CN110951728A - Transgenic corn BBHTL8-1 exogenous insert flanking sequence and application thereof - Google Patents

Abstract

The invention discloses a flanking sequence of a transgenic insect-resistant herbicide-resistant corn BBHTL8-1 exogenous insert and application thereof. The nucleotide sequences of the flanking sequences are respectively shown in a sequence table SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The invention also provides a primer pair for detecting the 3' end flanking sequence. The identification of the flanking sequence of the exogenous insert of the transgenic insect-resistant herbicide-resistant quality-improved corn BBHTL8-1 is suitable for detecting related materials of corn BBHTL8-1 including parents, hybrid seeds and offspring, including plants, tissues, seeds and related products.

Description

Transgenic corn BBHTL8-1 exogenous insert flanking sequence and application thereof

Technical Field

The invention belongs to the technical field of plant biology, and particularly relates to a flanking sequence of a transgenic insect-resistant herbicide-resistant corn BBHTL8-1 exogenous insert and application thereof.

Background

Corn is an important grain crop in China, is also an important feed and industrial raw material, and plays an important role in guaranteeing national grain safety and national economic development. The corn borers and the diabrotica leaves cause great loss to the corn production in China every year. Weeds also cause serious harm to the production of corns in China, the yield is reduced by 10-30% in general year, the serious yield can reach more than 50%, and the production cost is greatly increased by means of artificial weeding along with the increase of labor cost. In order to prevent and control pests and reduce weed, farmers often use a large amount of highly toxic chemical pesticides to prevent and control, so that the corn pesticide residue is serious, and the pesticide spraying process is easy to cause poisoning accidents and seriously harms the health of people. The development of insect-resistant and herbicide-resistant corn is of great significance to the development of the corn industry in China.

The transgenic technology provides a new molecular breeding approach for the genetic improvement of the corn. The insect-resistant and herbicide-resistant transgenic crops cultured by utilizing the transgenic technology are effective means for controlling agricultural pests and preventing and removing weeds, can effectively reduce the dependence of farmers on chemical insecticides, reduce the labor cost, improve the yield and the quality of corns, and have important significance for protecting the ecological environment and the biodiversity.BtGeneCry1AbThe gene is mainly applied to insect-resistant genes aiming at lepidoptera pests such as corn borers and cotton bollworms. Transgenic varieties such as MON810 by Monsanto, TC1507 by DuPont, Bt11 and Bt176 by Nahenda, DP4114 by Pioneer, and the likeCry1AbAnd the commercial planting popularization is realized.Cry3BbMainly aiming at coleoptera insects such as corn Diabrotica bimaculata, MON863 and MON88017 of MonsantoCry3Bb1Can be used for resisting corn rootworm coleoptera pests. Glyphosate (Glyphosate) is a systemic, broad-spectrum and foliar organic phosphine herbicide, is successfully developed by Monsanto company in 1971, is the best herbicide sold worldwide, and has the characteristics of high efficiency, low toxicity, easy degradation and the like. It can competitively inhibit the activity of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in the shikimate pathway of plants and bacteria. NK603, MON87427 of Monsanto will have glyphosate herbicide resistancecp4epspsThe gene is transferred into crops, so that the crops have glyphosate resistance and are commercially applied on a large scale.

Vitamin E (tocopherol) has an important antioxidant function and is essential for animals and humansA fat-soluble vitamin contains 8 kinds of tocopherol, i.e. α, β, gamma, delta-tocopherol and α, β, gamma, delta-tocotrienol, wherein the corn mainly contains α, β, gamma, delta-tocopherol, α -tocopherol activity is the highest, and the gamma-tocopherol content is the highest in the corn, but the activity is only α -tocopherol 1/10.ZmHPTCan increase the total content of vitamin E in plant body.ZmTMTThe method can convert low-activity gamma-tocopherol into high-activity α -tocopherol, the combination of the two genes can obviously improve the content of α -tocopherol in the corn, the commercial development situation of 2018-year global biotechnology/transgenic crop released by the international agricultural biotechnology application service organization shows that the transgenic crop in 2018 continuously keeps high application rate, the global planting area reaches 1.917 hundred million hectares, the planting area of the transgenic crop with the composite insect-resistant character accounts for 42% of the global planting area, in the United states, the planting area of the transgenic corn with the composite character accounts for 76% of the total planting area of the corn, the transgenic crop with the composite character has the advantages of low cost, high efficiency, convenient management, less investment and the like, and more applications and favor of farmers can be obtained.

