CN103952426A - Double reporter gene contained binary T-DNA (transferred deoxyribonucleic acid) carrier as well as construction method and application of double reporter gene contained binary T-DNA carrier - Google Patents
Double reporter gene contained binary T-DNA (transferred deoxyribonucleic acid) carrier as well as construction method and application of double reporter gene contained binary T-DNA carrier Download PDFInfo
- Publication number
- CN103952426A CN103952426A CN201410175961.6A CN201410175961A CN103952426A CN 103952426 A CN103952426 A CN 103952426A CN 201410175961 A CN201410175961 A CN 201410175961A CN 103952426 A CN103952426 A CN 103952426A
- Authority
- CN
- China
- Prior art keywords
- carrier
- gene
- dna
- double
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a double reporter gene contained binary T-DNA (transferred deoxyribonucleic acid) carrier as well as a construction method and an application of the double reporter gene contained binary T-DNA carrier. The construction method comprises the steps of modifying the traditional binary T-DNA carrier; combining a biosafety marker gene utilization method and a transgenic plant selective marker gene removal method, connecting a GUS (beta-glucuronidase) gene of a reporter gene and a selective marker gene into the same T-DNA region, and connecting a GFP (green fluorescent protein) gene and a target gene into the other T-DNA region to obtain the double reporter gene contained binary T-DNA carrier; detecting the two reporter genes through selfing separation of a progeny; removing transgenic plants in which target genes and selective marker genes are co-integrated to finally obtain safe transgenic plants which only contain target genes, but no selective marker genes; rapidly screening to obtain safe transgenic plants which contain both target genes and biosafety marker GFP genes. Therefore, the manpower, material resources and financial resources are greatly saved, the gene integration efficiency is effectively increased, and the produced safe transgenic plants are effectively increased.
Description
Technical field
The present invention relates to biological technical field, specifically, relate to a kind of double T-DNA carrier and construction process and application that contains two reporter genes.
Background technology
Food problem is the key problem of every country, due to the deterioration of environment, a large amount of minimizings of cultivated area, the continuous growth of population, the food problem of China is faced with increasing challenge, and resolving Food Security is the important prerequisite that guarantees economical and efficient and Sustainable development.Practice shows, the development of science and technology is to solve one of most important approach of food problem with breakthrough, utilizes genetic engineering technique improvement variety of crops, and the quality and yield of raising farm crop has more and more important realistic meaning.
Transgenic technology starts from the eighties in last century, and this technology obtains paying close attention to widely and applying from occurring, plant transgenic technology has become and improved crop yield, quality till now, and utilization of agricultural resources utilization rate is improved one of effective means of agroecological environment etc.At present, transgenic plant mainly comprise cash crop, food crop, vegetables, flowers, medicinal plant, fruit tree and herbage etc.Since first genetically modified crops commercial applications in 1996, the cultivated area of genetically modified crops increases year by year, to its cultivated area in 2012, increased by 100 times (ISAAA, 2012), transgenic technology also becomes one of the fastest new technology of development utilization in premodern agriculture history.But along with the fast development of this technology, people are when concern transgenic plant bring tremendous economic and social benefit, its safety problem has also caused the concern that people are general.In plant transgene process, the transformation frequency of foreign gene in Plant accepter cell is quite low, in order to obtain real transformant quickly and easily from huge recipient cell group, specific selectable marker gene is widely used in transgenosis process.Yet, the security of selectable marker gene is but subject to people's query, be mainly manifested in: the selectable marker gene being widely used is at present mainly antibiotics resistance gene and herbicide resistance gene, these genes may be transferred in microorganism, make pathogenic bacteria obtain resistance, thereby cause the microbiotic of clinical use to lose efficacy; In addition, possible producer drifts about, and through natural hybridization, is delivered in ruderal, and the superweed that develops immunity to drugs, brings great harm to agriculture production and ecotope; Finally, these genes and product thereof may have a negative impact to animals and humans are healthy and safe.Therefore, the security of raising Study of Marker Genes in Transgenic Plants is important goal and the urgent task of plant transgenic technology now.
At present, the strategy of raising Selectable Marker Genes in Transgenic Plants security mainly contains: the conversion system that uses marker-free gene; Utilize uncontested Biosafety marker gene; Reject the selectable marker gene that has obtained transfer-gen plant.Use the conversion system of marker-free gene, the workload of transgenic positive plant screening is huge, wastes time and energy; Utilizing uncontested Biosafety marker gene simple to operate, is current the most conventional method; Reject the potential safety hazard that marker gene can avoid selectable marker gene to bring completely, and be conducive to polygene conversion.Therefore, utilize uncontested Biosafety marker gene and reject the Main Means that transfer-gen plant selectable marker gene becomes current transgenic research.
Reporter gene is protein or the gene of enzyme, the i.e. very easy certified gene of a kind of expression product that a kind of coding can be detected.Gus gene (β-D-Glucose glycosides phytase gene) is conventional at present a kind of reporter gene, the a series of beta-glucoside acid of its expression product β-glucuronidase (GUS) energy catalytic pyrolysis, the bromo-4 chloro-3-indoles of 5--beta-glucoside acid fat (X-Gluc) is decomposed into blue material, its detection method is simple, quick, sensitive, stable, and background activity is low.Another kind of conventional reporter gene is green fluorescent protein (GFP) gene, GFP is that a class is present in the bioluminescent protein in the coelenterates bodies such as jellyfish, hydra and coral, be subject to ultraviolet or when blue-light excited, GFP transmitting green fluorescence, it is easy to detect, only need excitation light source, do not need any substrate or cofactor, and material can vivo observation, meanwhile, the formation of GFP chromophore, without species specificity, can be expressed in protokaryon eukaryotic cell, its expression product does not have toxic action substantially to cell, and does not affect normal growth and the function of cell.GFP gene is one of Biosafety marker gene of discovered in recent years.
The method of rejecting transfer-gen plant selectable marker gene mainly contains locus specificity restructuring, Transposon System and cotransformation system.Wherein, cotransformation method is that research is many, the method for application comparative maturity, and it has easy and simple to handle, applied widely, and genetic transformation efficiency is compared with advantages of higher, thereby is widely used in the plants such as paddy rice, tobacco, rape, soybean, corn.Cotransformation method is that selectable marker gene and goal gene are structured in respectively on 2 different carriers, common conversion of plant recipient cell, obtain the plant that transgenosis is integrated altogether, pass through again the genetic recombination of transformed plant perfect stage, make selectable marker gene separated with goal gene, obtained rejecting the positive transformed plant of selectable marker gene.But, because the gene integration efficiency of different plant transgene carriers is variant, and be easily incorporated into the same position of acceptor gene group, its application is restricted.In order to address this problem, investigator has built again the super binary vector that contains two T-DNA, be that selectable marker gene and goal gene are inserted into respectively in same plasmid and separate T-DNA district, this has effectively improved integration efficiency, but in the common integration transformation cell obtaining, there is most of double T-DNA to be incorporated into genomic same site, make in descendant inheritting, gene on double T-DNA carrier can not be separated, cannot obtain the transgenic positive plant of marker-free gene, how in transgenic progeny, simple and quick rejecting is the key point that improves cotransformation efficiency and cultivate the safe transfer-gen plant of marker-free gene containing the common integration plant of selectable marker gene.
Summary of the invention
First object of the present invention is to provide a kind of method of simple and quick structure double T-DNA carrier, by only need to once connecting to transform after simple pcr amplification introducing restriction enzyme site, just can obtain double T-DNA carrier.Utilize this carrier can obtain by transgenic positive offspring plant selfing separation the Transgene-safty plant of marker-free.
Second object of the present invention is to provide a kind of double T-DNA carrier and application thereof that contains two reporter genes.
The 3rd object of the present invention is to provide the method that builds the double T-DNA carrier that contains two reporter genes.
First, the invention provides a kind of method that builds double T-DNA carrier pTRIDT313, comprise the following steps:
(1) take pCMBIA1302 carrier as template, with nucleotides sequence shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, SEQ ID NO.4, classify primer as, carry out respectively pcr amplification and obtain T-DNA left and right border LB and RB, LB introduces restriction enzyme site SphI and BglII, and RB introduces restriction enzyme site SacI and SphI;
(2) border, left and right LB and RB are linked respectively to pMD19-T carrier, carry out respectively enzyme with skeleton carrier pCAMBIA1302 and cut, then carry out three fragment connections with T4 ligase enzyme, obtain the double T-DNA carrier pTRIDT313 containing two cover T-DNA borders.
Wherein, border, the left and right LB obtaining in step (1) and the nucleotide sequence of RB are respectively as shown in SEQID NO.5, SEQ ID NO.6.
Further, the invention provides a kind of double T-DNA carrier that contains two reporter genes, this carrier has two T-DNA regions, and reporter gene GUS and Select gene are contained in a T-DNA region, and reporter gene GFP and goal gene are contained in another T-DNA region.
In a kind of double T-DNA carrier that contains two reporter genes provided by the invention, hygromycin phosphotransferase gene (hpt), paraxin phosphoric acid transferase gene (cat), neomycin phosphotransferase gene (npt II), Herbicid resistant Bar gene.
In one embodiment of the invention, Select gene used is hygromycin phosphotransferase gene.
Further, the double T-DNA carrier that contains two reporter genes provided by the invention is pTRIDT314.Fig. 8 is shown in by its structure collection of illustrative plates.
