CN115820685A - Citrus CsGSTF1 gene and application thereof - Google Patents
Citrus CsGSTF1 gene and application thereof Download PDFInfo
- Publication number
- CN115820685A CN115820685A CN202211004475.9A CN202211004475A CN115820685A CN 115820685 A CN115820685 A CN 115820685A CN 202211004475 A CN202211004475 A CN 202211004475A CN 115820685 A CN115820685 A CN 115820685A
- Authority
- CN
- China
- Prior art keywords
- citrus
- csgstf1
- gene
- vigs
- canker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a citrus CsGSTF1 gene and application thereof, wherein the citrus CsGSTF1 gene is a susceptible gene of citrus canker, and the nucleotide sequence of the gene is SEQ ID NO:1 or in SEQ ID NO:1 is substituted, deleted or added with one or more nucleotides and has a nucleotide sequence for coding proteins with the same activity; the application method specifically comprises the following steps: (1) cloning VIGS fragment of citrus CsGSTF1 gene; (2) constructing an expression vector of VIGS; (3) And transforming the citrus by the VIGS expression vector to obtain a VIGS plant with the silenced citrus CsGSTF1 gene. The invention clones and obtains the citrus CsGSTF1 gene for the first time and usesVIGS silencing reduces the transcription level of the citrus CsGSTF1, and verifies the function of the CsGSTF1 in citrus canker resistance; obtaining H of VIGS silent plant 2 O 2 The content is obviously increased, the resistance to the citrus canker is greatly enhanced, the incidence degree of the canker is obviously reduced, and the method has great application value in breeding of citrus canker resistant diseases.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a citrus CsGSTF1 gene and application thereof.
Background
Citrus canker (CBC) is a bacterial disease caused by the Xanthomonas citri subsp. Therefore, it is an urgent need for the development of the citrus industry to enhance the research on the prevention and control of citrus canker.
The traditional prevention and control means of citrus canker, such as burning of diseased trees, use of pesticides and the like, need to invest a large amount of manpower and material resources and cause huge environmental hazards. Therefore, prevention and treatment of citrus canker are more hopeful to be used for breeding new disease-resistant germplasm. The molecular breeding can be used for directionally and efficiently cultivating new disease-resistant germplasm, so that the molecular breeding is rapidly developed and widely applied at present. In recent years, some anti-ulcer citrus resources, such as the strains of malorange, xinhui orange and navel orange which transfer tussah antimicrobial peptide D gene, have been obtained by biotechnology means; an evening splendid orange line overexpressing CsBZIP 40; and (3) a plant with improved resistance to citrus canker, which is obtained by editing a citrus canker susceptible gene CsLOB1 promoter at a fixed point by using the gene, and the like. However, high-quality candidate genes are still deficient, and the research on functions and action mechanisms is not deep, so that more genes closely related to citrus canker are urgently needed to be purposefully excavated, and the functions and mechanisms of the genes are deeply analyzed for anti-canker molecular breeding.
glutathione-S-transferase, which is ubiquitous in animals, plants and microorganisms, is a superfamily of enzymes encoded by multiple genes and having multiple functions. GST families are divided into 8 subfamilies of F (Phi), U (Tau), T (Theta), Z (Zeta), L (Lambda), DHAR, EF1B γ and TCHQD, based on homology and gene structural features of plant proteins, wherein the F and U subfamilies are plant-specific, with the most members and abundant content compared to the other subfamilies (Jain et al, 2010). At present, plant GST protein is successively found in plants such as corn, arabidopsis thaliana, soybean, rice, tobacco and the like, and has the functions of detoxification, metabolite transportation, stress regulation, growth and development regulation, signal transduction and the like in the plants. Although GST regulation has been partially applied to plant disease resistance, no related research has been reported in the field of citrus canker.
In view of this, the present application is specifically made.
Disclosure of Invention
The invention provides a citrus CsGSTF1 gene and application thereof in enhancing the resistance of citrus to canker for improving the resistance of citrus to canker, the citrus CsGSTF1 gene is obtained by cloning for the first time, and the VIGS vector of the citrus CsGSTF1 gene is transferred into citrus, so that the transcription level of the citrus CsGSTF1 is reduced, the resistance of the citrus to canker can be obviously improved, the morbidity degree of the canker is reduced, and the phenotype of a transgenic plant is not influenced.
The invention is realized by the following technical scheme:
a citrus CsGSTF1 gene, wherein the nucleotide sequence of the citrus CsGSTF1 gene is SEQ ID NO:1 or in SEQ ID NO:1 is substituted, deleted or added with one or more nucleotides and has a nucleotide sequence for coding proteins with the same activity.
