CN103952426B

CN103952426B - A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application

Info

Publication number: CN103952426B
Application number: CN201410175961.6A
Authority: CN
Inventors: 江千涛; 赵珊; 王际睿; 陈国跃; 祁鹏飞; 刘亚西; 蒲至恩; 李伟; 魏育明; 郑有良
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2014-04-28
Filing date: 2014-04-28
Publication date: 2016-06-08
Anticipated expiration: 2034-04-28
Also published as: CN103952426A

Abstract

The invention provides a kind of double T-DNA carrier containing double, two reporter genes and construction method thereof and application. traditional double T-DNA carrier is improved by the present invention, combine utilizing bio-safety marker gene and rejecting transfer-gen plant selectable marker gene both approaches, Reporter gene GUS gene and selectable marker gene are connected into same T-DNA region, GFP gene and genes of interest are connected into another T-DNA region, obtain the double T-DNA carrier containing double, two reporter genes, by two reporter genes of offspring's selfing separation detection, reject genes of interest to occur to be total to the transfer-gen plant integrated with selectable marker gene, finally give the Transgene-safty plant only having genes of interest and marker-free, rapid screening obtains the Transgene-safty plant containing genes of interest and bio-safety labelling GFP, so it is greatly saved manpower, material resources and financial resources, it is effectively increased the efficiency of gene integration and the generation of safe transfer-gen plant.

Description

A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application

Technical field

The present invention relates to biological technical field, specifically, relate to a kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application.

Background technology

Food problem is the key problem of every country, due to the deterioration of environment, a large amount of minimizings of cultivated area, the continuous growth of population, the food problem of China is faced with increasing challenge, resolves Food Security and is to ensure that the important prerequisite of economical and efficient and sustainable development. Practice have shown that, the development of science and technology and breakthrough are to solve one of most important approach of food problem, utilize technique for gene engineering improvement variety of crops, and the quality and yield improving crops has more and more important realistic meaning.

Transgenic technology starts from the eighties in last century, and namely this technology obtains paying close attention to widely and application from appearance, and plant transgenic technology has become raising crop yield, quality, utilization of agricultural resources utilization rate, one of effective means improving agroecological environment etc. till now. At present, transgenic plant mainly includes industrial crops, cereal crops, vegetable, flowers, medicinal plants, fruit tree and herbage etc.Since first genetically modified crops commercial applications in 1996, the cultivated area of genetically modified crops increases year by year, increasing 100 times (ISAAA, 2012) to its cultivated area in 2012, transgenic technology also becomes one of new technique that in premodern agriculture history, development utilization is the fastest. But, along with the fast development of this technology, people are while concern transgenic plant brings tremendous economic and social benefit, and its safety problem also result in the concern that people are general. In plant transgene process, exogenous gene transformation frequency in recipient plant cell is at a fairly low, in order to obtain real conversion cell quickly and easily from huge recipient cell group, specific selectable marker gene is widely used in transgenic protocol. But, the safety of selectable marker gene is but subject to the query of people, it is mainly manifested in: the selectable marker gene being widely used at present is mainly antibiotics resistance gene and herbicide resistance gene, these genes may be transferred in microorganism, pathogen is made to obtain resistance, thus causing that the antibiotic of Clinical practice lost efficacy; Furthermore, it is possible to producer drifts about, being delivered in ruderal through natural hybridization, develop immunity to drugs superweed, and agricultural production and ecological environment are brought great harm; Finally, these genes and product thereof may have a negative impact to animals and humans are healthy and safe. Therefore, the safety improving Study of Marker Genes in Transgenic Plants is important goal and the urgent task of plant transgenic technology now.

At present, the strategy improving Selectable Marker Genes in Transgenic Plants safety mainly has: use the conversion system of marker-free gene; Utilize uncontested bio-safety marker gene; Reject the selectable marker gene having obtained transfer-gen plant. Using the conversion system of marker-free gene, the workload of transgenic positive plant screening is huge, wastes time and energy; Utilize uncontested bio-safety marker gene simple to operate, be presently the most conventional method; Reject the potential safety hazard that marker gene then can avoid selectable marker gene to bring completely, and be conducive to polygenes to convert. Therefore, uncontested bio-safety marker gene and rejecting transfer-gen plant selectable marker gene is utilized to become the Main Means of current transgenic research.