The present invention also provides the construction process of the double T-DNA carrier that contains two reporter genes, comprises the following steps:
(1) structure of double T-DNA carrier, comprising:
1) take pCMBIA1302 carrier as template, with nucleotides sequence shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, SEQ ID NO.4, classify primer as, carry out respectively pcr amplification and obtain T-DNA left and right border LB and RB, LB introduces restriction enzyme site SphI and BglII, and RB introduces restriction enzyme site SacI and SphI;
2) border, left and right LB and RB are linked respectively to pMD19-T carrier, carry out respectively enzyme with skeleton carrier pCAMBIA1302 and cut, then carry out three fragment connections with T4 ligase enzyme, obtain the double T-DNA carrier pTRIDT313 containing two cover T-DNA borders;
(2) contain the structure of the intermediate carrier of gus gene, comprise that pcr amplification obtains gus gene, be connected to pMD19-T carrier, by restriction enzyme site, pTRIDT313 carrier hygromycin phosphotransferase gene is replaced to gus gene, obtain the intermediate carrier pTRIDT313-GUS containing gus gene;
(3) intermediate carrier pTRIDT313-GUS is connected after SacI cuts with EcoRI enzyme with the T carrier that is connected selectable marker gene, selectable marker gene inserts after intermediate carrier pTRIDT313-GUS, obtains the double T-DNA carrier that contains two reporter genes.
In above-mentioned construction process, the primer sequence that in step (2), pcr amplification obtains gus gene use is as shown in SEQ ID NO.7 and SEQ ID NO.8.
Wherein, described in step (2), restriction enzyme site is XhoI.
Preferably, in step (3), selectable marker gene is hygromycin phosphotransferase gene.
In one embodiment of the invention, in step (3), selectable marker gene is the hygromycin phosphotransferase gene that comprises promotor and terminator, it take pCMBIA1302 carrier as template, by pcr amplification, obtain, the primer, as shown in SEQ ID NO.10 and SEQ ID NO.11, is wherein introduced respectively SacI and EcoRI restriction enzyme site in primer.
The invention provides the host cell that contains double T-DNA carrier pTRIDT314.
The invention provides the application of the above-mentioned double T-DNA carrier that contains two reporter genes in gene transformation.
The invention provides the application of the above-mentioned double T-DNA carrier that contains two reporter genes in the transgenic plant of screening marker-free.
The invention provides the application of the above-mentioned double T-DNA carrier that contains two reporter genes in detecting transgenic plant.
At present, the method that detects transfer-gen plant is mainly pcr amplification and Southern hybridization, and the advantage of pcr amplification is quick, can detect in a large number, but result often exists false positive, and Southern results of hybridization accurately and reliably, but method is complicated, and cost is high, and efficiency is low.The transgene carrier containing two reporter gene GUS and GFP that the present invention builds, can pass through direct-detection reporter gene, can fast, accurately simply detect again transgenic progeny plant.
The present invention has improved traditional double T-DNA carrier, by utilizing Biosafety marker gene and rejecting these two kinds of methods of transfer-gen plant selectable marker gene, combine, reporter gene gus gene and the anti-hygromycin phosphotransferase gene of screening-gene are connected into same T-DNA region, GFP gene and goal gene are connected into another T-DNA region, obtain the double T-DNA carrier that contains two reporter genes, because GUS and GFP gene are present in respectively in two T-DNA, detect two kinds of reporter genes simultaneously, just can from transgenic progeny plant, filter out quickly and accurately goal gene, with selectable marker gene, separated plant occur, thereby obtain only having goal gene and the Transgene-safty plant of marker-free, by detecting two reporter gene rapid screening, obtain the Transgene-safty plant that contains goal gene and Biosafety mark GFP, manpower, material resources and financial resources have so greatly been saved, the efficiency of gene integration and the generation of safe transfer-gen plant have effectively been improved.
Accompanying drawing explanation
Fig. 1 is the pcr amplification figure of fragment LB and RB, wherein swimming lane 1.Marker I; Swimming lane 2-5 is object fragment LB; Swimming lane 6-9 is object fragment RB.
Fig. 2 is the pcr amplification figure of fragment GUS and Hygromycin, wherein swimming lane 1.Marker III; 2-5. object fragment GUS; 6-9. object fragment Hygromycin.
Fig. 3 is that the enzyme of carrier pTIRDT313 is cut proof diagram, wherein swimming lane 1.Marker III; 2. enzyme is cut sample; 3. plasmid pTIRDT313.
Fig. 4 is that the enzyme of intermediate carrier pTIRDT313-GUS is cut proof diagram, wherein swimming lane 1.Marker III; 2. plasmid pTIRDT313-GUS; 3. enzyme is cut sample.
Fig. 5 is that the enzyme of carrier pTIRDT314 is cut proof diagram, wherein swimming lane 1.Marker D15000; 2. enzyme is cut sample; 3. plasmid pTIRDT314.
Fig. 6 is expression of plants double T-DNA carrier pTIRDT313 collection of illustrative plates.
Fig. 7 is intermediate carrier pTIRDT313-GUS collection of illustrative plates.
Fig. 8 is the two reporter gene double T-DNA carrier pTIRDT314 collection of illustrative plates of expression of plants.
Fig. 9 is for turning tobacco T1 for gus gene detection figure, and wherein A figure is that PCR detects electrophorogram, swimming lane 1.Marker II, and swimming lane 2-8 is transgenic regenerated plant, and 9 is wild-type tobacco negative control, and 10 is plasmid positive control, and 11 is H
2o negative control; B figure is the GUS positive plant figure that dyes.
Figure 10 is for turning tobacco T1 for GFP gene PCR detection figure, and swimming lane 1 is Marker II, and swimming lane 2-15 is the transgenic regenerated plant that embodiment 3 obtains, the plant of 4,5,6,10,11,12,13,15 test positive wherein, and 16 is H
2o negative control, 17 is wild-type tobacco negative control, 18 is plasmid positive control.
Embodiment
Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the modification that the inventive method, step or condition are done or replacement, all belong to scope of the present invention.
If do not specialize, primer used in embodiment is synthetic by Shanghai Li Fei Bioisystech Co., Ltd, examining order is completed by Shanghai Li Fei Bioisystech Co., Ltd, pMD19-T carrier is purchased from precious biotechnology (Dalian) company limited, competence DH5 α is purchased from Tian Gen biochemical technology company limited, and restriction enzyme is purchased from NEB (Beijing) company limited.Other biochemical reagents are non-to be indicated outward and is conventional commercial reagent, the conventional means that in embodiment, technique means used is well known to those skilled in the art especially.
Agent prescription of the present invention:
X-GLUC staining fluid: 50mmol/L sodium phosphate buffer (pH=7.0); 10mmol/LNa
2eDTA (pH=8.0); 0.5mmol/L K
3[Fe (CN)
6]; 0.5mmol/L K
4[Fe (CN)
6]; 0.1%Triton-X100; 0.8g/L X-Gluc.
The structure of embodiment 1 double T-DNA carrier pTRIDT313
Step 1: design border, primer amplification T-DNA left and right
According to the sequence (GenBank:AF234298.1) of the pCMBIA1302 carrier of having announced, the primer of design amplification T-DNA left margin (LB), primer comprises restriction enzyme site SphI and BglII, and sequence is shown in SEQ ID NO.1, SEQ ID NO.2; The primer of design amplification T-DNA right margin (RB), primer comprises restriction enzyme site SacI and SphI, sequence is shown in SEQ ID NO.3, SEQ ID NO.4.Primer is synthetic by Shanghai Li Fei Bioisystech Co., Ltd, and described primer sequence is as follows:
SEQ?ID?NO.1:GGT
GCATGCGGACTGATGGGCTGCCTG
SEQ?ID?NO.2:TAA
AGATCTCAGTACATTAAAAACGTC
SEQ?ID?NO.3:
GAGCTCCACGAGGTGCCACCATGTTGGTTAAA
CTATCAGTGTTTG
SEQ?ID?NO.4:TTG
GCATGCACATACAAATGGACG
Take pCAMBIA1302 as template, and take SEQ ID NO.1 and SEQ ID NO.2 carries out pcr amplification LB as primer, i.e. SEQ ID NO.5, and object fragment is about 168bp (Fig. 1).Take SEQ ID NO.3 and SEQ ID NO.4 carries out pcr amplification RB as primer, i.e. SEQ ID NO6, and object fragment is about 156bp (Fig. 1).Amplified production is carried out to glue recovery, connect pMD19-T carrier, 16 ℃ of connections are spent the night, and then will connect product and transform competent escherichia coli cell DH5 α, screening positive clone.Order-checking called after T-LB and T-RB.
Step 2: the structure that contains the double T-DNA carrier pTRIDT313 on two pairs of borders
By through the plasmid T-LB that contains object fragment SEQ ID NO.5 and SEQ ID NO.6 of sequence verification and T-RB respectively at 37 ℃ through SphI, BglII and SacI, SphI double digestion 4h, then cuts enzyme product and runs the fragment that glue reclaims respectively 168bp and 156bp; Meanwhile, skeleton carrier pCMBIA1302 is run at 37 ℃ after SacI and BglII double digestion 4h to the carrier segments that glue reclaims 10kb left and right.The fragment of two entries and carrier segments 22 ℃ of connections under the effect of T4 ligase enzyme are spent the night.To connect product and transform competent escherichia coli cell, take SEQ ID NO.2 and SEQ ID NO.3 carries out PCR evaluation as primer, if LB and RB are connected into carrier, amplify the fragment of 309bp, then positive colony is shaken to bacterium and extract plasmid, with BglII and SacI double digestion, obtain one and expection fragment of the same size.Finally carry out sequence verification, by the correct carrier name pTRIDT313 (seeing Fig. 6) of order-checking, this is and contains the plant transgene carrier that two T-DNA frontier districts are applicable to Agrobacterium cotransformation.Because the right-hand member of RB and the left end of LB have designed respectively identical restriction enzyme site SphI, can two fragments be connected into carrier so simultaneously, reduced step and the time of vector construction.Although carrier also contains SphI restriction enzyme site, by this method carrier, do not need to carry out SphI enzyme and cut, in vector construction, increased like this selection space of restriction enzyme site.
The structure that embodiment 2 contains two reporter gene double T-DNA carriers
Step 1: the intermediate carrier containing beta-glucuronic acid Glycosylase gene (GUS) builds
1) clone of gus gene: according to known gus gene sequence (GenBank:AF527487.1), design primer amplification gus gene total length, and all introduce restriction enzyme site XhoI in two primers.Described primer SEQ ID NO.7 and SEQ ID NO.8 sequence are as follows, and underscore is partly restriction enzyme site sequence:
SEQ?ID?NO.7:TGA
CTCGAGATGGTCCGTCCTGTAGAA
SEQ?ID?NO.8:CAA
CTCGAGTTCATTGTTTGCCTCCCT
Take PAL156 carrier as template, and SEQ ID NO.7 and SEQ ID NO.8 are primer PCR amplification gus gene, i.e. SEQ ID NO.9, and object fragment is about 2048+6+6bp (Fig. 3).Amplified production is carried out glue recovery, connects pMD19-T, and conversion is checked order after identifying positive colony, the plasmid called after T-GUS that checks order correct.
2) insertion of gus gene
Carrier pTRIDT313 is carried out after XhoI single endonuclease digestion 4h, spend 37 ℃ of dephosphorylation 15min of Starch phosphorylase, 80 ℃ of water-bath 20min; Run glue with the same plasmid T-GUS cutting through XhoI enzyme, reclaim respectively the carrier of 10kb left and right and the gus gene fragment of 2000bb left and right, then under the effect of T4 ligase enzyme, 22 ℃ of connections are spent the night.Take SEQ ID NO.7 and SEQ ID NO.8 as primer carries out PCR evaluation, if gus gene is connected into carrier, amplify the fragment of 2054bp, by XhoI enzyme, cut out the fragment (Fig. 4) of a 2000bp left and right.What adopt due to the present invention is single endonuclease digestion, thereby need to by checking order, determine the direction that is connected into gus gene, by order-checking plasmid called after pTRIDT313-GUS (Fig. 7 is shown in by collection of illustrative plates) in the right direction.
Step 2: the structure of the double T-DNA carrier that contains two reporter genes
1) the hygromycin phosphotransferase gene clone who comprises promotor and terminator: the primer that comprises promotor, hygromycin phosphotransferase gene and terminator according to the pCAMBIA1302 carrier sequences Design amplification of having announced, and in primer, introduce respectively SacI and EcoRI restriction enzyme site, primer sequence is as follows:
SEQ?ID?NO10:TAC
GAGCTCATGGTGGAGCACGACA
SEQ?ID?NO11:CTC
GAATTCTAATTCGGGG?GATCTG
Take pCAMBIA1302 as template, take SEQ ID NO.10 and SEQ ID NO.11 as primer PCR amplification, i.e. SEQ ID NO.12, object fragment is about 2066+6+6bp (Fig. 3).Product is carried out to glue recovery, connect pMD19-T, transform and identify, the plasmid called after T-Hygromycin that checks order correct.
2) insertion of hygromycin phosphotransferase gene
Intermediate carrier pTRIDT313-GUS and T-Hygromycin are cut after glue recovery through SacI and EcoRI enzyme, and under the effect of T4 ligase enzyme, 22 ℃ of connections are spent the night.Take SEQ ID NO.10 and SEQ ID NO.11 carries out PCR evaluation as primer, if hygromycin phosphotransferase gene is connected into carrier, amplify the fragment of 2072bp, through enzyme, cutting the plasmid correct with sequence verification is the double T-DNA carrier that contains two reporter genes, and two T-DNA regions comprise respectively a reporter gene, name pTRIDT314 (Fig. 8).
The genetic transformation of embodiment 3pTRIDT314 carrier and offspring plant positive-selecting
The double T-DNA carrier pTRIDT314 carrier leaf dish method transformation of tobacco that contains two reporter genes
1) the present invention adopts thermal shock conversion method (method reference molecule clone: laboratory manual), recombinant plasmid pTRIDT314 is imported to the competent cell of agrobacterium tumefaciens lba4404, through the positive recon called after LBA4404-pTRIDT314 of Screening and Identification.