The key of the insect resistance of the transgenic crops is to obtain excellent insecticidal protein with insect resistance, and BT insecticidal protein is commonly used at present, such as BT insecticidal proteinCry1Ab、Cry1F、Cry2BbAnd the like. The use of a single insecticidal protein alone is likely to cause resistance development and development in pests. The transgenic crops containing a plurality of insect-resistant proteins can be cultivated to effectively delay the occurrence of insect resistance, and the trend of planting the transgenic crops with compound characters is already. In addition to the properties of insect resistance and herbicide resistance, other excellent properties such as potato with the properties of browning prevention, low acrylamide content, late blight resistance and the like, apple with the property of browning prevention, drought-tolerant sugarcane, transgenic golden rice containing provitamin A transformant GR2E and the like are introduced into the transgenic plants. The transgenic corn which is not commercially planted in China is developed in different stages of environmental safety evaluation, the transgenic corn which is cultivated by the method has the characteristics of insect resistance, herbicide tolerance and vitamin E-rich composite character, the content of the vitamin E in grains is increased, the feed requirement can be met, the feed production cost can be reduced, and the chemical synthesis production cost can be reducedResulting in contamination. After the safety production certificate is obtained through transgenic safety evaluation in the future, the method can be applied to commercial planting, effectively reduces the occurrence of the corn borers, the occurrence of weeds, reduces the labor cost and the use of pesticides, and improves the production benefit of the corn.

Disclosure of Invention

The invention aims to provide a flanking sequence of a transgenic insect-resistant herbicide-resistant corn BBHTL8-1 exogenous insert and application thereof.

A transgenic corn BBHTL8-1 exogenous insertion flanking sequence, wherein the nucleotide sequences of the flanking sequence are respectively shown in sequence tables SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

The exogenous insert comprises an insect-resistant geneCry1Ab、Cry3BbGlyphosate resistant genecp4epspsGene, cornZmHPTAndZmTMTa gene.

The exogenous insertion sequence and the flanking sequence of the transgenic corn BBHTL8-1 are applied to detection of the transgenic corn BBHTL 8-1.

The specific primer pair for detecting the transgenic corn BBHTL8-1 has a nucleotide sequence shown in a sequence table SEQ ID NO: 3-4.

A kit for detecting transgenic corn BBHTL8-1 contains the specific primer pair.

The specific primer pair is applied to detection of transgenic maize BBHTL8-1 parents, descendants, hybrid F1, and plants, tissues, seeds or products thereof.

A method for detecting transgenic corn BBHTL8-1 is characterized in that total DNA of a sample is used as a template, a PCR reaction is carried out by utilizing the specific primer pair, and if the size of an amplification product band is 240 bp, the sample to be detected contains components from BBHTL 8-1.

The invention has the beneficial effects that: the invention relates to an insect-resistant gene according to the codon usage frequency of cornCry1Ab、Cry3BbAnd glyphosate resistance genecp4epspsOptimizing gene codon to make it express and translate efficiently in cornCry1Ab、Cry3BbAndcp4epspsand from maizeZmHPTAndZmTMTconstruction of genes into the plant surfaceAnd (3) obtaining a vector, transforming the immature embryo by adopting an agrobacterium infection method, and obtaining the transgenic corn with insect resistance and herbicide tolerance composite resistance by taking the glyphosate as selection pressure. The insertion positions of foreign fragments are analyzed by utilizing whole genome sequencing and flanking sequence sequencingCry1Ab、Cry3Bb、cp4epsps、ZmHPTAndZmTMTthe gene expression level and the protein expression level are analyzed, and meanwhile, the insect resistance and the herbicide performance of the transgenic corn and the vitamin E content of grains are evaluated. The BBHTL8-1 transgenic corn is likely to enter into commercial planting in the future. The invention provides a flanking sequence of an exogenous insertion fragment of an insect-resistant herbicide-resistant transgenic corn BBHTL8-1 insertion site, which is a 3' end flanking sequence of the exogenous insertion fragment. The flanking sequence of the specific transgenic event is specific, and the integration segment of the flanking sequence and the exogenous genome may be PCR amplified to detect specific PCR band via designing primer containing at least partial flanking sequence and at least partial exogenous insertion segment. Designing an upstream specific primer on the exogenous insert fragment, designing a downstream specific primer on the 3' flanking sequence, and amplifying the specific fragment. Or designing an upstream specific primer according to a flanking sequence at the 5' end, designing a downstream specific primer according to an exogenous insert, and amplifying a specific fragment.

Drawings

FIG. 1 is a map of pL8 plasmid.

FIG. 2 isCry1Ab、Cry3Bb、ZmTMT、ZmHPT、cp4epspsDetecting the gene in BBHTL8-1 material specificity PCR;

in the figure, the negative control is Zheng 58, the positive control is transgenic T1 generation plants, and the Marker is 100 bp molecular weight standard.

FIG. 3 BBHTL8-1 material-specific PCR assay;

in the figure, 1: BBHTL8-1 corn line; 2: positive control (transgenic T1 generation plants); 3: negative control (non-transgenic zheng 58 control); m: 100 bp molecular weight standard.

FIG. 4 is a drawing showingCry1Ab、Cry3Bb1、cp4epsps、ZmHPT、ZmTMTThe gene expression level in 5 leaf stage and mature stage of BBHTL8-1 material;

in the figure (A) isCry1Ab、Cry3Bb1、cp4epsps、ZmHPT、ZmTMTThe gene is expressed in 5-leaf stage of BBHTL8-1 material; (B) is composed ofCry1Ab、Cry3Bb1、cp4epsps、ZmHPT、ZmTMTThe gene is expressed in the mature period of BBHTL8-1 material.

FIG. 5 shows the evaluation of herbicide resistance of BBHTL8-1 material, and the growth of transgenic BBHTL8-1 material and non-transgenic control material after spraying glyphosate for 1 week.

FIG. 6 evaluation of field insect resistance of BBHTL8-1 material;

the phenotype of non-transgenic plants and BBHTL8-1 on leaves (A-B) and ears (C-D) after the indirect insects in the field, white arrows indicate the location of wormholes, and the negative control is non-transgenic corn material Zheng 58.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

EXAMPLE 1 acquisition of transgenic Material

Codon usage frequency pairs according to maizeCry1Ab、Cry3BbAndcp4epspsthe gene is codon-optimized, and the optimized genecp4epsps、Cry1AbAndCry3Bbgenes and from maizeZmHPTAndZmTMTthe gene is constructed into a plant expression vector, the vector skeleton is from a pCAMBIA1300 vector sequence, the vector size is 25221 bp, the vector map is shown in figure 1, wherein the inclusion between RB and LBCry1Ab, ZmTMT, ZmHPT, Cry3Bb and cp4epspsFive expression cassettes (Table 1-Table 5).

TABLE 1 Cry1Ab expression cassettes

Name (R)	Size and breadth	Function(s)
			E35S	619 bp	The cauliflower mosaic virus 35S promoter (double CaMV 35S) contains a repeat enhancer region.
Act2 intron	591 bp	The first intron of the rice actin gene Act2 stabilizes expression of Cry1 Ab.
			Cry1Ab	2451 bp	Derived from Bacillus thuringiensiscry1AbA gene expressing a Cry1Ab protein, resistant to lepidopteran insects.
Tnos	224 bp	Derived from the 3' non-transcribed region of the nopaline synthase from Agrobacterium, terminates transcription and directs the polyadenylation of the information RNA.

TABLE 2 ZmTMT expression cassette

Name (R)	Size and breadth	Function(s)
			GLB1	1439 bp	The corn embryo specific promoter GLB1 enables the target gene to be specifically and highly expressed in the embryo of the corn.
ZmTMT	1059 bp	Is derived from corn, is a key enzyme in a vitamin E synthetic pathway, and can improve the content of α vitamin E in seeds.
			Tglb1	986 bp	Derived from corn embryo specific geneGLB1The 3' non-transcribed region of (a), terminates transcription, and directs polyadenylation of the message RNA.

TABLE 3 ZmHPT expression cassette

Name (R)	Size and breadth	Function(s)
			GLB1	1620 bp	The corn embryo specific promoter GLB1 enables the target gene to be specifically and highly expressed in the embryo of the corn.
ZmHPT	1200 bp	Derived fromCorn, a key enzyme in the vitamin E synthesis pathway, can increase the total content of vitamin E in seeds.
			Tglb1	986 bp	Is derived from the 3' non-transcribed region of the corn embryo specific gene GLB1, terminates transcription and directs the polyadenylation of the messenger RNA.

TABLE 4 Cry3Bb expression cassettes

Name (R)	Size and breadth	Function(s)
			OsACT2	1405 bp	The 5' end region of rice actin gene contains promoter, transcription initiation point and the first intron.
Cry3Bb	1965 bp	Derived from a Bacillus thuringiensis Cry3Bb gene, expresses a Cry3Bb protein and is resistant to coleopteran insects.
			Thsp17	211 bp	The 3' non-transcribed region of the heat shock protein Hsp17 from wheat terminates transcription and directs the polyadenylation of messenger RNA.

TABLE 5 cp4epsps expression cassette

Name (R)	Size and breadth	Function(s)
			Ubi	1994 bp	The 5' end region of the maize ubiquitin protein gene comprises a promoter, a transcription starting point and a first intron.
ZmEPSP	189 bp	Derived from the chloroplast transit peptide DNA sequence of maize EPSPS, directs the CP4EPSPS protein into the chloroplast where aromatic amino acid is synthesized.
			cp4epsps	1368 bp	DNA sequence from Agrobacterium CP4 strain, encoding synthetic CP4EPSPS, glyphosate resistant.
T35S	185 bp	Is derived from the 3' non-transcribed region of cauliflower mosaic virus 35S, terminates transcription and guides information RNA polyadenylation.

Agrobacterium-mediated transformation methods were used. This was done according to the method of Agrobacterium-mediated transformation of mail organisms using a standard binding vector system, Plant Physiology, 2002,129: 13-22.

Obtaining transformation starting material, namely taking corn young ears pollinated for 9-12 days, stripping young embryos, and placing the young embryos in a liquid culture medium for infection, wherein the liquid culture medium is used for agrobacterium infection.

And (3) transformation: the plasmid PL8 containing the gene of interest was transformed into Agrobacterium EHA105 strain to OD₆₀₀And when the concentration is not less than 0.3 and not more than 0.4, resuspending the agrobacterium with the infection solution, putting the corn material into the invasion dye solution, and carrying out agrobacterium infection.

Glyphosate was added to the medium as a selective pressure and the transformed material was subjected to selection culture, subcultured every two weeks. After 2-3 months of selective culture, the resistant callus grows rapidly on the selective culture medium and is fresh in color. Transferring the resistant callus to a regeneration medium to obtain a mature embryoid body. And (4) putting the embryoid on an MS culture medium for rooting to obtain the regenerated corn seedling. Backcross breeding is carried out on the positive plants obtained by transformation and the contrast Zheng 58 for multiple generations, and BBHTL8-1 transgenic plants are obtained by screening.

Example 2 detection of foreign genes in BBHTL8-1 transformation Material

Adopting a plant genome DNA extraction kit of the whole gold company to extract BBHTL8-1 genome DNA, and respectively aligningCry1Ab、Cry3BbAndcp4epspsthe gene is specifically amplified. The primer sequences are shown in Table 6.

TABLE 6 primer information for detection of foreign genes in BBHTL8-1 transformation Material

The PCR (polymerase chain reaction) reaction system is as follows:

2xTSINGKE Master Mix 10 µl

Forward primer (10 µM) 0.4 µl

Reverse primer (10 µM) 0.4 µl

ddH₂O 8.2 µl

DNA template 1.0 μ l

The PCR reaction procedure was as follows:

94℃ 3 min

94℃ 30 s

58℃ 30 s 35 cycles

72℃ 30 s

72℃ 10 min

after the reaction, the PCR product was subjected to agarose gel electrophoresis, and the results of the PCR electrophoresis are shown in FIG. 2.

Example 3 flanking sequence analysis and specific PCR detection of BBHTL8-1

The inventor carries out continuous 3 generations (BC 4F1, BC5F1 and BC6F 1) of exogenous gene PCR detection on the BBHTL8-1 backcrossed and transferred offspring in the previous experiment, and the PCR result shows that the exogenous gene is stably inherited in the offspring of the transgenic plant, and the segregation ratio of the transgenic plant and the non-transgenic plant accords with the Mendel inheritance rule of a single copy gene and is single copy insertion.

The inventors have detected the integration of the exogenous gene of interest in the genome of BBHTL8-1 by means of a whole-gene re-sequencing method and a PCR technique. The obtained sequencing result is combined with bioinformatics analysis, and the exogenous insertion sequence is integrated on the chromosome of the corn. The foreign gene of BBHTL8-1 is inserted between the corn genome Chr4: 180575645-180577000.

The inventor determines the integration position of the exogenous gene in the genome by a high-throughput re-sequencing method and a PCR sequencing method, and the flanking sequence of the BBHTL8-1 event is sequenced by PCR as follows, and the left flanking sequence is shown as SEQ ID NO: 1, and the right flanking sequence is shown as SEQ ID NO: 2, respectively. The primer pair for 3' end specificity PCR detection consists of SEQ ID NO: 3 and a single-stranded DNA molecule as set forth in SEQ ID NO: 4, and the amplified sequence is shown as SEQ ID NO: 5, respectively.

BBHTL8-1 genome DNA is extracted by adopting a plant genome DNA extraction kit of the whole gold company, and the 3' end sequence of the inserted fragment is subjected to specific PCR amplification. The sequence of the amplification primer is as follows:

BBHTL8-1N: 5’-GATTAGTTGAGCGGTGGCAAC-3’； （SEQ ID NO：3）

NosRBfw3: 5’-TGATTAGAGTCCCGCAATTAT-3’。 （SEQ ID NO：4）

the theoretical amplification size was 240 bp (SEQ ID NO: 5).

The PCR (polymerase chain reaction) reaction system is as follows:

2xTSINGKE Master Mix 10 µl

Forward primer (10 µM) 0.4 µl

Reverse primer (10 µM) 0.4 µl

ddH₂O 8.2 µl

DNA template 1.0 μ l

The PCR reaction procedure was as follows:

94℃ 3 min

94℃ 30 s

58℃ 30 s 35 cycles

72℃ 30 s

72℃ 10min

after the reaction, the PCR product was subjected to agarose gel electrophoresis, and the results of the PCR electrophoresis are shown in FIG. 3.

Example 4 BBHTL8-1 exogenous Gene qRT-PCR detection

Extracting RNA from the roots, stems, leaves of seedlings of 5 leaves of a maize BBHTL8-1 plant and the roots, stems, leaves and seeds of mature plants in a mature period. RNA extraction was performed by the method of SV Total RNA Isolation System (Promega, USA) and Reverse Transcription by the method of A3500-Reverse Transcription System (Promega, USA). The primers for qRT-PCR detection of foreign genes are shown in Table 7. SYBR Premix ExTaqTM (CodedRR041A, TAKARA) fluorescent quantitation kit was used, and PCR instrument was an Applied Biosystems (http:// www.AppliedBiosystems.com) Prism 7500 analyzer. BBHTL8-1 plantCry1Ab、Cry3Bb、 cp4epsps、ZmHPTAndZmTMTthe expression levels at the 5-leaf stage and the mature stage are shown in FIG. 4.

TABLE 7 foreign genes qRT-PCR primer information in BBHTL8-1 transformation Material

Example 5 BBHTL8-1 method for determining target protein and detecting its expression in different tissues

Enzyme-linked immunosorbent assay (ELISA) method is adopted for the samples of whole upper plants and grains of BBHTL8-1 corn and non-transgenic control cornCry1Ab、Cry3Bb、CP4EPSPS、ZmHPT、ZmTMTThe expression level of the protein is analyzed and detected. The assay was performed according to the kit instructions from EnviroLogix.

The materials are respectively taken at five leaf stage, flowering stage and mature stage of the corn growth, and comprise tissues such as roots, stems, leaves, spica, seeds and the like.

Taking 50 mg of plant material, grinding the plant material into powder by using liquid nitrogen, adding 300 muL of protein to extract buffer, dissolving the protein, centrifuging at 12,000 rpm, taking 200 muL of supernatant, and storing at-80 ℃; further diluted 100 times for use. Positive control: the corn kernel dry powder contains Cry1Ab 30 mug/g, Cry3Bb 30 mug/g, CP4EPSPS 40 mug/g, ZmHPT 5 mug/g and ZmTMT 5 mug/g respectively. The negative control is non-transgenic inbred line Zheng 58.

The ELISA procedure was as follows:

respectively taking 50 mu L of the diluted sample, adding the diluted sample into an enzyme label plate for reaction, and repeating the reaction for three times; incubating for 30 minutes at room temperature; removing the supernatant, and washing with wash buffer for 3-4 times; adding 50 mu L Cry1Ab respectively、Cry3Bb、CP4EPSPS、ZmHPT、ZmTMTAntibodies to different proteins; incubating for 1 hour at room temperature; removing the supernatant, and washing with wash buffer for 3-4 times; adding 100 muL of substrate, and incubating for 30 minutes at room temperature; adding 100 mu L of reaction stopping solution; OD450 light absorption determination is carried out by utilizing an enzyme-labeling instrument; the concentrations and contents of Cry1Ab, Cry3Bb, CP4EPSPS, ZmHPT and ZmTMT proteins were calculated from the OD450 values obtained by the measurement and the standard curve, respectively. BBHTL8-1 is in the 5-leaf stage, flowering stage and growing stageThe Cry1Ab, Cry3Bb, CP4EPSPS, ZmHPT and ZmTMT protein contents in the transgenic material at maturity are shown in tables 8-10.

TABLE 8 BBHTL8-1 transgenic Material 5 leaf stage Cry1Ab, Cry3Bb, CP4EPSPS, ZmHPT and ZmTMT protein content

Note: values are mean ± means standard deviation. Negative controls were not detected after subtraction of background values and are indicated as "-".

TABLE 9 BBHTL8-1 transgenic Material florescence Cry1Ab, Cry3Bb, CP4EPSPS, ZmHPT and ZmTMT protein content

Note: values are mean ± means standard deviation. Negative controls were not detected after subtraction of background values and are indicated as "-".

TABLE 10 BBHTL8-1 transgenic Material maturity levels Cry1Ab, Cry3Bb, CP4EPSPS, ZmHPT, and ZmTMT proteins

Note: values are mean ± means standard deviation. Negative controls were not detected after subtraction of background values and are indicated as "-".

Example 6 BBHTL8-1 field Glyphosate resistance test

Test materials: transgenic material and non-transgenic wild type control material were planted in 6 rows (3 replicates) of each material, 4 m long, 60 cm row spacing, and 30 cm plant spacing.

The test method comprises the following steps: the PCR positive transgenic plants are sprayed with glyphosate (41% emulsion) with different concentrations in the 3-4 leaf period and the large horn mouth period of the seedlings, the using concentrations are respectively 5 times of the general normal using concentration (3 mL/L), and the plant death rate is investigated after one week and two weeks by spraying clear water in contrast.

And (3) test results: the results show that spraying 15 mL/L glyphosate, BBHTL8-1 growth was unaffected, while all controls died (see FIG. 5). BBHTL8-1 has glyphosate resistance over 5 times higher than that of normal field, and is high glyphosate resistant transgenic corn.

Example 7 BBHTL8-1 resistance test to corn borer in the field

Test materials: BBHTL8-1 and non-transgenic control Zheng 58. Transgenic material and non-transgenic wild type control material are planted according to 6 rows of each material, the row length is 4 meters, the row spacing is 60 cm, the plant spacing is 30 cm, and the cell spacing is 2 meters.

The test method comprises the following steps: and (3) inoculating 20-30 newly hatched corn borers to each plant in each cell in the large-horn-mouth period of the seedling, inoculating 50-60 plants to each cell, and counting insect pests including the size, the number, the distribution and the like of wormholes on damaged leaves after 3 weeks of growth. The 9-grade insect-resistant grading standard formulated by the International Cooperation group of corn borers is as follows: grade 1-3: the wormhole needle is needle-punched (level 1: rare, dispersed; level 2: medium amount; level 3: large amount). 4-6 level: the size of the head of the wormhole match (4 grade: rare and scattered; 5 grade: medium quantity; 6 grade: large quantity). 7-9 level: the wormholes are larger than the match heads (7 grade: rare dispersion; 8 grade: medium amount; 9 grade: large amount). Resistance grade classification: 1-2.9 (high resistance), 3-4.9 (insect resistance), 5-6.9 (insect sensitivity), and 7-9 (high sensitivity).

And (3) test results: the results show that all the leaves of the transgenic plants are only damaged by the size of pinholes and are small in quantity, most (> 98%) of the leaves of the non-transgenic control plants have more wormholes than match heads, the number of the wormholes is large, the damage is serious (see figure 6), and the resistance identification result shows that the BBHTL8-1 has high resistance to the corn borer.

Example 8 determination of vitamin E content in BBHTL8-1 grains

The total content of vitamin E in plants can be increased by ZmHPT, and the low-activity gamma-tocopherol can be converted into high-activity α -tocopherol by ZmTMT, the vitamin E is extracted by a methanol/chloroform extraction method, and the content of the vitamin E in BBHTL8-1 and a non-transgenic control is detected by HPLC (high performance liquid chromatography), wherein the method comprises the following steps:

respectively will rotateGrinding the gene corn seed and the non-transgenic control into powder, weighing 100 mg, adding 600 μ L methanol/chloroform (2: 1), and mixing; adding 200 mu L of chloroform, and mixing uniformly; addition of ddH₂O, 250 mu L, and mixing evenly; 10,000 rpm, room temperature, 20 min; absorbing the lower-layer chloroform (the volume of each sample is equal) to a new EP tube, and blowing the chloroform by nitrogen; mixing with 100 μ L of anhydrous ethanol, and measuring vitamin E content by HPLC.

The result shows that the content of VE in the non-transgenic plant is the highest by gamma-tocopherol, about 4.27mg/100g, while the content of α -tocopherol in the transgenic plant is the highest by average 0.91 mg/100g of the control, which is increased to 8.21 mg/100g at the highest, and is increased by about 6 times, and the total tocopherol is also increased to 9.09 mg/100g from the original 6.98 mg/100g, which is increased by about 30%.

TABLE 11 measurement of vitamin E content in BBHTL8-1 transgenic plant seed

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> transgenic corn BBHTL8-1 exogenous insert flanking sequence and application thereof

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>680

<212>DNA

<213> corn (Zea mays L.)

<400>1

gtcgagtgag acagaatcta cttctagttg cataactgag tgaggctcaa aggaacactt 60

agtcatgaaa atctatatca tatagcaaag atgcttttga agatcccgac aatattttcg 120

tctacattat tcgccaccgc gtgtaactct ttattaacta taaaggactt tatgcttatt 180

atattttaat tccagacact aatagcaggt aacacgtatg tgattaatac tttagataat 240

ctattaattc ggctaaaata ccttataatt taggataaat tttggatgct tctgtacgga 300

atatctaaga cgcccttctt catccgcatt tgcagttctg tactcatgca cttgtcagtg 360

tcaaggcttg ccaatgttca gccgaaaaga aaaacagctc acggtccacg gaaaaaataa 420

atctgtcgct gggtagccca cgatcgcata aatgaagatg gttggcgatc gacatgcagc 480

ccgccagcgg tccgacggaa tggatgattg gggcatcccc acattggttc tgtaaaagtg 540

gctgatcact tatcctttag aggccgttgc ctagtttgtt aggggaccga gtccgccgca 600

tttaccagcg cgctgtgccc gcgtagtggc cgcgacgccc gcccaaagca gcatgcgtgg 660

agccatctcc tgtatttata 680

<210>2

<211>645

<212>DNA

<213> corn (Zea mays L.)

<400>2

atctctcata ctctttcatg gtatcattcg tctactgatc cttccgtctc tttcgctgcc 60

tatcccttcc tctcctcgtc tatcgtcatg tcagccagctcgagctcgtc gggcaccaat 120

ccgttcgccg ctgctaccgc agtagcgatc tcggttgcca ccgctcaact aatcaacatc 180

aagtcccacg ttcccgtgat gcttgatctc ggcgactcca acttcggcac atggcgcacc 240

ttcttcctca tcgcgttccg caagttcagt gtcctcgacc acatcgacct gatgcttgac 300

gacgccgagt ggacgcagat cgatacttgc atcgtctcct ggctctacac cacgctctcc 360

tccgacctcc tctccgtcgt catccagccg accgacgatg cctacaccac ctggaccgcc 420

atcaccgacc agttcctcga caacgtcgtg tatcggactg tccaggctcg tcagcagttc 480

cacgggcttc accaggggga catgacgatc acgacgtact gcggccagct caaggtcctg 540

actgacacgc tccgcgacat cggtgctccc gtctctgacc ccgacctcgt cgtcagcctc 600

ctcagcggcc tcaacgacaa gttcgccaac tgcgtcacaa ccatc 645

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gattagttga gcggtggcaa c 21

<210>4

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgattagagt cccgcaatta t 21

<210>5

<211>240

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata tagtggctga 60

tcacttatct ctcatactct ttcatggtat cattcgtcta ctgatccttc cgtctctttc 120

gctgcctatc ccttcctctc ctcgtctatc gtcatgtcag ccagctcgag ctcgtcgggc 180

accaatccgt tcgccgctgc taccgcagta gcgatctcgg ttgccaccgc tcaactaatc 240

Claims (7)

1. A transgenic maize BBHTL8-1 exogenous insertion flanking sequence is characterized in that the nucleotide sequences of the flanking sequence are respectively shown in a sequence table SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

2. The transgenic maize BBHTL8-1 exogenous insertion flanking sequence of claim 1, wherein the exogenous insertion fragment comprises an insect-resistant geneCry1Ab、Cry3BbGlyphosate resistant genecp4epspsGene, cornZmHPTAndZmTMTa gene.

3. The use of the exogenous insertion sequence of transgenic maize BBHTL8-1 and its flanking sequences of claim 1 or 2 for detecting transgenic maize BBHTL 8-1.

4. The specific primer pair for detecting the transgenic corn BBHTL8-1 is characterized in that the nucleotide sequence of the specific primer pair is shown in a sequence table SEQ ID NO: 3-4.

5. A kit for detecting transgenic maize BBHTL8-1, comprising the specific primer pair of claim 4.

6. Use of the specific primer pair of claim 4 for detecting transgenic maize BBHTL8-1 parent, progeny, hybrid F1, and plants, tissues, seeds, or preparations thereof.

7. A method for detecting transgenic corn BBHTL8-1, which is characterized in that total DNA of a sample is used as a template, a PCR reaction is carried out by using the specific primer pair of claim 4, and if the size of an amplification product band is 240 bp, the sample to be detected contains components derived from BBHTL 8-1.

Images