Reporter gene is the gene of the protein that can be detected of a kind of coding or enzyme, and namely a kind of expression product is very easy to certified gene. Gus gene (��-D-Glucose glycosides phytase gene) is a kind of reporter gene conventional at present, its a series of beta-glucosidase acid of expression product ��-glucuronidase (GUS) energy catalytic pyrolysis, bromo-for 5-4 chloro-3-indole-beta-glucosidase acid fat (X-Gluc) is decomposed into blue material, its detection method is simple, quick, sensitive, stable, and background activity is low. Another kind of conventional reporter gene is green fluorescent protein (GFP) gene, GFP is the bioluminescent protein that a class is present in the coelenterate bodies such as Jellyfish, hydra and Corallium Japonicum Kishinouye, when being subject to ultraviolet or being blue-light excited, GFP transmitting green fluorescence, it is easy to detect, only need excitation source, do not need any substrate or cofactor, and material can vivo observation, meanwhile, the formation of GFP chromophore, without species specificity, can be expressed in protokaryon eukaryotic cell, cell is substantially free of toxic action by its expression product, and does not affect normal growth and the function of cell. GFP gene is one of bio-safety marker gene of discovered in recent years.

The method rejecting transfer-gen plant selectable marker gene mainly has locus specificity restructuring, Transposon System and cotransformation system. wherein, cotransformation method is to study relatively more, that Application comparison is ripe methods, and it has easy and simple to handle, applied widely, and genetic transformation efficiency is advantages of higher relatively, thus is widely used in the plants such as Oryza sativa L., Nicotiana tabacum L., Brassica campestris L, Semen sojae atricolor, Semen Maydis. cotransformation method is to be built respectively with genes of interest on 2 different carriers by selectable marker gene, cotransformation recipient plant cell, obtain the plant that transgenic is integrated altogether, genetic recombination then through the transformed plant perfect stage, make selectable marker gene separate with genes of interest, obtain eliminating the positive transformants plant of selectable marker gene. but, owing to the gene integration efficiency of different plant transgene carriers is variant, and easily it is incorporated into the same position of acceptor gene group so that it is application is restricted. in order to solve this problem, researcher constructs again the super binary vector containing two T-DNA, namely selectable marker gene and genes of interest are inserted respectively in same plasmid and separate T-DNA district, this is effectively increased integration efficiency, but in the common integration transformation cell obtained, most of double T-DNA is had to be incorporated into genomic same site, make in descendant inheritting, gene on double T-DNA carrier can not separate, the transgenic positive plant of marker-free gene cannot be obtained, how in transgenic progeny, simple and quick rejecting integrates plant containing selectable marker gene common is improve cotransformation efficiency and cultivate the key point of the safe transfer-gen plant of marker-free gene.

Summary of the invention

First purpose of the present invention is in that a kind of method providing simple and quick structure double T-DNA carrier, has only to once connect to convert just to obtain double T-DNA carrier after introducing restriction enzyme site by simple pcr amplification. Utilize this carrier can pass through transgenic positive Progeny plants selfing and separate the Transgene-safty plant obtaining marker-free.

Second purpose of the present invention is in that to provide a kind of double T-DNA carrier containing double; two reporter genes and application thereof.

3rd purpose of the present invention is in that to provide the method building the double T-DNA carrier containing double; two reporter genes.

First, the invention provides a kind of method building double T-DNA carrier pTRIDT313, comprise the following steps:

(1) with pCMBIA1302 carrier for template, arrange as primer with nucleotides sequence shown in SEQIDNO.1, SEQIDNO.2 and SEQIDNO.3, SEQIDNO.4, carry out pcr amplification respectively and obtain T-DNA right boundary LB and RB, LB introduces restriction enzyme site SphI and BglII, RB and introduces restriction enzyme site SacI and SphI;

(2) right boundary LB and RB is respectively coupled to pMD19-T carrier, carries out enzyme action with skeleton carrier pCAMBIA1302 respectively, then carry out three fragment connections with T4 ligase, obtain containing the two double T-DNA carrier pTRIDT313 overlapping T-DNA border.

Wherein, the nucleotide sequence of right boundary LB and the RB obtained in step (1) is respectively as shown in SEQIDNO.5, SEQIDNO.6.

Further, the invention provides a kind of double T-DNA carrier containing double; two reporter genes, this carrier has two T-DNA regions, and Reporter gene GUS and Select gene are contained in a T-DNA region, and reporter gene GFP and genes of interest are contained in another T-DNA region.

In a kind of double T-DNA carrier containing double; two reporter genes provided by the invention, hygromycin phosphotransferase gene (hpt), chloromycetin phosphoric acid transferase gene (cat), neomycin phosphotransferase gene (npt II), Herbicid resistant Bar gene.

In one embodiment of the invention, Select gene used is hygromycin phosphotransferase gene.

Further, the double T-DNA carrier containing double; two reporter genes provided by the invention is pTRIDT314. Fig. 8 is shown in by its structure collection of illustrative plates.

Present invention also offers the construction method of double T-DNA carrier containing double; two reporter genes, comprise the following steps:

(1) structure of double T-DNA carrier, including:

1) with pCMBIA1302 carrier for template, arrange as primer with nucleotides sequence shown in SEQIDNO.1, SEQIDNO.2 and SEQIDNO.3, SEQIDNO.4, carry out pcr amplification respectively and obtain T-DNA right boundary LB and RB, LB introduces restriction enzyme site SphI and BglII, RB and introduces restriction enzyme site SacI and SphI;

2) right boundary LB and RB is respectively coupled to pMD19-T carrier, carries out enzyme action with skeleton carrier pCAMBIA1302 respectively, then carry out three fragment connections with T4 ligase, obtain containing the two double T-DNA carrier pTRIDT313 overlapping T-DNA border;

(2) structure of the intermediate carrier containing gus gene, gus gene is obtained including pcr amplification, it is connected to pMD19-T carrier, by restricting property restriction enzyme site, pTRIDT313 carrier hygromycin phosphotransferase gene is replaced to gus gene, obtain the intermediate carrier pTRIDT313-GUS containing gus gene;

(3) carrier T of intermediate carrier pTRIDT313-GUS and connection selectable marker gene is connected after SacI and EcoRI enzyme action, after selectable marker gene inserts intermediate carrier pTRIDT313-GUS, namely obtain the double T-DNA carrier containing double; two reporter genes.

In above-mentioned construction method, in step (2), pcr amplification obtains the primer sequence of gus gene use such as shown in SEQIDNO.7 and SEQIDNO.8.

Wherein, restriction enzyme site described in step (2) is XhoI.

Preferably, in step (3), selectable marker gene is hygromycin phosphotransferase gene.

In one embodiment of the invention, in step (3), selectable marker gene is the hygromycin phosphotransferase gene comprising promoter and terminator, it is with pCMBIA1302 carrier for template, obtained by pcr amplification, the primer, such as shown in SEQIDNO.10 and SEQIDNO.11, wherein introduces SacI and EcoRI restriction enzyme site respectively in primer.

The invention provides the host cell containing double T-DNA carrier pTRIDT314.

The invention provides the application in gene transformation of the above-mentioned double T-DNA carrier containing double; two reporter genes.

The invention provides the application in the transgenic plant of screening marker-free of the above-mentioned double T-DNA carrier containing double; two reporter genes.

The invention provides the application in detection transgenic plant of the above-mentioned double T-DNA carrier containing double; two reporter genes.

At present, the method for detection transfer-gen plant is mainly pcr amplification and Southern hybridization, and the advantage of pcr amplification is quick, can detect in a large number, but result often exists false positive, and Southern results of hybridization is accurately and reliably, but method is complicated, cost is high, and efficiency is low. The transgene carrier containing double; two Reporter gene GUS and GFP that the present invention builds, can pass through direct examining report gene, quickly, accurately can simply detect again transgenic progeny plant.

Present invention improves over traditional double T-DNA carrier, combine utilizing bio-safety marker gene and rejecting transfer-gen plant selectable marker gene both approaches, Reporter gene GUS gene and screening-gene hygromycin phosphoric acid transferase gene are connected into same T-DNA region, GFP gene and genes of interest are connected into another T-DNA region, obtain the double T-DNA carrier containing double, two reporter genes, owing to GUS and GFP gene is respectively present in two T-DNA, two kinds of reporter genes of detection simultaneously, just can filter out the plant that genes of interest separates with selectable marker gene from transgenic progeny plant quickly and accurately, thus obtaining the Transgene-safty plant only having genes of interest and marker-free, namely the Transgene-safty plant containing genes of interest and bio-safety labelling GFP is obtained by two reporter gene rapid screening of detection, so it is greatly saved manpower, material resources and financial resources, it is effectively increased the efficiency of gene integration and the generation of safe transfer-gen plant.