2) adopt leaf dish method by recon transformation of tobacco, concrete operation step is as follows:
A. get the blade of young tender health, use distilled water flushing one time, 70% ethanol is washed 45s, 10% clorox sterilization 6-8min, aseptic water washing 5 times, aseptic filter paper suck dry moisture.
B. single bacterium colony agrobacterium tumefaciens of picking, is inoculated into 20ml containing in Rifampin and the antibiotic YEB nutrient solution of kantlex, and on 28 ℃, 180rpm constant-temperature table, cultivating OD value is 0.6-0.8.Get above culture in 1% ratio, proceed in the fresh YEB nutrient solution without antibiotic, continue to cultivate 8-12 hour, when OD value can be used for conversion during for 0.4-0.6.
C. on Bechtop, pour bacterium liquid into aseptic little culture dish, adding final concentration is the Syringylethanone of 120 μ m/L, aseptic blade is cut into the fritter of 0.5cm * 0.5cm, puts into bacterium liquid and steeps 6-8 minute.Take out explant and on aseptic filter paper, suck the bacterium liquid adhering to.Then be seeded on MS substratum 28 ℃ of dark cultivations 2 days.
D. will transfer to containing 1.0mg/L6-BA through the explant of cultivating altogether, 0.1mg/LNAA, on the MS substratum of 40mg/L Totomycin and 150mg/L Timentin.Under the condition of illumination, select for 25 ℃ to cultivate.
E. select to cultivate 2-3 after week, when indefinite bud grows to 1cm left and right, cut indefinite bud and transfer on the MS substratum that contains 40mg/L Totomycin and 150mg/L Timentin and carry out root culture.
F. within about two weeks, grow adventive root, be then transplanted in soil.
3) detection of transgene tobacco positive plant
The transgenic tobacco plant with hygromycin resistance more than obtaining has three kinds of situations, a kind of for only having selectable marker gene to proceed to plant; The second is that selectable marker gene and GFP gene are incorporated into karyomit(e) same position altogether; The third is incorporated into chromosomal different positions altogether for selectable marker gene and GFP gene, and this is to obtain by offspring's selfing separation the transfer-gen plant of marker-free.By GUS, dye and detect the transfer-gen plant that can screen the second and the third situation with GFP.Concrete grammar is as follows:
A.GUS dyeing
The blade of getting regeneration plant carries out GUS dyeing, and ready blade is put into EP pipe, adds X-GLUC staining fluid submergence blade, seals lid; Put into 37 ℃ of incubator temperature and bathe 1-12h; Outwell and infect liquid and add 70% ethanol decolorization 2-3 time, till removing chlorophyll to negative control and be white, observe leaf color.Positive plant blade is dyed to blueness, is white or faint yellow after non-positive plant blade fades.
B.GFP detects
Get blade or the tip of a root of regeneration plant and make section; Use fluorescent microscope or laser confocal microscope under 488nm wavelength blue-light excited, observe the expression of GFP.Under fluorescent microscope or laser confocal microscope, positive plant blade is inspired green fluorescence, and non-positive plant blade is without fluorescence.
The present invention by plasmid pTRIDT314 transformation of tobacco, obtains transfer-gen plant by leaf dish method, and the blade of getting regeneration plant carries out respectively GUS dyeing and GFP detection.Positive plant comprises three kinds of situations, and a kind of is that plant leaf can only be dyed blueness by GUS dye liquor, does not observe green fluorescence; Another kind is that plant leaf can not be dyed blueness by GUS dye liquor, but can observe green fluorescence; Finally a kind of is that plant leaf can be dyed blueness by GUS dye liquor, can observe green fluorescence again.
4) acquisition of marker-free gene plant
Adopt the method for GUS dyeing, GFP observation and pcr amplification, the 70 strain tobacco regeneration plants through hygromycin selection survival are detected, result is as follows: by pcr amplification gus gene and blade GUS, dye, obtain the positive reconstituted tobacco seedlings (Fig. 9) of 17 strains; By pcr amplification GFP gene and fluorescent microscope GFP, observe, obtain the positive reconstituted tobacco seedling (Figure 10) of 13 strains; Wherein, the 13 strain reconstituted tobacco seedlings that GFP gene can be detected can detect gus gene, and have 5 strain reconstituted tobacco seedlings gus gene can only be detected.This obtaining 13 strains have the reconstituted tobacco seedling of gus gene and GFP gene to substitute aforesaid method screening by T2-Tn to reject the common integration plant containing selectable marker gene simultaneously, obtain only having GFP gene and the safe plant of not carrying selectable marker gene.If by goal gene be connected into GFP reporter gene place T ?DNA region, by this method, screen and obtain only observing green fluorescence and can not be dyed blue plant for not with the safe plant of selectable marker gene by GUS dye liquor.The constructed two reporter gene double T-DNA carriers of this presentation of results the present invention can be used for obtaining the safe plant of marker-free.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements, all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (10)
1. a method that builds double T-DNA carrier, is characterized in that, described double T-DNA carrier is pTRIDT313, comprises the following steps:
(1) take pCMBIA1302 carrier as template, with nucleotides sequence shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, SEQ ID NO.4, classify primer as, carry out respectively pcr amplification and obtain T-DNA left and right border LB and RB, LB introduces restriction enzyme site SphI and BglII, and RB introduces restriction enzyme site SacI and SphI;
(2) border, left and right LB and RB are linked respectively to pMD19-T carrier, carry out respectively enzyme with skeleton carrier pCAMBIA1302 and cut, then carry out three fragment connections with T4 ligase enzyme, obtain the double T-DNA carrier pTRIDT313 containing two cover T-DNA borders.
2. the double T-DNA carrier that contains two reporter genes, is characterized in that, this carrier has two T-DNA regions, and reporter gene GUS and Select gene are contained in a T-DNA region, and reporter gene GFP and goal gene are contained in another T-DNA region.
3. the double T-DNA carrier that contains two reporter genes as claimed in claim 2, it is characterized in that, described Select gene is hygromycin phosphotransferase gene hpt, paraxin phosphoric acid transferase gene cat, neomycin phosphotransferase gene npt II, Herbicid resistant Bar gene.
4. the double T-DNA carrier that contains as claimed in claim 2 or claim 3 two reporter genes, is characterized in that, it is pTRIDT314.
5. the construction process that contains the double T-DNA carrier of two reporter genes as described in claim 2 or 3, is characterized in that, comprises the following steps:
(1) structure of double T-DNA carrier, comprising:
1) take pCMBIA1302 carrier as template, with nucleotides sequence shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, SEQ ID NO.4, classify primer as, carry out respectively pcr amplification and obtain T-DNA left and right border LB and RB, LB introduces restriction enzyme site SphI and BglII, and RB introduces restriction enzyme site SacI and SphI;
2) border, left and right LB and RB are linked respectively to pMD19-T carrier, carry out respectively enzyme with skeleton carrier pCAMBIA1302 and cut, then carry out three fragment connections with T4 ligase enzyme, obtain the double T-DNA carrier pTRIDT313 containing two cover T-DNA borders;
(2) contain the structure of the intermediate carrier of gus gene, comprise that pcr amplification obtains gus gene, be connected to pMD19-T carrier, by restriction enzyme site, pTRIDT313 carrier hygromycin phosphotransferase gene is replaced to gus gene, obtain the intermediate carrier pTRIDT313-GUS containing gus gene;
(3) intermediate carrier pTRIDT313-GUS is connected after SacI cuts with EcoRI enzyme with the T carrier that is connected selectable marker gene, selectable marker gene inserts after intermediate carrier pTRIDT313-GUS, obtains the double T-DNA carrier that contains two reporter genes.
6. construction process as claimed in claim 5, is characterized in that, the primer sequence that in step (2), pcr amplification obtains gus gene use is as shown in SEQ ID NO.7 and SEQ ID NO.8.
7. construction process as claimed in claim 5, is characterized in that, described in step (2), restriction enzyme site is XhoI.
8. construction process as claimed in claim 5, is characterized in that, in step (3), selectable marker gene is hygromycin phosphotransferase gene.
9. the application of the double T-DNA carrier that contains two reporter genes as described in as arbitrary in claim 2～4 in the transgenic plant of screening marker-free.
10. the application of the double T-DNA carrier that contains two reporter genes as described in as arbitrary in claim 2～4 in detecting transgenic plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410175961.6A CN103952426B (en) | 2014-04-28 | 2014-04-28 | A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410175961.6A CN103952426B (en) | 2014-04-28 | 2014-04-28 | A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103952426A true CN103952426A (en) | 2014-07-30 |
| CN103952426B CN103952426B (en) | 2016-06-08 |
Family
ID=51329777
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410175961.6A Active CN103952426B (en) | 2014-04-28 | 2014-04-28 | A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103952426B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651396A (en) * | 2015-03-19 | 2015-05-27 | 海南大学 | Construction method of plant expression vector pCAMBIA1304-hpa1xoo and expression vector |
| CN105505988A (en) * | 2015-12-25 | 2016-04-20 | 四川农业大学 | Double T-DNA vector capable of achieving agrobacterium co-transformation and establishment method and application thereof |
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1654662A (en) * | 2004-02-09 | 2005-08-17 | 中国科学院遗传与发育生物学研究所 | Method for cultivating transgenic plant without selective marker and its special expression vector |
| US20060041956A1 (en) * | 2004-04-06 | 2006-02-23 | Pioneer Hi-Bred International, Inc. | Vectors for plant transformation and methods of use |
| CN102102108A (en) * | 2009-12-01 | 2011-06-22 | 北京未名凯拓作物设计中心有限公司 | Method for cultivating efficient selected-marker-free transgenic crop by using double T-DNA+1 vectors |
| CN102703499A (en) * | 2012-06-27 | 2012-10-03 | 浙江省农业科学院 | Method for converting disease-resistance genes of rice and obtaining transgenic descendants without selective markers |
| CN103255166A (en) * | 2013-05-20 | 2013-08-21 | 中国农业科学院植物保护研究所 | Ultra-binary vector as well as construction method and application thereof |
-
2014
- 2014-04-28 CN CN201410175961.6A patent/CN103952426B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1654662A (en) * | 2004-02-09 | 2005-08-17 | 中国科学院遗传与发育生物学研究所 | Method for cultivating transgenic plant without selective marker and its special expression vector |
| US20060041956A1 (en) * | 2004-04-06 | 2006-02-23 | Pioneer Hi-Bred International, Inc. | Vectors for plant transformation and methods of use |
| CN102102108A (en) * | 2009-12-01 | 2011-06-22 | 北京未名凯拓作物设计中心有限公司 | Method for cultivating efficient selected-marker-free transgenic crop by using double T-DNA+1 vectors |
| CN102703499A (en) * | 2012-06-27 | 2012-10-03 | 浙江省农业科学院 | Method for converting disease-resistance genes of rice and obtaining transgenic descendants without selective markers |
| CN103255166A (en) * | 2013-05-20 | 2013-08-21 | 中国农业科学院植物保护研究所 | Ultra-binary vector as well as construction method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| SONGBIAO CHEN,ET AL.: "Green fluorescent protein as a vital elimination marker to easily screen marker-free transgenic progeny derived from plants co-transformed with a double T-DNA binary vector system", 《PLANT CELL REP》, vol. 23, 31 December 2005 (2005-12-31), pages 625 - 631, XP019335420, DOI: doi:10.1007/s00299-004-0853-4 * |
| 李煦等: "多基因双T-DNA植物表达载体的构建及拟南芥转化", 《山东大学学报（理学报）》, vol. 42, no. 9, 30 September 2009 (2009-09-30), pages 1 - 7 * |
| 陆晓春等: "转基因植物中的标记基因及其消除", 《浙江农业学报》, vol. 13, no. 1, 31 December 2001 (2001-12-31), pages 49 - 54 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104651396A (en) * | 2015-03-19 | 2015-05-27 | 海南大学 | Construction method of plant expression vector pCAMBIA1304-hpa1xoo and expression vector |
| CN105505988A (en) * | 2015-12-25 | 2016-04-20 | 四川农业大学 | Double T-DNA vector capable of achieving agrobacterium co-transformation and establishment method and application thereof |
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103952426B (en) | 2016-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
| CN108913795B (en) | Southern rice black-streaked dwarf resistant locus qSRBSDV9 and molecular marking method thereof | |
| CN104878092B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9953 | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| Donahoo et al. | Phytophthora foliorum sp. nov., a new species causing leaf blight of azalea | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| BR112021009416A2 (en) | nucleic acid sequences for dbn8002 soybean plant detection and methods of detection thereof | |
| CN115820685A (en) | Citrus CsGSTF1 gene and application thereof | |
| CN103952426B (en) | A kind of double T-DNA carrier containing double; two reporter genes and construction method thereof and application | |
| CN104593381B (en) | A kind of corn resistant gene of salt and its application | |
| CN104818296A (en) | Method for building Chinese cabbage genetic transformation system by cell-penetrating peptide and microspore culture | |
| CN108018369B (en) | Creation, detection and application of corn transformation event ZM2-104 | |
| CN102492721A (en) | Sesame genetic transformation method mediated by agrobacterium | |
| CN107858372A (en) | A kind of agriculture bacillus mediated cotton transient transformation methods | |
| CN102911941B (en) | Root-specific promoter and application thereof | |
| CN102031270A (en) | Method for culturing apple seedling by agrobacterium-mediated high-efficiency transformation system | |
| CN115725643A (en) | Application of NtMYB35 transcription factor in tobacco black shank resistance | |
| CN115820686A (en) | Citrus CsGSTU18 gene and application thereof | |
| CN105505988A (en) | Double T-DNA vector capable of achieving agrobacterium co-transformation and establishment method and application thereof | |
| CN104878097B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9981 | |
| CN111254212B (en) | Rice blast resistance gene Pi68(t) close linkage molecular marker and application thereof | |
| CN107475285A (en) | A kind of Xa21 gene mutation bodies plant and preparation method thereof | |
| CN103923922B (en) | Heavy metal evoked promoter is cultivating the application in heavy metal pollution of soil early warning transgenic plant | |
| CN110129471A (en) | It is a kind of for detecting the nucleic acid sequence and its detection method of rice plants ZUPM01 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |