacag gctgccgccc tgcccttttc ctggcgtttt 9180 cttgtcgcgt gttttagtcg cataaagtag aatacttgcg actagaaccg gagacattac 9240 gccatgaaca agagcgccgc cgctggcctg ctgggctatg cccgcgtcag caccgacgac 9300 caggacttga ccaaccaacg ggccgaactg cacgcggccg gctgcaccaa gctgttttcc 9360 gagaagatca ccggcaccag gcgcgaccgc ccggagctgg ccaggatgct tgaccaccta 9420 cgccctggcg acgttgtgac agtgaccagg ctagaccgcc tggcccgcag cacccgcgac 9480 ctactggaca ttgccgagcg catccaggag gccggcgcgg gcctgcgtag cctggcagag 9540 ccgtgggccg acaccaccac gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt 9600 gccgagttcg agcgttccct aatcatcgac cgcacccgga gcgggcgcga ggccgccaag 9660 gcccgaggcg tgaagtttgg cccccgccct accctcaccc cggcacagat cgcgcacgcc 9720 cgcgagctga tcgaccagga aggccgcacc gtgaaagagg cggctgcact gcttggcgtg 9780 catcgctcga ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc 9840 aggcggcgcg gtgccttccg tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc 9900 gagaatgaac gccaagagga acaagcatga aaccgcacca ggacggccag gacgaaccgt 9960 ttttcattac cgaagagatc gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc 10020 ccgcgcacgg ctcaaccgtg cggctgcatg aaatcctggc cggtttgtct gatgccaagc 10080 tggcggcctg gccggccagc ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt 10140 gatgtgtatt tgagtaaaac agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag 10200 taaataaaca aatacgcaag gggaacgcat gaaggttatc gctgtactta accagaaagg 10260 cgggtcaggc aagacgacca tcgcaaccca tctagcccgc gccctgcaac tcgccggggc 10320 cgatgttctg ttagtcgatt ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg 10380 ggaagatcaa ccgctaaccg ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa 10440 ggccatcggc cggcgcgact tcgtagtgat cgacggagcg ccccaggcgg cggacttggc 10500 tgtgtccgcg atcaaggcag ccgacttcgt gctgattccg gtgcagccaa gcccttacga 10560 catatgggcc accgccgacc tggtggagct ggttaagcag cgcattgagg tcacggatgg 10620 aaggctacaa gcggcctttg tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga 10680 ggttgccgag gcgctggccg ggtacgagct gcccattctt gagtcccgta tcacgcagcg 10740 cgtgagctac ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg 10800 cgacgctgcc cgcgaggtcc aggcgctggc cgctgaaatt aaatcaaaac tcatttgagt 10860 taatgaggta aagagaaaat gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc 10920 gcaccgcagca gcaaggctgc aacgttggcc agcctggcag acacgccagc catgaagcgg 10980 gtcaactttc agttgccggc ggaggatcac accaagctga agatgtacgc ggtacgccaa 11040 ggcaagacca ttaccgagct gctatctgaa tacatcgcgc agctaccaga gtaaatgagc 11100 aaatgaataa atgagtagat gaattttagc ggctaaagga ggcggcatgg aaaatcaaga 11160 acaaccaggc accgacgccg tggaatgccc catgtgtgga ggaacgggcg gttggccagg 11220 cgtaagcggc tgggttgtct gccggccctg caatggcact ggaaccccca agcccgagga 11280 atcggcgtga cggtcg 11296 <210> 5 <211> 11068 <212> DNA <213> Artificial Sequence <220> <223> pGO-DV2-nptII vector <400> 5 caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt 60 gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc 120 gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc 180 gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct 240 ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc 300 gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga 360 ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc 420 ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg 480 ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg 540 aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat 600 gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt 660 gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga 720 gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt 780 tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg 840 ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg 900 cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga 960 cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg 1020 ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct 1080 agggcaaatt gccctagcag gggaaaaagg tcgaaaaggc ctctttcctg tggatagcac 1140 gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa 1200 gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga 1260 tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc 1320 ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct 1380 gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat 1440 ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga 1500 ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 1560 tctgacacat gcagctcccg gaaacggtca cagcttgtct gtaagcggat gccgggagca 1620 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 1680 agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt 1740 actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 1800 catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 1860 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 1920 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 1980 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 2040 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 2100 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 2160 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 2220 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 2280 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 2340 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 2400 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 2460 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 2520 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 2580 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 2640 agggattttg gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt 2700 tattttctcc caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc 2760 ttccccgata tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc 2820 cctgccgctt ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt 2880 gctgtctccc aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa 2940 aaaatcatac agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc 3000 cacatcggcc agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct 3060 attcgtatag ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata 3120 cagctcgata atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc 3180 atcggcctca ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt 3240 tggaacaggc agctttcctt ccagccatag catcatgtcc ttttcccgtt ccacatcata 3300 ggtggtccct ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac 3360 cagcttatat accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc 3420 gatcagtttt ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct 3480 tttctacagt atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca 3540 ctgttccttg cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca 3600 aagttggcgt ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca 3660 gcaacgctct gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca 3720 aacccggcag cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc 3780 gccttacaac ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg 3840 gtgattttgt gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt 3900 gtggtgtaaa caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt 3960 actgaattaa cgccgaatta attcggggga tctggatttt agtactggat tttggtttta 4020 ggaattagaa attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc 4080 ttatatgctc aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact 4140 actcacacat tattatggag aaaatagagc ttgtcgatcg ttaattaatc agaagaactc 4200 gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga gcggcgatac cgtaaagcac 4260 gaggaagcgg tcagcccatt cgccgccaag ctcttcagca atatcagggg tagccaacgc 4320 tatgtcctga tagcggtccg ccacacccag ccggccacag tcgatgaatc cagaaaagcg 4380 gccattttcc accatgatat tcggcaagca ggcatcgcca tgtgtcacga cgagatcctc 4440 gccgtcgggc atgcgcgcct tgagcctggc gaacagttcg gctggcgcga gcccctgatg 4500 ctcttcgtcc agatcatcct gatcgacaag accggcttcc atccgagtac gtgctcgctc 4560 gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc ggatcaagcg tatgcagccg 4620 ccgcattgca tcagccatga tggatacttt ctcggcagga gcaaggtgag atgacaggag 4680 atcctgcccc ggcacttcgc ccaatagcag ccagtccctt cccgcttcag tgacaacgtc 4740 gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac gatagccgcg ctgcctcgtc 4800 ctggagttca ttcagggcac cggacaggtc ggtcttgaca aaaagaaccg ggcgcccctg 4860 cgctgacagc cgaaacacgg cggcatcaga gcagccgatt gtctgttgtg cccagtcata 4920 gccgaatagc ctctccaccc aagcggccgg agaacctgcg tgcaatccat cttgttcaat 4980 ccccatccta ggggacgcgt ggatcctcta gaggccgctt ggtatctgca ttacaatgaa 5040 atgagcaaag actatgtgag taacactggt caacactagg gagaaggcat cgagcaagat 5100 acgtatgtaa agagaagcaa tatagtgtca gttggtagat actagatacc atcaggaggt 5160 aaggagagca acaaaaagga aactctttat ttttaaattt tgttacaaca aacaagcaga 5220 tcaatgcatc aaaatactgt cagtacttat ttcttcagac aacaatattt aaaacaagtg 5280 catctgatct tgacttatgg tcacaataaa ggagcagaga taaacatcaa aatttcgtca 5340 tttatattta ttccttcagg cgttaacaat ttaacagcac acaaacaaaa acagaatagg 5400 aatatctaat tttggcaaat aataagctct gcagacgaac aaattattat agtatcgcct 5460 ataatatgaa tccctatact attgacccat gtagtatgaa gcctgtgcct aaattaacag 5520 caaacttctg aatccaagtg ccctataaca ccaacatgtg cttaaataaa taccgctaag 5580 caccaaatta cacattctc gtattgctgt gtaggttcta tcttcgtttc gtactaccat 5640 gtccctatat tttgctgcta caaaggacgg caagtaatca gcacaggcag aacacgattt 5700 cagagtgtaa ttctagatcc agctaaacca ctctcagcaa tcaccacaca agagagcatt 5760 cagagaaacg tggcagtaac aaaggcagag ggcggagtga gcgcgtaccg aagacggtag 5820 atctgctaga gtcagcttgt cagcgtgtcc tctccaaatg aaatgaactt ccttatatag 5880 aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat 5940 cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc 6000 tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttca acgatggcct 6060 ttcctttatc gcaatgatgg catttgtagg agccaccttc cttttccact atcttcacaa 6120 taaagtgaca gatagctggg caatggaatc cgaggaggtt tccggatatt accctttgtt 6180 gaaaagtctc aatcggacca tcacatcaat ccacttgctt tgaagacgtg gttggaacgt 6240 cttctttttc cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag 6300 aggcatcttc aacgatggcc tttcctttat cgcaatgatg gcatttgtag gagccacctt 6360 ccttttccac tatcttcaca ataaagtgac agatagctgg gcaatggaat ccgaggaggt 6420 ttccggatat taccctttgt tgaaaagtct caatcggacc tgcagaagct caccggtgcg 6480 gtccgcgtaa ctataacggt cctaaggtag cgaaagcttg tcgactatcg gacgagctca 6540 aagtttaacg cgttagcaga aggcatgttg ttgtgactcc gaggggttgc ctcaaactct 6600 atcttataac cggcgtggag gcatggaggc aggggtattt tggtcatttt aatagatagt 6660 ggaaaatgac gtggaattta cttaaagacg aagtctttgc gacaaggggg ggcccacgcc 6720 gaatttaata ttaccggcgt ggccccccct tatcgcgagt gctttagcac gagcggtcca 6780 gattaaagt agaaaatttc ccgcccacta gggttaaagg tgttcacact ataaaagcat 6840 atacgatgtg atggtatttg atggagcgta tattgtatca ggtatttccg ttggatacga 6900 attattcgta cgaccctcgg cgcgccgaga acttccagag ctttgggtac gtcacctatn 6960 gagaccgagg tctcntaagt cgagcgcgta gtcctcggta atatcgcaga acaaaagtac 7020 ctgatatcga gtgtacttca agtcagtggg aaatcaataa aatgattatt ttatgaatat 7080 atttcattgt gcaagtagat agaaattaca tatgttacat aacacacgaa ataaacaaaa 7140 aaagacaatc caaaaacaaa caccccaaaa aaaataatca ctttagataa actcgtatga 7200 ggagaggcac gttcagtgac tcgacgattc ccgagcaaaa aaagtctccc cgtcacacat 7260 gtagtgggtg acgcaattat ctttaaagta atccttctgt tgacttgtca ttgataacat 7320 ccagtcttcg tcaggattgc aaagaattat agaagggatc ccacctttta ttttcttctt 7380 ttttccatat ttagggttga cagtgaaatc agactggcaa cctattaatt gcttccacaa 7440 tgggacgaac ttgaagggga tgtcgtcgat gatattatag gtggcgtgtt catcgtagtt 7500 ggtgaaatcg atggtaccgt tccaatagtt gtgtcgtccg agacttctag cccaggtggt 7560 ctttccggta cgagttggtc cgcagatgta gaggctgggg tgtcggattc cattccttcc 7620 attgtccttg ttaaatcggc catccattca aggtcagatt gagcttgttg gtatgagaca 7680 ggatgtatgt aagtataagc gtctatgctt acatggtata gatgggtttc cctccaggag 7740 tgtagatctt cgtggcagcg aagatctgat tctgtgaagg gcgacacata cggttcaggt 7800 tgtggaggga ataatttgtt ggctgaatat tccagccatt gaagctttgt tgcccattca 7860 tgagggaatt cttccttgat catgtcaaga tattcctcct tagacgttgc agtctggata 7920 atagttctcc atcgtgcgtc agatttgcga ggagaaacct tatgatctcg gaaatctcct 7980 ctggttttaa tatctccgtc ctttgatatg taatcaagga cttgtttaga gtttctagct 8040 ggctggatat tagggtgatt tccttcaaaa tcgaaaaaag aaggatccct aatacaaggt 8100 tttttatcaa gctggagaag agcatgatag tgggtagtgc catcttgatg aagctcagaa 8160 gcaacaccaa ggaagaaaat aagaaaaggt gtgagtttct cccagagaaa ctggaataaa 8220 tcatctcttt gagatgagca cttgggatag gtaaggaaaa catatttaga ttggagtctg 8280 aagttcttac tagcagaagg catgttgttg tgactccgag gggttgcctc aaactctatc 8340 ttataaccgg cgtggaggca tggaggcagg ggtattttgg tcattttaat agatagtgga 8400 aaatgacgtg gaatttactt aaagacgaag tctttgcgac aagggggggc ccacgccgaa 8460 tttaatatta ccggcgtggc ccccccttat cgcgagtgct ttagcacgag cggtccagat 8520 ttaaagtaga aaatttcccg cccactaggg ttaaaggtgt tcacactata aaagcatata 8580 cgatgtgatg gtatttgatg gagcgtatat tgtatcaggt atttccgttg gatacgaatt 8640 attcgtacga ccctcatagt ttaaactatc agtgtttgac aggatatatt ggcgggtaaa 8700 cctaagagaa aagagcgttt attagaataa cggatattta aaagggcgtg aaaaggttta 8760 tccgttcgtc catttgtatg tgcatgccaa ccacagggtt cccctcggga tcaaagtact 8820 ttgatccaac ccctccgctg ctatagtgca gtcggcttct gacgttcagt gcagccgtct 8880 tctgaaaacg acatgtcgca caagtcctaa gttacgcgac aggctgccgc cctgcccttt 8940 tcctggcgtt ttcttgtcgc gtgttttagt cgcataaagt agaatacttg cgactagaac 9000 cggagacatt acgccatgaa caagagcgcc gccgctggcc tgctgggcta tgcccgcgtc 9060 agcaccgacg accaggactt gaccaaccaa cgggccgaac tgcacgcggc cggctgcacc 9120 aagctgtttt ccgagaagat caccggcacc aggcgcgacc gcccggagct ggccaggatg 9180 cttgaccacc tacgccctgg cgacgttgtg acagtgacca ggctagaccg cctggcccgc 9240 agcacccgcg acctactgga cattgccgag cgcatccagg aggccggcgc gggcctgcgt 9300 agcctggcag agccgtgggc cgacaccacc acgccggccg gccgcatggt gttgaccgtg 9360 ttcgccggca ttgccgagtt cgagcgttcc ctaatcatcg accgcacccg gagcgggcgc 9420 gaggccgcca aggcccgagg cgtgaagttt ggcccccgcc ctaccctcac cccggcacag 9480 atcgcgcacg cccgcgagct gatcgaccag gaaggccgca ccgtgaaaga ggcggctgca 9540 ctgcttggcg tgcatcgctc gaccctgtac cgcgcacttg agcgcagcga ggaagtgacg 9600 cccaccgagg ccaggcggcg cggtgccttc cgtgaggacg cattgaccga ggccgacgcc 9660 ctggcggccg ccgagaatga acgccaagag gaacaagcat gaaaccgcac caggacggcc 9720 aggacgaacc gtttttcatt accgaagaga tcgaggcgga gatgatcgcg gccgggtacg 9780 tgttcgagcc gcccgcgcac ggctcaaccg tgcggctgca tgaaatcctg gccggtttgt 9840 ctgatgccaa gctggcggcc tggccggcca gcttggccgc tgaagaaacc gagcgccgcc 9900 gtctaaaaag gtgatgtgta tttgagtaaa acagcttgcg tcatgcggtc gctgcgtata 9960 tgatgcgatg agtaaataaa caaatacgca aggggaacgc atgaaggtta tcgctgtact 10020 taaccagaaa ggcgggtcag gcaagacgac catcgcaacc catctagccc gcgccctgca 10080 actcgccggg gccgatgttc tgttagtcga ttccgatccc cagggcagtg cccgcgattg 10140 ggcggccgtg cgggaagatc aaccgctaac cgttgtcggc atcgaccgcc cgacgattga 10200 ccgcgacgtg aaggccatcg gccggcgcga cttcgtagtg atcgacggag cgccccaggc 10260 ggcggacttg gctgtgtccg cgatcaaggc agccgacttc gtgctgattc cggtgcagcc 10320 aagcccttac gacatatggg ccaccgccga cctggtggag ctggttaagc agcgcattga 10380 ggtcacggat ggaaggctac aagcggcctt tgtcgtgtcg cgggcgatca aaggcacgcg 10440 catcggcggt gaggttgccg aggcgctggc cgggtacgag ctgcccattc ttgagtcccg 10500 tatcaggcag cgcgtgagct acccaggcac tgccgccgcc ggcacaaccg ttcttgaatc 10560 agaacccgag ggcgacgctg cccgcgaggt ccaggcgctg gccgctgaaa ttaaatcaaa 10620 actcatttga gttaatgagg taaagagaaa atgagcaaaa gcacaaacac gctaagtgcc 10680 ggccgtccga gcgcaccgcag cagcaaggct gcaacgttgg ccagcctggc agacacgcca 10740 gccatgaagc gggtcaactt tcagttgccg gcggaggatc acaccaagct gaagatgtac 10800 gcggtacgcc aaggcaagac cattaccgag ctgctatctg aatacatcgc gcagctacca 10860 gagtaaatga gcaaatgaat aaatgagtag atgaatttta gcggctaaag gaggcggcat 10920 ggaaaatcaa gaacaaccag gcaccgacgc cgtggaatgc cccatgtgtg gaggaacggg 10980 cggttggcca ggcgtaagcg gctgggttgt ctgccggccc tgcaatggca ctggaacccc 11040 caagcccgag gaatcggcgt gacggtcg 11068 <210> 6 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> T2A module nucleotide sequence <400> 6 ggtctcngag ggcagaggaa gtcttctaac atgcggtgac gtggaggaga atcccggccc 60 tngagacc 68 <210> 7 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> P2A module nucleotide sequence <400> 7 ggtctcngct actaattttt ctcttcttaa gcaagctgga gatgttgaag aaaatcctgg 60 acccngagac c 71 <210> 8 <211> 422 <212> DNA <213> Artificial Sequence <220> <223> CmYLCV module nucleotide sequence <400> 8 ggtctcncta tctggcagac aaagtggcag acatactgtc ccacaaatga agatggaatc 60 tgtaaaagaa aacgcgtgaa ataatgcgtc tgacaaaggt taggtcggct gcctttaatc 120 aataccaaag tggtccctac cacgatggaa aaactgtgca gtcggtttgg ctttttctga 180 cgaacaaata agattcgtgg ccgacaggtg ggggtccacc atgtgaaggc atcttcagac 240 tccaataatg gagcaatgac gtaagggctt acgaaataag taagggtagt ttgggaaatg 300 tccactcacc cgtcagtcta taaatactta gcccctccct cattgttaag ggagcaaaat 360 ctcaagaga tagtcctaga gagagaaaga gagcaagtag cctagaagta gaaccngaga 420 cc 422 <210> 9 <211> 264 <212> DNA <213> Artificial Sequence <220> <223> AtHSP 3 prime UTR module nucleotide sequence <400> 9 ggtctcnata tgaagatgaa gatgaaatat ttggtgtgtc aaataaaaag cttgtgtgct 60 taagtttgtg tttttttctt ggcttgttgt gttatgaatt tgtggctttt tctaatatta 120 aatgaatgta agatctcatt ataatgaata aacaaatgtt tctataatcc attgtgaatg 180 ttttgttgga tctcttctgc agcatataac tactgtatgt gctatggtat ggactatgga 240 atatgattaa agataagnga gacc 264 <210> 10 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 1st Forward nucleotide sequence containing BasI enzyme site and overhang site <400> 10 ggtctcnaac c 11 <210> 11 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 1st Reverse nucleotide sequence containing BasI enzyme site and overhang site <400> 11 ggtctcncct c 11 <210> 12 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 2nd Forward nucleotide sequence containing BasI enzyme site and overhang site <400> 12 ggtctcnccc t 11 <210> 13 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 2nd Reverse nucleotide sequence containing BasI enzyme site and overhang site <400> 13 ggtctcntag c 11 <210> 14 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 3rd Forward nucleotide sequence containing BasI enzyme site and overhang site <400> 14 ggtctcnacc c 11 <210> 15 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 3rd Reverse nucleotide sequence containing BasI enzyme site and overhang site <400> 15 ggtctcnata t 11 <210> 16 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 1st Forward primer <400> 16 acggtctcna accatggtga gcaagggcga g 31 <210> 17 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 1st Reverse primer <400> 17 tgggtctcnc ctccttgtac agctcgtcca t 31 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 2nd Forward primer <400> 18 acggtctcnc cctgtgagca agggcgagga g 31 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 2nd Reverse primer <400> 19 tgggtctcnt agccttgtac agctcgtcca t 31 <210> 20 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 3rd forward primer <400> 20 acggtctcna cccgtgagca agggcgagga g 31 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> 3rd Reverse primer <400> 21 tgggtctcna tatttacttg tacagctcgt ccat 34 <210> 22 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> T2A site <400> 22 gcagaggaag tcttctaaca tgcggtgacg tggaggagaa tcccgg 46 <210> 23 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> P2A site <400> 23 ctaatttttc tcttcttaag caagctggag atgttgaaga aaatcctgg 49 <210> 24 <211> 400 <212> DNA <213> Artificial Sequence <220> <223> Promoter site <400> 24 ctggcagaca aagtggcaga catactgtcc cacaaatgaa gatggaatct gtaaaagaaa 60 acgcgtgaaa taatgcgtct gacaaaggtt aggtcggctg cctttaatca ataccaaagt 120 ggtccctacc acgatggaaa aactgtgcag tcggtttggc tttttctgac gaacaaataa 180 gattcgtggc cgacaggtgg gggtccacca tgtgaaggca tcttcagact ccaataatgg 240 agcaatgacg taagggctta cgaaataagt aagggtagtt tgggaaatgt ccactcaccc 300 gtcagtctat aaatacttag cccctccctc attgttaagg gagcaaaatc tcaagagagat 360 agtcctagag agagaaagag agcaagtagc ctagaagtag 400 <210> 25 <211> 242 <212> DNA <213> Artificial Sequence <220> <223> Terminator site <400> 25 gaagatgaag atgaaatatt tggtgtgtca aataaaaagc ttgtgtgctt aagtttgtgt 60 ttttttcttg gcttgttgtg ttatgaattt gtggcttttt ctaatattaa atgaatgtaa 120 gatctcatta taatgaataa acaaatgttt ctataatcca ttgtgaatgt tttgttggat 180 ctcttctgca gcatataact actgtatgtg ctatggtatg gactatggaa tatgattaaa 240 ga 242

Claims (16)

Consists of one sequence of SEQ ID NOs: 2 to 5,
A backbone vector for preparing a polycistronic expression vector, which is used to prepare a vector for polycistronic expression in plants.
A backbone vector in which a second restriction enzyme recognition site is inserted into a binary vector is used,
The backbone vector has one sequence of SEQ ID NOs: 2 to 5, and two overhang sequences are located at the cleavage site by the second restriction enzyme of the backbone vector,
the two overhang sequences are located on the forward strand and the reverse strand, respectively,
The following (1) promoter at the cleavage site by the second restriction enzyme; (2) a nucleotide sequence encoding one or more 2A peptides; (3) two or more target gene modules; and (4) a vector for polycistronic expression in plants, in which terminator elements are inserted.
(1) a promoter cleaved by a second restriction enzyme and comprising two overhang sequences complementary to an overhang sequence located in the backbone vector and an overhang sequence located in the target gene module after cleavage, respectively;
(2) located between the target gene modules, cleaved by the second restriction enzyme, and comprising two overhang sequences complementary to the overhang sequence located in the target gene module and the overhang sequence located in another target gene module after cleavage , a nucleotide sequence encoding one or more 2A peptides;
(3) between the promoter and the nucleotide sequence encoding the 2A peptide, or between the nucleotide sequence encoding two 2A peptides, or between the nucleotide sequence encoding the 2A peptide and the terminator, and is cleaved by a second restriction enzyme; two overhang sequences complementary to two of the overhang sequence located in the promoter after cleavage, the overhang sequence located in the nucleotide sequence encoding the 2A peptide, and the overhang sequence located in the terminator; two target gene-specific sequences respectively linked to the two complementary overhang sequences; and two or more target gene modules comprising a target gene; and
(4) A terminator cleaved by the second restriction enzyme and comprising two overhang sequences complementary to the overhang sequence located in the backbone vector and the overhang sequence located in the target gene module after cleavage, respectively.
3. The method of claim 2,
The two overhang sequences in the promoter are complementary to an overhang sequence located on the reverse strand of the backbone vector and an overhang sequence located at the forward 5' end of the first target gene module, respectively,
Two overhang sequences in the nucleotide sequence encoding the 2A peptide are complementary to an overhang sequence located at the reverse 5' end of the first target gene module and an overhang sequence located at the forward 5' end of the second target gene module, respectively,
In the target gene module, the two overhang sequences are i) complementary to an overhang sequence located at the reverse 5' end of the promoter and an overhang sequence located at the forward 5' end of the nucleotide sequence encoding the 2A peptide, respectively, or ii) each 1 Overhang sequence located at the reverse 5' end of the nucleotide sequence encoding the 2A peptide and the overhang sequence located at the forward 5' end of the nucleotide sequence encoding the second 2A peptide are complementary, or iii) each nucleotide encoding the 2A peptide complementary to an overhang sequence located at the reverse 5' end of the sequence and an overhang sequence located at the forward 5' end of the terminator;
The two overhang sequences in the terminator are complementary to the overhang sequence located in the forward strand of the backbone vector and the overhang sequence located in the reverse 5' end of the target gene module, respectively, a vector for polycistronic expression for plants.
3. The method of claim 2,
The binary vector is a pLSLR vector, a vector for polycistronic expression in plants.
3. The method of claim 2,
The backbone vector has the sequence of SEQ ID NO: 5, a vector for polycistronic expression for plants.
3. The method of claim 2,
The second restriction enzyme is BasI, a vector for polycistronic expression for plants.
7. The method of claim 6,
The vector for polycistronic expression for plants, wherein all of the overhang sequences include 4 bases.
7. The method of claim 6,
The vector for polycistronic expression for plants, wherein the two overhang sequences located in the backbone vector are 5'-ATAG-3' in the reverse strand and 5'-TAAG-3' in the forward strand.
7. The method of claim 6,
The elements inserted into the polycistronic expression vector are: a promoter - a first gene module of interest - a nucleotide sequence encoding the first 2A peptide - a second target gene module - a nucleotide sequence encoding the second 2A peptide - a third object Gene module - a vector for polycistronic expression in plants, which is inserted in terminator sequence.
10. The method of claim 9,
The promoter comprises 5'-CTAT-3' at the 5' end of the forward direction and 5'-GGTT-3' overhang sequence at the 5' end of the reverse direction,
The first target gene module includes 5'-AACC-3' at the 5' end of the forward direction and 5'-CCTC-3' overhang sequence at the 5' end of the reverse direction,
The nucleotide sequence encoding the first 2A peptide comprises 5'-GAGG-3' at the 5' end of the forward direction and 5'-AGGG-3' overhang sequence at the 5' end of the reverse direction,
The second target gene module includes 5'-CCCT-3' at the 5' end of the forward direction and 5'-TAGC-3' overhang sequence at the 5' end of the reverse direction,
The nucleotide sequence encoding the second 2A peptide includes 5'-GCTA-3' at the 5' end of the forward direction and 5'-GGGT-3' overhang sequence at the 5' end of the reverse direction,
The third target gene module includes 5'-ACCC-3' at the 5' end of the forward direction and 5'-ATAT-3' overhang sequence at the 5' end of the reverse direction,
The terminator is a vector for polycistronic expression for plants, comprising a 5'-ATAT-3' end at the 5' end of the forward direction and a 5'-CTTA-3' overhang sequence at the 5' end of the reverse direction.
10. The method of claim 9,
The nucleotide sequence encoding the first 2A peptide and the nucleotide sequence encoding the second 2A peptide have the sequences of SEQ ID NOs: 22 and 23, respectively, except for the overhang sequence, a vector for polycistronic expression for plants.
7. The method of claim 6,
The promoter and terminator, except for the overhang sequence, has the sequence of SEQ ID NOs: 24 and 25, respectively, a vector for polycistronic expression for plants.
a backbone vector having one of SEQ ID NOs: 2-5;
a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 6 is inserted;
a cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 7 is inserted;
cloning vector into which the promoter sequence of SEQ ID NO: 8 is inserted;
a cloning vector into which the terminator sequence of SEQ ID NO: 9 is inserted;
a first target gene module;
a second target gene module; and
prepared from a third target gene module,
The first target gene module includes a sequence of SEQ ID NOs: 10 and 11, a first target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 10 and 11, and a first target gene,
The second target gene module includes a sequence of SEQ ID NOs: 12 and 13, a second target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 12 and 13, and a second target gene,
The third target gene module, the sequence of SEQ ID NOs: 14 and 15, a third target gene-specific sequence linked to the 3' end of each of the sequences of SEQ ID NOs: 14 and 15, and a third target gene, Vectors for polycistronic expression in plants.
14. The method of claim 13,
The cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 6 is inserted, the cloning vector into which the nucleotide sequence encoding the 2A peptide of SEQ ID NO: 7 is inserted, the cloning vector into which the promoter sequence of SEQ ID NO: 8 is inserted, and SEQ ID NO: 9 The cloning vector used for the cloning vector into which the terminator sequence of is inserted is pLUG-Prime, pCR2.1, or pGEM-T, respectively, a vector for polycistronic expression in plants.
A plant transformed with the vector for polycistronic expression for a plant according to any one of claims 2 to 14.
15. A method for producing a vector for polycistronic expression in a plant according to any one of claims 2 to 14,
inserting a second restriction enzyme recognition site into a binary vector to prepare a backbone vector having one of SEQ ID NOs: 2 to 5;
preparing a cloning vector into which a promoter sequence having a second restriction enzyme recognition site is inserted;
preparing a cloning vector into which a nucleotide sequence encoding a 2A peptide having a second restriction enzyme recognition site is inserted;
preparing a target gene module having a second restriction enzyme recognition site;
preparing a cloning vector into which a terminator sequence having a second restriction enzyme recognition site is inserted;
The backbone vector, the cloning vector into which the promoter sequence is inserted, the cloning vector into which the nucleotide sequence encoding the 2A peptide is inserted, the target gene module, and the cloning vector into which the terminator sequence is inserted, are mixed, and then a second restriction enzyme and ligase are added. A method for producing a vector for polycistronic expression in plants, comprising the step of simultaneously performing the enzymatic digestion and ligation process.

Images