Accompanying drawing explanation

Fig. 1 is the pcr amplification figure of fragment LB and RB, wherein swimming lane 1.MarkerI; Fragment LB for the purpose of swimming lane 2-5; Fragment RB for the purpose of swimming lane 6-9.

Fig. 2 is the pcr amplification figure of fragment GUS and Hygromycin, wherein swimming lane 1.MarkerIII; The fragment GUS of 2-5. order; The fragment Hygromycin of 6-9. order.

Fig. 3 is the digestion verification figure of carrier pTIRDT313, wherein swimming lane 1.MarkerIII; 2. enzyme action sample; 3. plasmid pTIRDT313.

Fig. 4 is the digestion verification figure of intermediate carrier pTIRDT313-GUS, wherein swimming lane 1.MarkerIII; 2. plasmid pTIRDT313-GUS; 3. enzyme action sample.

Fig. 5 is the digestion verification figure of carrier pTIRDT314, wherein swimming lane 1.MarkerD15000; 2. enzyme action sample; 3. plasmid pTIRDT314.

Fig. 6 is expression of plants double T-DNA carrier pTIRDT313 collection of illustrative plates.

Fig. 7 is intermediate carrier pTIRDT313-GUS collection of illustrative plates.

Fig. 8 is the double; two reporter gene double T-DNA carrier pTIRDT314 collection of illustrative plates of expression of plants.

Fig. 9 is for turning Nicotiana tabacum L. T1 for gus gene detection figure, and wherein A figure is that PCR detects electrophoretogram, and swimming lane 1.MarkerII, swimming lane 2-8 is transgenic regenerated plant, and 9 is wild-type tobacco negative control, and 10 is plasmid positive control, and 11 is H₂O negative control; B figure is GUS dyeing is positive plant figure.

Figure 10 is for turning Nicotiana tabacum L. T1 for GFP gene PCR detection figure, and swimming lane 1 is MarkerII, and swimming lane 2-15 is the transgenic regenerated plant that embodiment 3 obtains, and the wherein plant of 4,5,6,10,11,12,13,15 test positive, 16 is H₂O negative control, 17 is wild-type tobacco negative control, and 18 is plasmid positive control.

Detailed description of the invention

Following example are used for illustrating the present invention, but are not limited to the scope of the present invention. Without departing from the spirit and substance of the case in the present invention, the amendment that the inventive method, step or condition are made or replacement, belong to the scope of the present invention.

If not specializing, primer used in embodiment is synthesized by Shanghai Li Fei Bioisystech Co., Ltd, examining order is completed by Shanghai Li Fei Bioisystech Co., Ltd, pMD19-T carrier is purchased from precious biological engineering (Dalian) company limited, competence DH5 �� is purchased from Tian Gen biochemical technology company limited, and restricted enzyme is purchased from NEB (Beijing) company limited. Other biochemical reagents non-specifically are conventional commercial reagent outside indicating, the conventional means that technological means used in embodiment is well known to those skilled in the art.

Agent prescription of the present invention:

X-GLUC dyeing liquor: 50mmol/L sodium phosphate buffer (pH=7.0); 10mmol/LNa₂EDTA (pH=8.0); 0.5mmol/LK₃[Fe(CN)₆]; 0.5mmol/LK₄[Fe(CN)₆]; 0.1%Triton-X100; 0.8g/LX-Gluc.

The structure of embodiment 1 double T-DNA carrier pTRIDT313

Step 1: design primer amplification T-DNA right boundary

Sequence (GenBank:AF234298.1) according to the pCMBIA1302 carrier announced, the primer of design amplification T-DNA left margin (LB), primer includes restriction enzyme site SphI and BglII, and sequence is shown in SEQIDNO.1, SEQIDNO.2; The primer of design amplification T-DNA right margin (RB), primer includes restriction enzyme site SacI and SphI, and sequence is shown in SEQIDNO.3, SEQIDNO.4. Primer is synthesized by Shanghai Li Fei Bioisystech Co., Ltd, and described primer sequence is as follows:

SEQIDNO.1:GGTGCATGCGGACTGATGGGCTGCCTG

SEQIDNO.2:TAAAGATCTCAGTACATTAAAAACGTC

SEQIDNO.3:GAGCTCCACGAGGTGCCACCATGTTGGTTAAA

CTATCAGTGTTTG

SEQIDNO.4:TTGGCATGCACATACAAATGGACG

With pCAMBIA1302 for template, carrying out pcr amplification LB with SEQIDNO.1 and SEQIDNO.2 for primer, i.e. SEQIDNO.5, purpose fragment is about 168bp (Fig. 1).Carrying out pcr amplification RB with SEQIDNO.3 and SEQIDNO.4 for primer, i.e. SEQIDNO6, purpose fragment is about 156bp (Fig. 1). Amplified production carrying out glue recovery, connects pMD19-T carrier, 16 DEG C connect overnight, then will connect product and convert competent escherichia coli cell DH5 ��, screening positive clone. Order-checking called after T-LB and T-RB.

Step 2: the structure of the double T-DNA carrier pTRIDT313 containing two pairs of borders

By through sequence verification containing purpose fragment SEQIDNO.5 and SEQIDNO.6 plasmid T-LB and T-RB respectively at 37 DEG C through SphI, BglII and SacI, SphI double digestion 4h, then digestion products is run glue and is separately recovered the fragment of 168bp and 156bp; Meanwhile, skeleton carrier pCMBIA1302 is run at 37 DEG C after SacI and BglII double digestion 4h glue and reclaim the carrier segments of about 10kb. The fragment of two entries and carrier segments under the effect of T4 ligase 22 DEG C connect overnight. Product will be connected and convert competent escherichia coli cell, PCR qualification is carried out for primer with SEQIDNO.2 and SEQIDNO.3, if LB and RB is connected into carrier, then amplify the fragment of 309bp, then positive colony is shaken bacterium and extracts plasmid, obtain one and expection fragment of the same size with BglII and SacI double digestion. Finally carrying out sequence verification, by carrier name pTRIDT313 (see Fig. 6) correct for order-checking, this is the plant transgene carrier being suitable for Agrobacterium cotransformation containing two T-DNA frontier districts. Owing to the right-hand member of RB has separately designed identical restriction enzyme site SphI with the left end of LB, so two fragments can be connected into carrier simultaneously, decrease step and the time of vector construction. Although carrier also contains SphI restriction enzyme site, but is made without SphI enzyme action by the method carrier, in vector construction, so add the selection space of restriction enzyme site.

The embodiment 2 structure containing two reporter gene double T-DNA carriers

Step 1: the intermediate carrier containing beta-glucuronic acid glycosidase genes (GUS) builds

1) clone of gus gene: according to known gus gene sequence (GenBank:AF527487.1), designs primer amplification gus gene total length, and introduces restriction enzyme site XhoI in two primers. Described primer SEQIDNO.7 and SEQIDNO.8 sequence are as follows, and underscore part is restriction enzyme site sequence:

SEQIDNO.7:TGACTCGAGATGGTCCGTCCTGTAGAA

SEQIDNO.8:CAACTCGAGTTCATTGTTTGCCTCCCT

With PAL156 carrier for template, SEQIDNO.7 and SEQIDNO.8 is primer PCR amplification gus gene, i.e. SEQIDNO.9, and purpose fragment is about 2048+6+6bp (Fig. 3). Amplified production is carried out glue recovery, connects pMD19-T, convert and check order after identifying positive colony, the plasmid called after T-GUS checking order correct.

2) insertion of gus gene

After carrier pTRIDT313 is carried out XhoI single endonuclease digestion 4h, spend 37 DEG C of dephosphorylation 15min of phosphorylase, 80 DEG C of water-bath 20min; With also pass through XhoI enzyme action plasmid T-GUS run glue, be separately recovered the carrier of about 10kb and the gus gene fragment of about 2000bb, then under T4 ligase effect 22 DEG C connect overnight. Carry out PCR qualification with SEQIDNO.7 and SEQIDNO.8 for primer, if gus gene is connected into carrier, then amplify the fragment of 2054bp, gone out the fragment (Fig. 4) of an about 2000bp by XhoI enzyme action. Due to present invention employing is single endonuclease digestion, so that determine, by checking order, the direction being connected into gus gene, by plasmid called after pTRIDT313-GUS (Fig. 7 is shown in by collection of illustrative plates) in the right direction for order-checking.

Step 2: the structure of the double T-DNA carrier containing two reporter genes

1) the hygromycin phosphotransferase gene clone of promoter and terminator is comprised: the primer comprising promoter, hygromycin phosphotransferase gene and terminator according to the pCAMBIA1302 carrier sequence design amplification announced, and in primer, introduce SacI and EcoRI restriction enzyme site respectively, primer sequence is as follows:

SEQIDNO10:TACGAGCTCATGGTGGAGCACGACA

SEQIDNO11:CTCGAATTCTAATTCGGGGGATCTG

With pCAMBIA1302 for template, expand with SEQIDNO.10 and SEQIDNO.11 for primer PCR, i.e. SEQIDNO.12, purpose fragment is about 2066+6+6bp (Fig. 3). Product is carried out glue recovery, connects pMD19-T, convert and identify, the plasmid called after T-Hygromycin checking order correct.

2) insertion of hygromycin phosphotransferase gene

By intermediate carrier pTRIDT313-GUS and T-Hygromycin after SacI and EcoRI enzyme action glue reclaims, under T4 ligase effect, 22 DEG C connect overnight. PCR qualification is carried out for primer with SEQIDNO.10 and SEQIDNO.11, if hygromycin phosphotransferase gene is connected into carrier, then amplify the fragment of 2072bp, it is the double T-DNA carrier containing two reporter genes through the plasmid that enzyme action and sequence verification are correct, and two T-DNA regions include a reporter gene, name pTRIDT314 (Fig. 8) respectively.

The genetic transformation of embodiment 3pTRIDT314 carrier and Progeny plants positive-selecting

Double T-DNA carrier pTRIDT314 carrier leaf disk method transformation of tobacco containing double; two reporter genes

1) present invention adopts thermal shock conversion method (method reference molecule is cloned: laboratory manual), recombiant plasmid pTRIDT314 is imported the competent cell of agrobacterium tumefaciens lba4404, is positive recon called after LBA4404-pTRIDT314 through Screening and Identification.

2) adopting leaf disk method by recon transformation of tobacco, concrete operation step is as follows:

A. taking the blade of young tender health, with distilled water flushing one time, 45s washed by 70% ethanol, 10% hypochlorite disinfectant 6-8min, aseptic water washing 5 times, aseptic filter paper suck dry moisture.

B. the single bacterium colony Agrobacterium tumefaciems of picking one, is inoculated into 20ml containing in the antibiotic YEB culture fluid of rifampicin and kanamycin, 28 DEG C, to cultivate OD value on 180rpm constant-temperature table be 0.6-0.8. Take the ratio that above culture is in 1%, proceed to fresh in, in the YEB culture fluid of antibiotics, continuing to cultivate 8-12 hour, can be used for converting when OD value is 0.4-0.6.

C. on superclean bench into, bacterium solution is poured aseptic little culture dish, add the acetosyringone of final concentration of 120 ��m/L, aseptic blade is cut into the fritter of 0.5cm �� 0.5cm, put in bacterium solution and steep 6-8 minute. Take out outer implant on aseptic filter paper, suck the bacterium solution of attachment. Then it is seeded in MS culture medium, 28 DEG C of light culture 2 days.

D. the outer implant through co-culturing is transferred in the MS culture medium containing 1.0mg/L6-BA, 0.1mg/LNAA, 40mg/L hygromycin and 150mg/LTimentin. When illumination, 25 DEG C carry out selecting to cultivate.

E. select to cultivate after 2-3 week, when adventitious bud grows to about 1cm, cut adventitious bud and transfer to the MS culture medium containing 40mg/L hygromycin and 150mg/LTimentin carries out root culture.

F. within about two weeks, grow adventitious root, be then transplanted in soil.

3) detection of transgene tobacco positive plant

The transgenic tobacco plant with hygromycin resistance derived above has three kinds of situations, a kind of for only having selectable marker gene to proceed to plant;The second is selectable marker gene and GFP gene is incorporated into chromosome same position altogether; The third is incorporated into chromosomal diverse location altogether for selectable marker gene and GFP gene, and this offspring's of can be by selfing separates the transfer-gen plant obtaining marker-free. The transfer-gen plant of the second and the third situation can be screened by GUS dyeing and GFP detection. Concrete grammar is as follows:

A.GUS dyes

The blade taking regeneration plant carries out GUS dyeing, is put into by ready blade in EP pipe, adds X-GLUC dyeing liquor submergence blade, seals lid; Put into 37 DEG C of incubator temperature bath 1-12h; Outwell and infect liquid and add 70% ethanol decolorization 2-3 time, remove chlorophyll is white to negative control, observe leaf color. Positive plant blade is dyed to blueness, and non-positive plant blade is white or faint yellow after fading.

B.GFP detects

The blade or the tip of a root that take regeneration plant make section; Use fluorescence microscope or laser confocal microscope 488nm wavelength blue-light excited under, observe the expression of GFP. Under fluorescence microscope or laser confocal microscope, positive plant blade is inspired green fluorescence, non-positive plant blade unstressed configuration.

The present invention by plasmid pTRIDT314 transformation of tobacco, obtains transfer-gen plant by leaf disk method, and the blade taking regeneration plant carries out GUS dyeing and GFP detection respectively. Positive plant includes three kinds of situations, and one is that plant leaf can only be dyed blueness by GUS dye liquor, does not observe green fluorescence; Another kind is that plant leaf can not be dyed blueness by GUS dye liquor, but it is observed that green fluorescence; Last one is that plant leaf can be dyed blueness by GUS dye liquor, again it is observed that green fluorescence.

4) acquisition of marker-free gene plant

The method adopting GUS dyeing, GFP observation and pcr amplification, the 70 strain Nicotiana tabacum L. regeneration plants survived through hygromycin selection are detected, result is as follows: is dyeed by pcr amplification gus gene and blade GUS, obtains 17 strains positive reconstituted tobacco Seedling (Fig. 9); Observed by pcr amplification GFP gene and fluorescence microscope GFP, obtain 13 strains positive reconstituted tobacco Seedling (Figure 10); Wherein, can detect that 13 strain reconstituted tobacco Seedlings of GFP gene can detect gus gene, and have 5 strain reconstituted tobacco Seedlings to be only able to detect gus gene. This 13 strain obtained has the reconstituted tobacco Seedling of gus gene and GFP gene can pass through the T2-Tn alternative said method screening rejecting common integration plant containing selectable marker gene simultaneously, obtains only having GFP gene not carry the safe plant of selectable marker gene. If genes of interest being connected into the T region of DNA territory at GFP reporter gene place, being screened by the method and only being observed green fluorescence and blue plant can not be dyed by GUS dye liquor to be the safe plant without selectable marker gene. This result illustrates that the double; two reporter gene double T-DNA carriers constructed by the present invention can be used for obtaining the safe plant of marker-free.

Although, above the present invention is described in detail with a general description of the specific embodiments, but on basis of the present invention, it is possible to it is made some modifications or improvements, and this will be apparent to those skilled in the art. Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.

Claims

1. contain the double T-DNA carrier of double; two reporter gene, it is characterised in that this carrier has two T-DNA regions, and Reporter gene GUS and Select gene are contained in a T-DNA region, and reporter gene GFP and genes of interest are contained in another T-DNA region.

2. the double T-DNA carrier containing double; two reporter genes as claimed in claim 1, it is characterized in that, described Select gene is hygromycin phosphotransferase gene hpt, chloromycetin phosphoric acid transferase gene cat, neomycin phosphotransferase gene npt II, Herbicid resistant Bar gene.

3. contain the construction method of the double T-DNA carrier of double; two reporter genes as claimed in claim 1 or 2, it is characterised in that comprise the following steps:

(1) structure of double T-DNA carrier, including:

2) right boundary LB and RB being respectively coupled to pMD19-T carrier, carry out enzyme action with skeleton carrier pCAMBIA1302 respectively, wherein pCAMBIA1302 carrier is through SacI and BglII double digestion; Carry out three fragment connections with T4 ligase again, obtain containing the two double T-DNA carrier pTRIDT313 overlapping T-DNA border;

4. construction method as claimed in claim 3, it is characterised in that in step (2), pcr amplification obtains the primer sequence of gus gene use such as shown in SEQIDNO.7 and SEQIDNO.8.

5. construction method as claimed in claim 3, it is characterised in that restriction enzyme site described in step (2) is XhoI.

6. construction method as claimed in claim 3, it is characterised in that in step (3), selectable marker gene is hygromycin phosphotransferase gene.

7. the application in the transgenic plant of screening marker-free of the double T-DNA carrier containing double; two reporter genes as described in as arbitrary in claim 1��2.

8. the application in detection transgenic plant of the double T-DNA carrier containing double; two reporter genes as described in as arbitrary in claim 1��2.