The invention also provides application of the citrus CsGSTF1 gene in enhancing the resistance of citrus to canker, and the application method is to reduce the transcription level of the CsGSTF1 gene in citrus plants.
Further, VIGS silencing is used as a means to reduce CsGSTF1 gene transcript levels in citrus.
Further, the application method specifically comprises the following steps:
(1) Cloning VIGS fragment of citrus CsGSTF1 gene;
(2) Constructing an expression vector of VIGS;
(3) And transforming the citrus by the VIGS expression vector to obtain a VIGS plant with the silenced citrus CsGSTF1 gene.
Further, in the step (1), the cloning method of the VIGS fragment of the citrus CsGSTF1 gene comprises the following steps: extracting total citrus RNA, carrying out reverse transcription to obtain cDNA, carrying out high-fidelity enzyme PCR amplification by using the cDNA as a template to obtain a VIGS fragment of the citrus CsGSTF1 gene, wherein the nucleotide sequence is SEQ ID NO:2, respectively.
Further, in the step (1), primers used for PCR amplification are CsGSTF1-VIGS-F and CsGSTF1-VIGS-R, and nucleotide sequences thereof are respectively SEQ ID NO:3 and SEQ ID NO:4.
further, in the step (2), the construction method of the VIGS gene fragment expression vector comprises the following steps: and (2) carrying out enzyme digestion on the VIGS fragment of the PCR product orange CsGSTF1 gene obtained in the step (1) through Xba I and Sma I, recovering the enzyme-digested VIGS fragment, connecting the recovered enzyme-digested VIGS fragment with a TRV2 vector, transforming an escherichia coli competent cell, and extracting a plasmid to obtain the VIGS expression vector of the CsGSTF1 gene.
Further, in the step (3), the method for transforming citrus by the VIGS expression vector comprises the following steps: transforming agrobacterium into the VIGS expression vector obtained in the step (2), preparing agrobacterium liquid containing the VIGS expression vector, infecting aseptic citrus seedlings, and obtaining VIGS plants with silenced citrus CsGSTF1 genes after fluorescence observation, PCR and qRT-PCR verification.
Further, after the VIGS plant is obtained in the step (3), the resistance evaluation of the citrus canker is carried out on the VIGS plant, and the fact that the citrus CsGSTF1 gene silencing can enhance the resistance of the citrus canker is judged.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the citrus CsGSTF1 gene provided by the embodiment of the invention is a glutathione-S-transferase CsGSTF1 which is obtained from genes differentially expressed before and after citrus canker infection and has the early expression and the down regulation in the infection of citrus canker infection in disease-resistant varieties and the up regulation in the infection of disease-susceptible varieties, and can reduce H in citrus cells during transient overexpression 2 O 2 The content shows that the CsGSTF1 gene is a susceptible gene of the citrus canker;
2. according to the citrus CsGSTF1 gene and the application thereof in enhancing the resistance of citrus to canker, the VIGS vector of the citrus CsGSTF1 gene is constructed, agrobacterium-mediated transformation is carried out on citrus, an obtained citrus plant can obviously resist the canker, the scab area is reduced by 25%, the disease index is reduced by 21%, and the morbidity degree of the canker is obviously reduced;
3. according to the citrus CsGSTF1 gene and the application thereof in enhancing the resistance of citrus to canker, the morbidity degree of citrus canker can be obviously reduced through VIGS silencing of the citrus CsGSTF1 gene, and the phenotype of a citrus plant cannot be influenced by the VIGS silencing of the citrus CsGSTF1 gene;
4. the embodiment of the invention provides a citrus CsGSTF1 gene and application thereof in enhancing canker resistance of citrus, wherein glutathione-S-transferase activity and H of VIGS silent plants are subjected to glutathione-S-transferase activity 2 O 2 Content detection shows that the silencing of the citrus CsGSTF1 gene can be realized by increasing H 2 O 2 Content, so as to enhance the canker resistance of the citrus CsGSTF1 silent plant;
5. the citrus CsGSTF1 gene and the application thereof in enhancing the canker resistance of citrus provided by the embodiment of the invention can be used as a candidate gene to perform canker resistance breeding with multiple canker resistance and susceptibility genes by utilizing the cooperation of technologies such as VIGS silencing, RNA interference, gene editing and the like, and has great application value in the canker resistance breeding of citrus.
Drawings
In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and that for those skilled in the art, other related drawings can be obtained from these drawings without inventive effort.
FIG. 1 is a bioinformatics profile of citrus CsGSTF1 according to an embodiment of the present invention: a, chromosome location of a citrus CsGSTF1 gene; b, the gene structure of the citrus CsGSTF 1; c, a conserved domain of citrus CsGSTF 1;
FIG. 2 is an induced expression diagram of Sclerotinia citrea of Citrus csGSTF1 according to the present invention: the letters on the data bars indicate significance of difference (P < 0.05);
FIG. 3 is a hormone-induced expression profile of citrus CsGSTF1 according to an embodiment of the present invention: the letters on the data bars indicate significance of difference (P < 0.05);
FIG. 4 is a diagram of transient overexpression vector of citrus CsGSTF1 constructed in the embodiment of the present invention: and (4) GUS: a beta-glucuronidase gene; NPTII, kanamycin resistance gene; 35S, a plant constitutive promoter derived from cauliflower mosaic virus; NOS, opine synthase gene terminator; LB, left homology arm; RB, right homology arm;
FIG. 5 shows the relative expression of citrus CsGSTF1 in transient overexpression material according to the present invention: * Differential significance (P = 0.05);
FIG. 6 shows GST enzyme activity and H activity in transient overexpression materials in accordance with embodiments of the present invention 2 O 2 The content is as follows: a, GST enzyme activity; b, H 2 O 2 Content (c); pLGNe, material transiently transformed with empty vector; pLGNe-GSTF1, material for transient transformation of CsGSTF1 overexpression vector;
FIG. 7 is a flowchart of an embodiment of VIGS silencing using the citrus CsGSTF1 gene to increase resistance to citrus canker in accordance with an embodiment of the present invention;
FIG. 8 is a diagram of a VIGS vector of the CsGSTF1 gene of a citrus plant according to an embodiment of the present invention: GFP, green fluorescent protein; rdRp, NA-dependent RNA polymerase; CP, coat protein; 35S, plant constitutive promoter from cauliflower mosaic virus; NOS, opine synthase gene terminator; LB, left homology arm; RB, right homology arm;
FIG. 9 is a PCR detection chart of VIGS plants according to the embodiment of the present invention: +, positive control; negative control; m, molecular weight standard; 1, VIGS plant of csgstf1; TRV1, TRV2, detection result diagrams of two carriers;
FIG. 10 is a qRT-PCR detection chart of CsGSTF1 expression in VIGS plants of the present invention: * The difference was significant (P = 0.05) (the same applies below); TRV2, empty vector plants (same below); TRV2-GSTF1, plant of VIGS vector for transforming CsGSTF1 (the same below);
FIG. 11 is a plant phenotype diagram of VIGS according to an embodiment of the present invention: WT, non-transgenic plants;
FIG. 12 shows the disease of VIGS plants after the leaves are inoculated with the canker pathogen according to the embodiment of the invention;
FIG. 13 is a statistical chart of lesion size after inoculation of canker pathogen on the leaves of VIGS plants according to the embodiment of the present invention;
FIG. 14 is a statistical chart of disease indexes of VIGS plant leaves inoculated with canker pathogens according to the embodiment of the invention;
FIG. 15 shows the GST enzyme activity and H activity of VIGS plants 2 O 2 The contents are as follows: a, GST enzyme activity; b, H 2 O 2 And (4) content.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not meant to limit the present invention.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, it will be apparent to one of ordinary skill in the art that: it is not necessary to employ these specific details to practice the present invention. In other instances, well-known materials or methods have not been described in detail in order to avoid obscuring the present invention.
Throughout the specification, reference to "one embodiment," "an embodiment," "one example," or "an example" means: the particular features, structures, or characteristics described in connection with the embodiment or example are included in at least one embodiment of the invention. Thus, the appearances of the phrases "one embodiment," "an embodiment," "one example" or "an example" in various places throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures, or characteristics may be combined in any suitable combination and/or sub-combination in one or more embodiments or examples. Further, those of ordinary skill in the art will appreciate that the illustrations provided herein are for illustrative purposes and are not necessarily drawn to scale. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
Example 1
Bioinformatics analysis of citrus CsGSTF1
As shown in FIG. 1, the citrus CsGSTF1 gene is located between 27945446bp to 27946977bp of citrus chromosome 3 (FIG. 1A), contains 2 introns and 3 exons, encodes 221 amino acids (FIG. 1B), and contains GST functional domains at the N-terminal and C-terminal (FIG. 1C).
The nucleotide sequence of the CsGSTF1 gene is SEQ ID NO:1:
ATGGCAACTCCAGTAAAAGTGTACGGTCCGCCACTCTCTACTGCCGTGTGCAGGGTCGTAGCCTGTCTCCTGGAGAAAGATGTGGAGTTTCAGCTCATTTCCCTCAACATGGCTAAAGGCGATCACAAGAAACCTGATTTTCTGAAGATCCAGCCCTTTGGCCAAGTACCAGCATTTCAGGATGAGAAAATCTCCCTCTTTGAGTCTCGAGCTATATGCCGCTATGTTTGTGAGAATTATCCAGAAAAAGGAAACAAGGGATTATTTGGAACAAATCCGTTGGCAAAAGCTTCAATAGATCAGTGGCTGGAAGCCGAGGGGCAAAGCTTTAACCCGCCAAGCTCTGCTCTAGTGTTTCAACTAGCACTCGCTCCTCGAATGAACATCAAGCAAGACGAAGGAGTAATCAAACAGAATGAAGAAAAGCTGGCAAAAGTGCTCGATGTTTATGAGAAGAGGCTGGGGGAGAGTCGGTTCTTGGCTGGGGATGAATTTTCTTTGGCTGATCTTTCACACTTGCCTAATGCGCATTATTTGGTGAATGCAACTGATAGAGGAGAGATTTTAACTTCCAGGGATAATGTAGGGAGATGGTGGGGTGAGATTTCGAACAGAGATTCATGGAAGAAGGTGGTTGATATGCAGAAACAGCAGCACAGTCCTTGA。
example 2
Expression analysis of Citrus CsGSTF1
1. Citrus canker germ induction expression of citrus CsGSTF1
In order to verify the relation between the citrus CsGSTF1 and the infection of citrus canker germs, the citrus canker germs are inoculated in a disease-resistant variety kumquat and a susceptible variety malva by injection, and qRT-PCR primers CsGSTF1-RT-F and CsGSTF1-RT-R are designed according to a specific region of the citrus CsGSTF 1.
qRT-PCR reaction conditions: 95 ℃ for 3min,95 ℃ for 10s; circulation is carried out for 40 times at 56 ℃ and 10s, at 72 ℃ and 10s; 10min at 72 ℃; by use of 2 -ΔΔCt The method calculates the relative expression quantity of the CsGSTF1 gene in the plant.
Nucleotide sequence of primer CsGSTF1-RT-F SEQ ID NO:5 is as follows:
TCTCGAGCTATATGCCGCTATG
the nucleotide sequence of the primer CsGSTF1-RT-R is SEQ ID NO:6 is as follows:
TTGGCGGGTTAAAGCTTTGC。
the analysis on the induced expression characteristics of CsGSTF1 infected by citrus canker pathogenic bacteria shows that as shown in FIG. 2: in the late orange, the expression level of CsGSTF1 is obviously increased in the early stage of citrus canker pathogen infection, while in the kumquat, the expression level of CsGSTF1 is reduced in the early stage of citrus canker pathogen infection. From the above results, it was presumed that CsGSTF1 is a susceptible gene of citrus canker, and its expression level is inversely correlated with canker resistance.
2. Hormone-induced expression of citrus CsGSTF1
To further determine the relevance of citrus CsGSTF1 to citrus canker, the induced expression of CsGSTF1 by the hormones Abscisic acid (ABA), jasmonic Acid (JA) and Salicylic acid (Salicylic acid, SA) related to the plant biological stress is analyzed, as shown in FIG. 3, the result shows that CsGSTF1 has different expression patterns after the mallow orange and the kumquat are induced by 3 hormones, which indicates that CsGSTF1 responds to signal transduction pathways of the 3 hormones to different degrees, and further verifies that CsGSTF1 is related to citrus resistance and citrus canker.
3. Transient overexpression of citrus CsGSTF1
For analysis of CsGSTF1 in Citrus cell H 2 O 2 Function in content control, csGSTF1 gene was inserted into pLGNe vector to construct CsGSTF1 overexpression vector as shown in FIG. 4pLGNe-GSTF1, and transiently injecting late orange leaves. As shown in FIG. 5, the CsGSTF1 is obviously over-expressed in the material which is transiently over-expressed for 5 days, and as can be seen from FIG. 6, the GST enzyme activity of the over-expressed material is obviously increased (FIG. 6A), H 2 O 2 The content was significantly reduced (fig. 6B), further indicating that CsGSTF1 gene is a susceptible gene to citrus canker.
Example 3
Enhanced citrus canker resistance using citrus CsGSTF1 silencing
As shown in FIG. 7, the specific implementation process of the invention for improving citrus canker resistance by using CsGSTF1 silencing comprises VIGS fragment cloning, vector construction, citrus transformation, positive identification and resistance evaluation.
Cloning of the VIGS fragment
1) RNA extraction and cDNA Synthesis
Total RNA of Malus asiatica was extracted using RNA extraction kit (Idela, CAT: RN 09), and cDNA was reverse transcribed using Recombinant DNase I (TAKARA), to obtain a VIGS fragment of CsGSTF1 gene whose nucleotide sequence is SEQ ID NO:2 is as follows:
CTCGCTCCTCGAATGAACATCAAGCAAGACGAAGGAGTAATCAAACAGAATGAAGAAAAGCTGGCAAAAGTGCTCGATGTTTATGAGAAGAGGCTGGGGGAGAGTCGGTTCTTGGCTGGGGATGAATTTTCTTTGGCTGATCTTTCACACTTGCCTAATGCGCATTATTTGGTGAATGCAACTGATAGAGGAGAGATTTTAACTTCCAGGGATAATGTAGGGAGATGGTGGGGTGAGATTTCGAACAGAGATTCATGGAAGAAGGTGGTTGATATGCAGAAACAGCAGCACAGTCCTTGA。
2) Amplification of VIGS fragment of CsGSTF1 Gene
1.2.1 cloning the VIGS fragment of CsGSTF1 gene with the PrimeSTAR master mix (TAKARA) kit, the length is 300bp;
1.2.2 carrying out PCR amplification by using primers CsGSTF1-VIGS-F and CsGSTF 1-VIGS-R;
1.2.3 agarose gel containing the desired fragment was cut, and RNAi fragment was recovered by using DNA gel recovery kit (Edley).
And (3) PCR reaction conditions: at 98 ℃ for 5min;98 ℃,30s,56 ℃,30s,72 ℃,1.5min,35 cycles; extension at 72 ℃ for 10min.
Nucleotide sequence of primer CsGSTF1-VIGS-F SEQ ID NO:3 is as follows:
GCTCTAGACTCGCTCCTCGAATGAACATC
nucleotide sequence of primer CsGSTF1-VIGS-R SEQ ID NO:4 is as follows:
GCCCCGGGTCAAGGACTGTGCTGCTG。
construction of the VIGS vector
As shown in fig. 8, the VIGS fragment of VIGS vector TRV2 and CsGSTF1 gene was digested with Xba I and Sma I, gel recovered, then the two fragments were ligated and transformed into escherichia coli competent cells, and plasmid was extracted to obtain VIGS expression vector TRV2-GSTF1; wherein, GFP: green fluorescent protein; rdRp: a NA-dependent RNA polymerase; and (3) CP: a coat protein; 35S: a plant constitutive promoter derived from cauliflower mosaic virus; NOS: opine synthase gene terminators; LB: a left homology arm; RB: and (4) a right homology arm. Transforming the vector TRV2-GSTF1 into agrobacterium by an electric shock method to prepare agrobacterium liquid containing the VIGS expression vector.
Transformation of the VIGS vector
1) Agrobacterium activation
Respectively adding 500 μ L of TRV1, TRV2, and TRV2-GSTF1 Agrobacterium liquid into 50mL of liquid LB medium (containing kanamycin) at 28 deg.C and 200r min -1 Cultured to OD 600 =1; the cells were collected and used as MMA (10 mM MgCl) 2 10nM MES, 100. Mu.M acetosyringone) liquid, and adjusting OD 600 =1; TRV1 is mixed with TRV2 and TRV2-GSTF1 carrier in the volume ratio of 1:1 and incubated at room temperature for 3 hr.
2) Infection with Agrobacterium
Immersing sterile seedlings with embryonic roots growing to 3cm into the agrobacterium liquid, and vacuumizing for 1min by using a vacuum pump; washing with sterile water for 3-5 times, culturing in seed culture medium at room temperature in dark for 2-3 d, transferring to soil for culturing, culturing at 25 deg.C in light/dark for 16h/8h, and periodically watering.
VIGS Positive identification and phenotypic Observation
The seedlings which show green fluorescence under ultraviolet light are positive seedlings, then the seedlings are transferred to a nutrient soil culture medium, after one month, tissues are collected to extract DNA and total RNA, and PCR verification is carried out by using two pairs of primers CsGSTF1-ID1-F, csGSTF-ID 1-R and CsGSTF1-ID2-F, csGSTF-ID 2-R, so as to obtain TRV1 and TRV2 carrier fragments respectively, as shown in figure 9.
Nucleotide sequence of primer CsGSTF1-ID1-F SEQ ID NO:7 is as follows:
TTGGGTTGCTACTGATTCGACT
nucleotide sequence of primer CsGSTF1-ID1-R SEQ ID NO:8 is as follows:
CTGTAAGGACCATCATACTTCGC
nucleotide sequence of primer CsGSTF1-ID2-F SEQ ID NO:9 is as follows:
CTGCCCGACAACCACTACCT
nucleotide sequence of primer CsGSTF1-ID2-R SEQ ID NO:10 is as follows:
CTTGTACAGCTCGTCCATGCC。
and (3) PCR reaction conditions: 3min at 94 ℃; 30 cycles of 94 ℃ 30s,58 ℃ 30s,72 ℃ 30s; 10min at 72 ℃.
And (3) carrying out qRT-PCR by using primers CsGSTF1-RT-F and CsGSTF1-RT-R to verify whether CsGSTF1 is successfully silenced. Setting the gene expression level of the TRV1 and TRV2 empty vector plants as 1, and if the gene expression level of the CsGSTF1 of the plant containing the target fragment vector is less than 1, generating gene silencing. Through identification, as shown in fig. 10, the CsGSTF1 transcription level is decreased by 48%.
qRT-PCR reaction conditions: 95 ℃ for 3min,95 ℃ for 10s; circulation is carried out for 40 times at 56 ℃ and 10s, at 72 ℃ and 10s; 10min at 72 ℃.
As shown in FIG. 11, the phenotype of the positive plant after fluorescence observation, PCR identification and qRT-PCR identification has no obvious difference compared with the wild type, and the silencing of CsGSTF1 has no adverse effect on the growth and development of citrus.
5. Evaluation of resistance
The in vitro needling method is used for evaluating the resistance of the VIGS plants to the canker, and the specific operation is as follows:
collecting mature leaves, cleaning, disinfecting with 75% alcohol, and washing in ultrapure water; pricking with vein as center, using pipette to sample ulcer bacteria solution, and sampling 1 μ L (1 × 10) per pinhole 5 CFU·mL -1 ) Constant temperature at 28 ℃Culturing in a light incubator (16 h light/8 h dark); the leaf is inoculated and cultured for 10 days for photographing, and the size of the lesion is counted by using Image J V1.47.
Calculating disease index according to disease index formula, classifying the disease into 0-7 grades according to lesion area, and expressing the lesion area with letter R, 0 grade (R is less than or equal to 0.25 mm) 2 ) Class 1 (0.25 mm) 2 ＜R≤0.5mm 2 ) Class 2 (0.5 mm) 2 ＜R≤0.75mm 2 ) Class 3 (0.75 mm) 2 ＜R≤1mm 2 ) Class 4 (1.0 mm) 2 ＜R≤1.25mm 2 ) Grade 5 (1.25 mm) 2 ＜R≤1.5mm 2 ) Class 6 (1.5 mm) 2 ＜R≤1.75mm 2 ) Class 7 (R > 1.75 mm) 2 ). Calculating the degree of disease according to the formula: DI =100 × Σ [ number of lesions at each stage × corresponding stage value ]/(total number of lesions × maximum stage).
As shown in FIGS. 12-14, after inoculation of 10d for ulcerative bacteria, VIGS plant symptoms of CsGSTF1 were significantly reduced; the lesion area is reduced by 25 percent; the disease index is reduced by 21 percent. Therefore, csGSTF1 gene silencing can enhance citrus canker resistance.
Example 4
Mechanism for analyzing citrus CsGSTF1 silencing to improve citrus canker resistance
As shown in FIG. 15, GST enzyme activity and H activity on CsGSTF 1-silenced plants 2 O 2 The content is detected, and the GST enzyme activity is obviously reduced, while H 2 O 2 The content is obviously increased. H 2 O 2 Is an important signal molecule of plants for coping with biotic stress, therefore, csGSTF1 regulates H 2 O 2 Levels affect citrus canker resistance.
In conclusion, the disease spot area of the citrus canker can be reduced to a great extent through silencing of CsGSTF1, and the incidence degree of the canker is reduced. The CsGSTF1 gene provided by the invention can be silenced by various technologies and used as anti-ulcer molecule breeding, and can also be cooperated with other disease-resistant or disease-susceptible genes to carry out citrus anti-ulcer molecule breeding, so that the CsGSTF1 gene has great application value in citrus anti-ulcer breeding.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are merely exemplary embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.
Claims (10)
1. A citrus CsGSTF1 gene is characterized in that the nucleotide sequence of the citrus CsGSTF1 gene is SEQ ID NO:1 or in SEQ ID NO:1 is substituted, deleted or added with one or more nucleotides and has a nucleotide sequence for coding proteins with the same activity.
2. An application of citrus CsGSTF1 gene in enhancing canker resistance of citrus.
3. Use of the citrus CsGSTF1 gene for enhancing resistance of citrus to canker diseases according to claim 2, wherein the method of use is to reduce the transcription level of the CsGSTF1 gene in citrus.
4. The use of the citrus CsGSTF1 gene for enhancing resistance of citrus to canker diseases according to claim 3, characterized in that the means for reducing the transcription level of the CsGSTF1 gene in citrus plants employs VIGS silencing.
5. The use of the citrus CsGSTF1 gene according to claim 2 for enhancing resistance of citrus to canker diseases, characterized in that the method of use comprises the steps of:
(1) Cloning VIGS fragment of citrus CsGSTF1 gene;
(2) Constructing an expression vector of VIGS;
(3) And transforming the citrus by the VIGS expression vector to obtain a VIGS plant with the silenced citrus CsGSTF1 gene.
6. The use of the citrus CsGSTF1 gene for enhancing citrus centering according to claim 5, wherein in the step (1), the VIGS fragment of the citrus CsGSTF1 gene is cloned by: extracting total citrus RNA, carrying out reverse transcription to obtain cDNA, carrying out high-fidelity enzyme PCR amplification by using the cDNA as a template to obtain a VIGS fragment of the citrus CsGSTF1 gene, wherein the nucleotide sequence is SEQ ID NO:2, respectively.
7. The use of the citrus CsGSTF1 gene in enhancing citrus pairing according to claim 6, wherein in step (1), the primers used for PCR amplification are CsGSTF1-VIGS-F and CsGSTF1-VIGS-R, the nucleotide sequences of which are SEQ ID NO:3 and SEQ ID NO:4.
8. the use of the citrus CsGSTF1 gene in enhancing citrus centering according to claim 5, wherein in the step (2), the VIGS gene fragment expression vector is constructed by the method comprising: and (2) carrying out enzyme digestion on the VIGS fragment of the PCR product orange CsGSTF1 gene obtained in the step (1) through Xba I and Sma I, recovering the enzyme-digested VIGS fragment, connecting the recovered enzyme-digested VIGS fragment with a TRV2 vector, transforming an escherichia coli competent cell, and extracting a plasmid to obtain the VIGS expression vector of the CsGSTF1 gene.
9. The use of the citrus CsGSTF1 gene in enhancing citrus centering according to claim 5, wherein in step (3), the method for transforming citrus with the VIGS expression vector comprises: and (3) transforming agrobacterium with the VIGS expression vector obtained in the step (2), preparing agrobacterium liquid containing the VIGS expression vector, infecting the aseptic citrus seedlings, and obtaining VIGS plants with silenced citrus CsGSTF1 genes after fluorescence observation, PCR and qRT-PCR verification.
10. The use of the citrus CsGSTF1 gene in enhancing citrus centering according to claim 5, wherein after the VIGS plant is obtained in step (3), the citrus canker resistance of the VIGS plant is evaluated, and the citrus CsGSTF1 gene silencing is judged to enhance the citrus canker resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211004475.9A CN115820685B (en) | 2022-08-22 | 2022-08-22 | Citrus CsGSTF1 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211004475.9A CN115820685B (en) | 2022-08-22 | 2022-08-22 | Citrus CsGSTF1 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115820685A true CN115820685A (en) | 2023-03-21 |
| CN115820685B CN115820685B (en) | 2023-09-12 |
Family
ID=85523165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211004475.9A Active CN115820685B (en) | 2022-08-22 | 2022-08-22 | Citrus CsGSTF1 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820685B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820686A (en) * | 2022-08-22 | 2023-03-21 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
| CN117363629A (en) * | 2023-10-10 | 2024-01-09 | 西部(重庆)科学城种质创制大科学中心 | Citrus CsGATA12 gene and method for enhancing citrus canker resistance by using same |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030046723A1 (en) * | 1999-03-23 | 2003-03-06 | Jacqueline Heard | Transgenic plants comprising polynucleotides encoding transcription factors that confer disease tolerance |
| US8592661B1 (en) * | 2012-10-16 | 2013-11-26 | Thomas Willard | Citrus cultivar CALLOR1 |
| CN110295185A (en) * | 2019-07-26 | 2019-10-01 | 西南大学 | A method of citrus is improved to canker resistance based on CsWAKL08 overexpression |
| CN114395570A (en) * | 2021-12-29 | 2022-04-26 | 西南大学 | Method for improving canker resistance of citrus by using CsNCED3 gene silencing |
-
2022
- 2022-08-22 CN CN202211004475.9A patent/CN115820685B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030046723A1 (en) * | 1999-03-23 | 2003-03-06 | Jacqueline Heard | Transgenic plants comprising polynucleotides encoding transcription factors that confer disease tolerance |
| US8592661B1 (en) * | 2012-10-16 | 2013-11-26 | Thomas Willard | Citrus cultivar CALLOR1 |
| CN110295185A (en) * | 2019-07-26 | 2019-10-01 | 西南大学 | A method of citrus is improved to canker resistance based on CsWAKL08 overexpression |
| CN114395570A (en) * | 2021-12-29 | 2022-04-26 | 西南大学 | Method for improving canker resistance of citrus by using CsNCED3 gene silencing |
Non-Patent Citations (3)
| Title |
|---|
| "PREDICTED_ Citrus clementina glutathione S-transferase (LOC18041909), mRNA", GENEBANK DATABASE, pages 024184604 * |
| EDUARDO HILARIO等: "Structural and biochemical characterization of a glutathione transferase from the citrus canker pathogen Xanthomonas", ACTA CRYSTALLOGR D STRUCT BIOL, vol. 76, no. 08 * |
| 姚利晓等: "柑橘溃疡病抗性相关转录因子CitMYB20的功能", 中国农业科学, no. 10 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820686A (en) * | 2022-08-22 | 2023-03-21 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
| CN115820686B (en) * | 2022-08-22 | 2023-09-12 | 西南大学 | Citrus CsGSTU18 gene and application thereof |
| CN117363629A (en) * | 2023-10-10 | 2024-01-09 | 西部(重庆)科学城种质创制大科学中心 | Citrus CsGATA12 gene and method for enhancing citrus canker resistance by using same |
| CN117363629B (en) * | 2023-10-10 | 2024-05-14 | 西部(重庆)科学城种质创制大科学中心 | Citrus CsGATA gene and method for enhancing citrus canker resistance by using same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115820685B (en) | 2023-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110283843B (en) | Method for improving citrus canker resistance based on CRISPRCAS9 mediated CsWRKY22 fixed-point editing | |
| CN115820685B (en) | Citrus CsGSTF1 gene and application thereof | |
| CN115058449A (en) | Method for improving citrus canker resistance by CsWRKY43 interference | |
| CN110066323B (en) | Microalgae light-harvesting protein NoHLR1 gene and application thereof | |
| CN111500579A (en) | Cotton miR164a and NAC 100L and application thereof in regulation and control of verticillium wilt resistance of plants | |
| CN104711268A (en) | Insect-resistant gene Zm-Cry1A(h), biological material related to gene and application of gene | |
| CN115820686B (en) | Citrus CsGSTU18 gene and application thereof | |
| CN116286724B (en) | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN105585623A (en) | Cultivating method for disease-resistant TaMYB-KW gene-transferred wheat, related biomaterials and application | |
| CN116083445A (en) | CrBZR1 gene and application thereof | |
| CN113481176B (en) | Application of GA3ox1 protein in regulating alfalfa plant type | |
| CN112662687B (en) | Method, kit and gene for delaying flowering phase of corn | |
| CN109929850A (en) | Anti- nematode Cotton Transformation event GHP10 | |
| CN117363628B (en) | Citrus CsMYB149 gene and method for enhancing citrus canker resistance by using same | |
| CN117363629B (en) | Citrus CsGATA gene and method for enhancing citrus canker resistance by using same | |
| CN104152454A (en) | Soybean derived drought induced type promoter GmMYB363P and application thereof | |
| CN103255164B (en) | Construct and use thereof | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN111961122B (en) | Dominant allele of cotton TBL34 gene and encoding protein and application thereof | |
| CN108148846A (en) | Rice blade profile mutator ZY103 and its application | |
| CN117886909A (en) | Transcription factor PpBZR1.1 affecting plant resistance to black spot disease, and coding gene and application thereof | |
| CN105384802B (en) | A kind of nucleotide sequence and its application from the controllable downstream gene translation efficiency of rubber tree | |
| CN107417776B (en) | Protein related to plant disease resistance and organ abscission as well as coding gene and application thereof | |
| CN105420250A (en) | Lychee cell wall acid invertase gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |