CN116286724B - Lectin receptor protein TaLecRLK2 and encoding gene and application thereof - Google Patents
Lectin receptor protein TaLecRLK2 and encoding gene and application thereof Download PDFInfo
- Publication number
- CN116286724B CN116286724B CN202310538546.1A CN202310538546A CN116286724B CN 116286724 B CN116286724 B CN 116286724B CN 202310538546 A CN202310538546 A CN 202310538546A CN 116286724 B CN116286724 B CN 116286724B
- Authority
- CN
- China
- Prior art keywords
- stripe rust
- talecrlk2
- wheat
- coding gene
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a coding gene of lectin receptor protein TaLecRLK2 and application thereof. The coding gene of the lectin-like receptor protein TaLecRLK2 provided by the invention is shown as SEQ ID NO: 2. The invention provides the sequence of SEQ ID NO:2, introducing the coding gene shown in the step 2 into hexaploid wheat to obtain transgenic wheat; the transgenic wheat exhibited significant resistance to stripe rust caused by the stripe rust race CYR 31. The coding gene of the lectin receptor protein TaLecRLK2 can be used for preparing a wheat strain with stripe rust resistance, and provides an excellent test material for cultivating stripe rust resistant wheat varieties.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to lectin receptor protein TaLecRLK2, and a coding gene and application thereof.
Background
Wheat is one of the cereal crops with the widest global planting area and the highest yield. Wheat stripe rust is one of the fungal diseases caused by the stripe rust wheat specialization (Puccinia striiformis f.sp tritici, pst) and occurring almost every major wheat area of the world, severely jeopardizing wheat yield. Frequent variation of stripe rust toxicity causes frequent outbreaks of wheat stripe rust and causes the resistance of the existing varieties to be overcome, so that reasonable utilization of disease resistance genes to create disease resistance materials is the most economical and effective sustainable development strategy for preventing and treating wheat stripe rust.
Lectin-like receptor kinases (LecRLKs) refer to those types of RLKs that, upon binding to oligosaccharides produced by pathogenic bacteria, activate intracellular kinase domains in the extracellular lectin region, thereby inducing and activating cellular defense mechanisms, which can be classified into three types, G, L and C, depending on the structural differences of the extracellular lectin region. Along with continuous intensive research, the LecRLKs family members can regulate the growth and development of plants, have important functions in the aspects of disease resistance and stress resistance of the plants and can participate in a plant hormone signal path.
Disclosure of Invention
The main purpose of the invention is to provide a coding gene of wheat lectin receptor kinase TaLecRLK2, which is helpful for improving the disease resistance of wheat and preventing and controlling wheat stripe rust caused by stripe rust bacteria.
The present invention provides a method for preparing a transgenic plant having increased resistance to stripe rust, comprising the steps of: setting SEQ ID NO:2, introducing the coding gene shown in the step 2 into a starting plant to obtain a transgenic plant; the transgenic plant exhibits significant resistance to stripe rust as compared to the starting plant;
the coding gene is introduced through a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into an expression vector pANIC 6E;
the plant is monocot common hexaploid wheat;
the stripe rust is stripe rust caused by the small species CYR31 of stripe rust.
The invention also claims a nucleotide sequence as set forth in SEQ ID NO:2 in improving the resistance of plants to stripe rust; the plant is monocot common hexaploid wheat; the stripe rust is stripe rust caused by the small species CYR31 of stripe rust.
The invention also claims a nucleotide sequence as set forth in SEQ ID NO:2 in the cultivation of wheat varieties resistant to stripe rust; the plant is monocot common hexaploid wheat; the stripe rust is stripe rust caused by the epidemic race CYR31 of stripe rust bacteria.
Compared with the prior art, the invention has the following beneficial effects or advantages:
the invention utilizes a reverse genetics method to analyze the TaLecRLK2 protein kinase gene, the TaLecRLK2 gene is induced by the non-affine race of the stripe rust, and the TaLecRLK2 gene is silenced by adopting a virus-mediated gene silencing technology, so that the TaLecRLK2 gene is determined to play a role in upregulation in wheat stripe rust resistance. Cloning TaLecRLK2 gene into expression vector, transforming young wheat embryo with agrobacterium mediated transgenic technology to obtain transgenic wheat plant with obvious resistance to wheat stripe rust. The invention proves that the TaLecRLK2 gene can be utilized to improve the disease resistance of wheat and other crops, thereby cultivating the disease resistant material for resisting wheat stripe rust.
Drawings
For purposes of illustration and not limitation, the invention will now be described in accordance with its preferred embodiments, particularly with reference to the accompanying drawings.
FIG. 1 is a schematic diagram showing the analysis of the expression profile of the transcription factor TaLecRLK2 gene provided by the embodiment of the invention.
FIG. 2 is a schematic diagram showing the results of the post-silencing inoculation phenotype of TaLecRLK2 gene provided by the embodiment of the invention (wherein BSMV is Barley Stripe Mosaic Virus barley streak mosaic virus; PDS is phytoene desaturase gene; gamma is empty vector control); CYR23 is a non-affinitive species of water source 11 and CYR31 is an affinitive species of water source 11.
FIG. 3 is a diagram of an over-expression vector for TaLecRLK2 obtained according to an embodiment of the present invention. ZmUbi is the maize ubiquitin promoter; taLecRLK2 is a CDS sequence of a TaLecRLK2 gene; GUSPlus encodes beta-glucosidase as a reporter gene for transgenic plants; T-NOS is a terminator sequence; bar is herbicide resistant gene as transgene plant screening gene.
Fig. 4 is a schematic diagram of a PCR detection result of a talicrlk 2 overexpressing plant provided by the embodiment of the present invention, where M is Marker, and L1, L2 and L3 are talicrlk 2 overexpressing plants, respectively.
FIG. 5 is a schematic diagram showing the results of inoculating a rust race phenotype into a TaLecRLK 2-transformed plant provided by the embodiment of the invention, wherein L1, L2 and L3 are TaLecRLK 1-transformed plants; WT is wild type plant (wild type).
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
The invention provides an application of a wheat lectin receptor kinase TaLecRLK2 gene in improving wheat stripe rust caused by wheat stripe rust, and is also suitable for improving disease resistance of other crops.
The application method of the wheat lectin receptor kinase TaLecRLK2 gene in cultivating and improving wheat rust resistant varieties comprises the following steps: transforming the wheat lectin receptor kinase TaLecRLK2 gene into wheat cells by using a plant genetic engineering technology to obtain a wheat variety expressing the TaLecRLK2 protein kinase.
The application of the wheat lectin receptor kinase TaLecRLK2 gene in cultivating and improving wheat rust resistant varieties provided by the invention further comprises the following steps: constructing a plant expression vector containing a wheat lectin-like receptor kinase TaLecRLK2 gene; transforming wheat young embryo by using agrobacterium-mediated genetic transformation method to obtain TaLecRLK2 transgenic wheat.
The verification method for the application of the wheat lectin receptor kinase TaLecRLK2 gene in cultivating and improving wheat rust resistant varieties comprises the following steps:
s101, obtaining TaLecRLK2 transgenic wheat, and carrying out molecular detection on the obtained TaLecRLK2 transgenic wheat;
s102, inoculating the T1 generation transgenic plant with a rust fungus race CYR31, and identifying the resistance of the transgenic plant to the rust fungus race.
The function identification method provided by the invention comprises the following steps:
based on qRT-PCR, taking an elongation factor gene TaEF1 alpha as an internal reference, and carrying out real-time fluorescence quantitative PCR by utilizing a specific primer of a protein kinase gene TaLecRLK2, so as to determine the expression quantity of the TaLecRLK2 gene at different infection times of wheat infected by the rust;
the transient silencing protein kinase gene TaLecRLK2 with specificity of virus-induced gene silencing technology is utilized, whether the wheat leaves are bleached after silencing TaPDS is observed on the tenth day after the wheat two-leaf inoculation of virus, and if symptoms exist, the virus inoculation is successful; the phenotype was observed 14 days after inoculation of the fresh spores of wheat stripe rust CYR31 on trefoil, and disease resistance was identified.
Example 1
This example is intended to obtain the nucleotide sequence of the TaLecRLK2 gene. The nucleotide sequence of the TaLecRLK2 gene was analyzed by bioinformatics at Ensemblplants (http:// plants. Ensembl. Org/Triticum_aestivum/Info/Indexdb=core). The nucleotide sequence of the TaLecRLK2 gene is determined by designing the full-length primer of the TaLecRLK2 gene, amplifying the TaLecRLK2 gene by using a field template and sequencing.
The TaLecRLK2 gene comprises 2055bp nucleotide, as shown in SEQ ID NO: 2.
Example 2
The present example developed functional verification of the TaLecRLK2 gene. Based on qRT-PCR, taking an elongation factor gene TaEF1 alpha as an internal reference (forward primer TaEF1 alpha-F: TGGTGTCATCAAGCCTGGTATGGT and reverse primer TaEF1 alpha-R: ACTCATGGTGCATCTCAACGGACT), carrying out real-time fluorescence quantitative PCR by utilizing a specific primer of a protein kinase gene TaLecRLK2 (forward primer TaLecRLK2-qRT-F: CGGCACTTGTAGGGAACTATT and reverse primer TaLecRLK2-qRT-R: GATGAGGCCATGGAAGAGAAG), determining the expression level of the TaLecRLK2 gene at different infection times of wheat by the rust bacteria, and taking 0hpi as a control in a non-affinitive interaction system (inoculated with CYR 23), wherein the expression level of the 24hpi wheat TaLecRLK-2D gene is obviously up-regulated, about 2.8 times of the control, and the other time points are up-regulated to a certain extent; expression of the 12hpi and 36hpi wheat TaLecRLK-2D genes was significantly down-regulated in the affinity interaction system (inoculated with CYR 31) at levels of about 0.5-fold and 0.4-fold, respectively, of the control group (FIG. 1).
The transient silencing protein kinase gene TaLecRLK2 specific to the virus-induced gene silencing technology is utilized. The specific fragment of TaLecRLK2 gene with the length of about 150-300bp is selected, the sequence is used for designing a VIGS primer (forward primer Vigs-F: TAGCTAGCTGATTAATTAATTTGCCTTCGGCACGTTCCT, reverse primer Vigs-R: TTGCTAGCTGAGCGGCCGCATGCGTTGAAGCCAACTCCG), and the selected specific fragment is connected to a gamma-PDS carrier by using the One step clone method. Since the BSMV virus is assembled by three elements of alpha, beta and gamma, the successful construction of the recombinant plasmid BSMV: taLecRLK2, BMSV: alpha, beta, gamma and BSMV: gamma-PDS is required to be subjected to linearization. The successfully linearized vector was then transcribed in vitro using the in vitro transcription kit (promega, P1320).
And selecting 11 wheat which has good growth vigor and grows to a water source of two leaves and one core, and carrying out virus inoculation experiments. The gamma vector (BSMV: taLecRLK 2), BSMV: alpha and BSMV: beta in vitro transcription products of the recombinant gene are extracted, 15 mu L each, are added into 270 mu L FES buffer, and are fully blown and mixed uniformly. Specific methods of inoculating viruses are described in Holzberg et al (2002) (Holzberg S, brosio P, gross C, pogue GP (2002) Barley stripe mosaic virus-induced gene silencing in a monocot plant J30:315-327). On the tenth day after inoculation of the wheat two-leaf virus, observing whether the wheat leaf is bleached after silencing TaLecRLK2, and if so, indicating that the virus inoculation is successful; the phenotype was observed 14 days after inoculation of the fresh spores of wheat stripe rust CYR31 on trefoil, and disease resistance was identified.
Specific fragments of TaLecRLK2 were silenced using virus-induced transient silencing techniques. The virus was tribological inoculated at wheat growth 16 d. After inoculation, the cells were placed in a photoperiod growth incubator at 24℃for 16h with light at 24℃and 8h in the dark for 100% moisture retention. After 7d inoculation, obvious streak-like chlorosis on the virus-receiving leaves can be observed, and the success of virus inoculation is proved. Inoculating a non-toxic race CYR23 of the rust bacteria, placing the inoculated rust bacteria into a 16 ℃ dark moisturizing 24h in a moisturizing box, and then transferring the inoculated rust bacteria into a photoperiod growth incubator with 16 ℃ illumination 16h and 14 ℃ darkness 8 h. The plants to be inoculated 14d were observed to have a small number of spore stacks produced on the leaves of the silenced TaLecRLK2 gene and the plants silenced with the TaLecRLK2 gene were significantly attenuated for rust (FIG. 2). The TaLecRLK2 gene is involved in wheat resistance to Rhizoctonia cerealis.
The embodiment uses a real-time fluorescence quantitative PCR technology to find that the TaLecRLK2 gene is induced by wheat stripe rust non-compatible race CYR23, and adopts a virus-mediated gene silencing technology to silence the TaLecRLK2 gene, so that the gene is determined to play a role in regulating and controlling the wheat stripe rust resistance, and a new gene resource is provided for wheat stripe rust resistance breeding.
Example 3
This example demonstrates the increased resistance of TaLecRLK2 transgenic wheat to Leptoradix. Transgenic plants obtained by agrobacterium-mediated genetic transformation. The full length of the TaLecRLK2 gene is constructed by using a Gateway technology in homologous recombination, and the recombination vector is obtained by inserting the TaLecRLK2 gene into a vector pANIC 6E. The successfully constructed vector plasmid (figure 3) is subjected to agrobacterium tumefaciens competent EHA105, colony PCR detection is performed, and a positive monoclonal strain is obtained. And then the wheat young embryo is sent to a national key laboratory of crop stress biology in arid region of northwest agriculture and forestry science and technology university for infection. The transgenic plants were cultured, DNA was extracted and PCR was performed, three lines L1, L2 and L3 of the T1 generation were selected and inoculated with the minispecies CYR31, and as a result, it was found that wheat lectin receptor kinase TaLecRLK2 overexpressing plants (FIG. 4) exhibited significant resistance to Rhizoctonia cerealis (FIG. 5). In FIG. 5, L1, L2 and L3 are positive plants, and WT is a wild type plant (wild type).
The over-expression vector of this example constructs the primer: taLecRLK2-HIS-F (forward primer): GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCACCACCACCACCACCACA TGGCCGGCATTTCAAGCGCC; taLecRLK2-HIS-R (reverse primer): GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATCTTCCTCCGGATAGATC A.
This example demonstrates that TaLecRLK2 protein kinase plays a positive regulatory role in wheat anti-rust process. The TaLecRLK2 transgenic plant can be used for creating a rust-resistant strain by using the protein kinase, and provides an excellent test material for cultivating rust-resistant varieties.
The above embodiments do not limit the scope of the present invention. It will be apparent to those skilled in the art that various modifications, combinations, sub-combinations and alternatives can occur depending upon design requirements and other factors. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of the present invention.
Claims (3)
1. A method of making a transgenic plant having increased resistance to stripe rust comprising the steps of: setting SEQ ID NO: 2. the coding gene is introduced into a starting plant to obtain a transgenic plant; the transgenic plant exhibits significant resistance to stripe rust as compared to the starting plant;
the coding gene is introduced through a recombinant expression vector, and the recombinant expression vector is obtained by inserting the coding gene into an expression vector pANIC 6E;
the plant is monocot common hexaploid wheat;
the stripe rust is stripe rust caused by the small species CYR31 of stripe rust.
2. The nucleotide sequence is shown in SEQ ID NO: 2. the use of the coding gene shown in increasing the resistance of plants to stripe rust, characterized in that the coding gene of SEQ ID NO: 2. the coding gene is introduced into a plant body, and the coding gene is overexpressed;
the plant is monocot common hexaploid wheat;
the stripe rust is stripe rust caused by the small species CYR31 of stripe rust.
3. The nucleotide sequence is shown in SEQ ID NO: 2. the application of the coding gene in breeding stripe rust resistant wheat varieties is characterized in that the coding gene shown in SEQ ID NO: 2. the coding gene is introduced into a plant body, and the coding gene is overexpressed;
the plant is monocot common hexaploid wheat;
the stripe rust is stripe rust caused by the epidemic race CYR31 of stripe rust bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310538546.1A CN116286724B (en) | 2023-05-15 | 2023-05-15 | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310538546.1A CN116286724B (en) | 2023-05-15 | 2023-05-15 | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116286724A CN116286724A (en) | 2023-06-23 |
| CN116286724B true CN116286724B (en) | 2023-08-25 |
Family
ID=86817077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310538546.1A Active CN116286724B (en) | 2023-05-15 | 2023-05-15 | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116286724B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117467680A (en) * | 2023-11-28 | 2024-01-30 | 重庆文理学院 | Application of tomato lectin receptor-like protein kinase gene lecRLK45 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106854239A (en) * | 2015-12-09 | 2017-06-16 | 中国科学院遗传与发育生物学研究所 | Wheat stripe rust resistance GAP-associated protein GAP TaSPX-MFS and its encoding gene and application |
| CN114621967A (en) * | 2022-05-16 | 2022-06-14 | 西北农林科技大学深圳研究院 | Wheat receptor protein kinase gene TaLEMK1.1 and application thereof |
| CN115786372A (en) * | 2022-12-20 | 2023-03-14 | 西南大学 | Corn Zmlech-G2 gene and application thereof |
-
2023
- 2023-05-15 CN CN202310538546.1A patent/CN116286724B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106854239A (en) * | 2015-12-09 | 2017-06-16 | 中国科学院遗传与发育生物学研究所 | Wheat stripe rust resistance GAP-associated protein GAP TaSPX-MFS and its encoding gene and application |
| CN114621967A (en) * | 2022-05-16 | 2022-06-14 | 西北农林科技大学深圳研究院 | Wheat receptor protein kinase gene TaLEMK1.1 and application thereof |
| CN115786372A (en) * | 2022-12-20 | 2023-03-14 | 西南大学 | Corn Zmlech-G2 gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 小麦凝集素类受体激酶ＴａＬｅｃＲＬＫ１ 的鉴定及抗锈病功能分析;王建锋等;植物病理学报;第53卷(第01期);第61-71页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116286724A (en) | 2023-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2017203180B2 (en) | Constructs for expressing transgenes using regulatory elements from Brachypodium ubiquitin genes | |
| KR101372114B1 (en) | Rice zinc finger protein transcription factor DST and use thereof for regulating drought and salt tolerance | |
| CN111978387B (en) | Rice blast resistance gene Pikg, encoding protein and application thereof | |
| CN111073873B (en) | Application of PP84 protein and coding gene thereof in regulation and control of plant drought resistance | |
| US20120198587A1 (en) | Soybean transcription factors and other genes and methods of their use | |
| CN111235165B (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| EP3385385A1 (en) | Use of tobacco gene nttctp in plants against potato virus y | |
| Liu et al. | Analyses of MiRNA functions in maize using a newly developed ZMBJ-CMV-2bN81-STTM vector | |
| CN116286724B (en) | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof | |
| CN101555276A (en) | Cadmium-resistant vegetable protein, coding gene and application thereof | |
| Zhou et al. | A novel R2R3-MYB transcription factor BpMYB106 of birch (Betula platyphylla) confers increased photosynthesis and growth rate through up-regulating photosynthetic gene expression | |
| Azizi et al. | Over-expression of the Pikh gene with a CaMV 35S promoter leads to improved blast disease (Magnaporthe oryzae) tolerance in rice | |
| Batyrshina et al. | The transcription factor TaMYB31 regulates the benzoxazinoid biosynthetic pathway in wheat | |
| CN115820685A (en) | Citrus CsGSTF1 gene and application thereof | |
| CN106282201A (en) | Maize Transcription Factor ZmbHLH2 and application thereof | |
| CN103275983A (en) | Gene promoter for stress induction expression and application of gene promoter | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| Alam et al. | Overexpression of OsHAP2E for a CCAAT-binding factor confers resistance to Cucumber mosaic virus and Rice necrosis mosaic virus | |
| CN111087457B (en) | Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof | |
| CN103290014A (en) | Adversity inducible expression gene promoter and application thereof | |
| CN108384800B (en) | Turn the cultivation, identification and application of CmWRKY15-1 gene Cut Flower Chrysanthemum Morifolium | |
| CN110643627A (en) | CIPK3 protein and application of coding gene thereof in drought resistance of plants | |
| CN104610438A (en) | Cotton stress response associated protein GhGeBP and coding gene and application thereof | |
| Zhou et al. | The transmembrane protein LbRSG from the recretohalophyte Limonium bicolor enhances salt gland development and salt tolerance | |
| CN105461790B (en) | The application of MYB99 albumen and its encoding gene in regulating and controlling plant seed germination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |