WO2023040623A1 - Method for and application of site-directed mutation of brassica napus bnhbbd gene - Google Patents

Abstract

Provided are a method for and an application of site-directed mutation of a Brassica napus BnHBBD gene, belonging to the technical field of plant gene editing and plant breeding. Screening targets Target1 and Target2 for the Brassica napus BnHBBD gene are designed, an sgRNA sequence is also designed, and the two targets, Target1 and Target2, are then linked to two identical sgRNA sequences to construct a dual-target gene editing vector pKSE401-BnHBBD-CRISPR to transform Brassica napus, so as to realize site-directed mutation of the Brassica napus BnHBBD gene and obtain a transgenic plant that has a long flowering period, is resistant to sclerotinia, and has hard-to-crack siliques; the gene editing technology is successfully used to edit Brassica napus, which greatly shortens the acquisition period of new germplasm and provides new ideas for rapeseed breeding.

Description

A method and application of site-directed mutation of Brassica napus BnHBBD gene technical field

The invention belongs to the technical field of plant gene editing and plant breeding, and in particular relates to a method and application of site-directed mutation of BnHBBD gene of Brassica napus.

Background technique

Rapeseed (Brassica napus L.) is one of the most widely planted oil crops in my country. It can not only be used to produce edible oil, but also can be used for ornamental purposes. It is one of the important economic crops in my country. Biological breeding and seed engineering are developing rapidly. At present, my country's breeding methods and technologies pay more attention to biological breeding, and will soon set up key special projects for the excavation and innovative utilization of agricultural biological germplasm resources to enhance innovation capabilities and improve the level of independent research and development.

In modern society, with the improvement of people's living standards, rapeseed has bright colors, many colors, wide distribution, simple management, and low investment. It has naturally become a farmland landscape crop with great ornamental value. Rapeseed tourism has gradually It's getting hotter. The most famous Duotian Rapeseed Blossom Scenic Spot in Xinghua, Jiangsu Province and the Rapeseed Blossom Sea Scenic Spot in Menyuan, Qinghai Province have nearly one million ticket sales per day, and billions of comprehensive tourism revenue (data sourced from People’s Government of Jiangsu Province, Menyuan County People's Government).

Gene editing is an emerging and precise genetic engineering technology that can modify specific genes in the genome of organisms. In recent years, some studies have used gene editing technology to knock out the LNK2 gene in soybeans to affect the flowering time of soybeans, and some studies have used the CRISPR/Cas9 system to obtain rice mutants, and found that there is a relationship between the expression of pyruvatease and cell cycle proteins. The study also found that knocking out multiple lysophosphatidic acid acyltransferase (Lysophosphatidic acid acyltransferase) genes in rapeseed by multiple gRNA and single gRNA can cause changes in fatty acid content. At present, the site-directed mutation technology of CRISPR/Cas9 system has gradually matured, which can greatly shorten the acquisition cycle of new germplasm.

At present, when rapeseed grows and blooms in a natural environment, various parts of rapeseed may be spread by Sclerotinia ascospores. Among the various parts of rapeseed, the fallen petals have the highest rate of carrying bacteria, and the hyphae will fall to the stems and leaves as the petals fall off, reinfecting rapeseed, and causing a large area of sclerotinia. In addition, rape also has problems such as easy cracking of siliques, large loss of rapeseed caused by mechanized harvesting, low harvesting efficiency, and short flowering period suitable for viewing.

Contents of the invention

Aiming at the deficiencies in the prior art, the invention provides a method and application of site-directed mutation of BnHBBD gene of Brassica napus. In the present invention, the BnHBBD gene of Brassica napus is bred by site-directed mutation using CIRSPR/Cas9 system, and a transgenic plant with long flowering period, anti-sclerotinia and hard-to-crack silique is obtained. Among them, in the name of the gene BnHBBD, Bn represents the English abbreviation of rapeseed, and H, B, B, and D are the Chinese pinyin initials of Hua (Hua), Petal (Ban), Bu (Bu), and Drop (Diao), respectively.

In the present invention, a CRISPR/Cas9 system sequence element set for site-directed mutation of Brassica napus BnHBBD gene is firstly provided, wherein the sequence element set includes U6-26p-Target1-gRNA, U6-26p-Target2 -gRNA and Cas9 gene optimized according to codons;

The U6-26p-Target1-gRNA includes a promoter U6-26p, a gRNA backbone structure and Target1; the U6-26p-Target2-gRNA includes a promoter U6-26p, a gRNA backbone structure, and Target2;

Wherein, the Brassica napus BnHBBD gene includes BnHBBD-C06 and BnHBBD-A07, the Target1 is the target sequence of the gene BnHBBD-C06, and the -Target2 is the target sequence of the gene BnHBBD-A07.

Wherein, the nucleotide sequence of the Target1 is: 5'-TACGATGGTTCTGCTCTGTC-3' (SEQ.ID.NO.1);

The nucleotide sequence of Target2 is: 5'-TGCAAGAATTGGAGCCACCG-3' (SEQ.ID.NO.2);

The nucleotide sequence of sgRNA is:

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ. ID. NO. 3).

Further, the nucleotide sequence of the BnHBBD-C06 is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ.ID.NO.6;

The nucleotide sequence of BnHBBD-A07 is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7.

The present invention also provides a gene editing vector pKSE401-BnHBBD-CRISPR, said gene editing vector comprises the above-mentioned CRISPR/Cas9 system sequence element set for site-directed mutation of Brassica napus BnHBBD gene.

The present invention also provides a genetically engineered bacterium for site-directed mutation of the Brassica napus BnHBBD gene, the genetically engineered bacterium is obtained by transforming the host bacterium with the above-mentioned gene editing vector pKSE401-BnHBBD-CRISPR.

The present invention also provides a kit for site-directed mutation of Brassica napus BnHBBD gene, said kit being the above-mentioned gene editing vector or genetic engineering bacteria.

The present invention also provides the application of the above-mentioned sequence element group, gene editing vector pKSE401-BnHBBD-CRISPR, genetically engineered bacteria or kits, and the application includes:

A) Application in Brassica napus gene BnHBBD-C06 and/or gene BnHBBD-A07 site-directed mutation, the nucleotide sequence of the BnHBBD-C06 gene is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ. As shown in ID.NO.6, the nucleotide sequence of the BnHBBD-A07 gene is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7;

B) use in the breeding of Brassica napus with a long flowering period; and/or

C) application in the breeding of Brassica napus with anti-sclerotinia; and/or

D) Application in the breeding of Brassica napus with siliques that are not easy to crack.

The present invention also provides a method for site-directed mutation of Brassica napus BnHBBD gene using CIRSPR/Cas9 system, comprising:

(1) Design screening targets Target1 and Target2 for the BnHBBD gene in Brassica napus, and design sgRNA sequences, connect the two targets Target1 and Target2 to the sgRNA sequences respectively, and construct the dual-target gene editing vector pKSE401-BnHBBD- CRISPR;

(2) Transforming the gene editing vector pKSE401-BnHBBD-CRISPR into Agrobacterium GV3101 to obtain the Agrobacterium containing the gene editing expression vector pKSE401-BnHBBD-CRISPR;

(3) expanding the culture, using the obtained Agrobacterium bacterium liquid to mediate the transformation of rape hypocotyl;

(4) Rapeseed hypocotyl culture, callus induction, redifferentiation, rooting culture, seedling hardening, transplanting, to obtain transgenic rapeseed;

(5) Identify the transgenic plants with mutations in the BnHBBD gene.

Wherein, the Brassica napus BnHBBD gene includes BnHBBD-C06 and BnHBBD-A07, the Target1 is the target sequence of the gene BnHBBD-C06, and the -Target2 is the target sequence of the gene BnHBBD-A07,

The nucleotide sequence of the Target1 is shown in SEQ.ID.NO.1,

The nucleotide sequence of the Target2 is shown in SEQ.ID.NO.2,

The nucleotide sequence of the sgRNA is shown in SEQ.ID.NO.3,

The nucleotide sequence of the BnHBBD-C06 is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ.ID.NO.6,

The nucleotide sequence of the BnHBBD-A07 is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7.

Wherein, the mutation of BnHBBD gene includes the insertion of T base.

The present invention also provides the application of the mutated BnHBBD gene obtained by the above method in regulating the abscission of Brassica napus flower organs.

Specifically, the application includes inhibiting the normal synthesis of HBBD protein in Brassica napus, breeding of Brassica napus with long flowering period, breeding of Brassica napus with anti-sclerotinia, and breeding of Rapeseed napus that is not easy to crack.

Compared with prior art, the beneficial effect of the present invention is:

Inflorescence abscission loss (INFLORESCENCE DEFICIENT IN ABSCISSION, IDA) can combine with the co-receptor HAE and HSL2 proteins on the membrane, through phosphorylation and signal cascade amplification reaction, and transmit the abscission signal to the intracellular downstream regulatory factors, making abscission The cells in the ABSCISSION ZONE (AZ) expanded, which eventually led to the detachment of the floral organ, while the cells in the detachment zone of the mutant no longer expanded, and the petals no longer fell off, which affected the absorptive layer between the silique peel and the pseudodiaphragm, and then made the horn The fruit is not easy to crack, and the rapeseed grains are not easy to fall off, which reduces the loss during the mechanized receiving process and improves the production efficiency of rapeseed. In the present invention, among the five homologous genes of rapeseed, two effective genes BnaA07g27400D and BnaC06g29530D, which have the highest expression level and are most similar to Arabidopsis for controlling flower organ shedding in Brassica napus, are determined, named BnHBBD- In A07 and BnHBBD-C06, CIRSPR/Cas9 system was used to perform site-directed mutation on the above genes, and rapeseed germplasm with non-shedding petals was obtained. Because only on the petals, the ascospores of Sclerotinia sclerotiorum can germinate to form hyphae, but they cannot germinate and form mycelia when they fall directly on the rape leaves. Therefore, the non-shedding of petals prevents the sclerotinia from further infiltrating the lower leaves, and can achieve antibacterial effect. disease purpose.

The invention successfully utilizes gene editing technology to edit in Brassica napus, greatly shortens the acquisition cycle of new germplasm, and provides new ideas for rape breeding. The transformed strain obtained after the gene editing vector pKSE401-BnHBBD-CRISPR constructed by the present invention transforms rape, provides experimental materials for studying the function and mechanism of action of the gene BnHBBD, and can also be used as a new long-flowering, anti-sclerotinia and non-shattering Germplasm resources provide new gene sources for rapeseed breeding and help promote the progress of agricultural science.

Description of drawings

Figure 1 is a comparison diagram of the nucleotide and amino acid sequences of BnHBBD-A07 and BnHBBD-C06.

Figure 2 is a schematic diagram of the positions of the selected Target1 and Target2 targets on the gene (a) and a schematic diagram of the LB and RB ranges in the pKSE401-BnHBBD-CRISPR plasmid (b), in the figure, LB: left boundary; RB: right Border; Kan: kanamycin resistance gene; P-CaMV35S: CaMV35 promoter; U6-26p-Target1-gRNA: gRNA expression element set, including promoter U6-26p, gRNA backbone structure and target 1 (Target1) ; U6-26p-Target2-gRNA: gRNA expression element set, including promoter U6-26p, gRNA backbone structure and target 2 (Target2); Cas9: Cas9 gene optimized according to codons.

Figure 3 is the gel map of PCR identification of leaf genome extracted from two positive plants obtained through transformation; in the figure, WT: wild type; hbbd-1, hbbd-2: mutant transgenic plants; +: positive control, pKSE401-BnHBBD- CRISPR plasmid; -: Negative control, ddH ₂ O; Marker: Takara DL2000 DNA Marker.

Fig. 4 is a schematic diagram showing the analysis of the sequencing results of the BnHBBD-A07 gene (a) and the BnHBBD-C06 gene (b) in the hbbd mutant compared with the wild type.

Figure 5 is a schematic diagram of the frameshift mutation caused by the T insertion at the target point 1 of the hbbd mutant; (a) in the figure is the change of the BnHBBD-A07 gene in the mutant compared with the wild type; (b) is the change compared with the wild type Compared with the changes in the BnHBBD-C06 gene in the mutant.

Figure 6 is a comparison of the flowering period of the wild type (a) and the hbbd mutant's flower organ non-shedding phenotype (b).

Fig. 7 is a comparison chart of the silique maturity period of the flower organ non-shedding phenotype (hbbd) and the wild type (WT) of three different lines of the hbbd mutant.

Figure 8 is a comparison of the inflorescence stages of the mutant (hbbd) and the wild type (WT). The numbers in the figure represent the position numbers of the rapeseed inflorescences. The first flower of the bud is numbered 1, and the second flower is numbered 2. analogy.

Fig. 9 is a schematic diagram showing the comparison of pathogenesis pathways of S. sclerotiorum infecting hbbd mutant and wild type under natural conditions.

Figure 10 is a schematic diagram of the comparison of Sclerotinia infecting hbbd mutants and wild-type WT in the incubator environment; where the small arrows in (a) and (c) in the figure are the inoculation positions of Sclerotinia, (b) Long arrows represent wild-type petals falling off on leaves, (d) long arrows and crosses represent mutant petals not falling off on leaves, 0dpi and 4dpi represent 0 days and 4 days of inoculation with Sclerotinia sclerotiorum.

Figure 11 is a statistical chart of the number of cases after inoculation with Sclerotinia sclerotiorum. After the t test, P<0.001, the difference is significant, and it is represented by three *.

Fig. 12 is a graph of measuring cracking force of siliques between mutant (hbbd) and wild type (WT). After t test, P<0.05, the difference is significant, indicated by a *.

Detailed ways

The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

In the following examples, various processes and methods not described in detail are conventional methods well known in the art. The source and trade name of the reagents used, as well as those whose components must be listed, are indicated when they appear for the first time. There is no special description for the same reagents used thereafter, and the content indicated for the first time is the same; what is involved is reagents, materials, etc. Unless otherwise specified, all are commercially obtained.

The culture medium and its formula adopted in the present invention are as follows:

LB liquid culture medium: Weigh 10g of tryptone, 5g of yeast extract, and 10g of sodium chloride, dissolve them in 80mL of double-distilled water, set the volume to 1L, then divide them into 10 Erlenmeyer flasks, seal them with sealing film, and extinguish under high temperature and high pressure at 121°C. Bacteria for 15 minutes, cooled and stored in a 4°C refrigerator.

LB solid medium: Weigh 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, and 15g of agar powder, dissolve them in 800mL of double-distilled water, then set the volume to 1L, and then divide into 10 Erlenmeyer flasks and seal them with parafilm. Sterilize under high temperature and high pressure at 121°C for 15 minutes, and store in a refrigerator at 4°C after cooling. When in use, put it in a microwave oven and heat it until it melts. After the liquid cools down to about 50°C, add antibiotics, shake it up and immediately pour it into a sterile plate, about 10mL per plate.

M0 medium: MS powder 4.4g/L, sucrose 30g/L, double-distilled water to volume, adjust the pH value to 5.84-5.88, coagulant Agar 10g/L, and pack after sterilization.

DM medium: MS powder 4.4g/L, sucrose 30g/L, constant volume with double distilled water, adjust the pH value to 5.84-5.88, sterilize, add AS after cooling the medium, add 1mL AS to 1L (mother solution 100μmol/ mL), put it in the refrigerator at 4°C for use, or add AS when in use.

M1 medium: MS powder 4.4g/L, sucrose 30g/L, mannitol 18g/L, 2,4-D 1mg/L, KT 0.3mg/L, distilled water to volume, adjust pH value to 5.84-5.88 , coagulant Agar 10g/L, add AS after cooling the medium after sterilization, add 1mL AS (mother solution 100μmol/mL) to 1L, put it in a 4°C refrigerator for later use, or add AS when in use.

M2 medium: MS powder 4.4g/L, sucrose 30g/L, mannitol 18g/L, 2,4-D 1mg/L, KT 0.3mg/L, distilled water to volume, adjust pH value to 5.84-5.88 , coagulant Agar 10g/L, after the medium is cooled after sterilization, add: Timentin TMT 300mg/L, STS 150μmol/L (note that it is prepared and used now, precipitation will appear after a long time), kanamycin 25mg /L, and then dispensed into sterile plates.

M3 medium: MS powder 4.4g/L, glucose 10g/L, xylose 0.25g/L, MES 0.6g/L, distilled water to volume, adjust the pH value to 5.84-5.88, coagulant Agar 10g/L, After the medium cools down after sterilization, add: ZT 2mg/L, IAA 0.1mg/L, Timentin TMT 300mg/L, AgNO ₃ 150μmol/L, Kanamycin 25mg/L, and then divide into sterile plates middle.

M4 medium: MS powder 4.4g/L, sucrose 10g/L, distilled water to volume, adjust the pH value to 5.84-5.88, coagulant Agar 8g/L, add Timentin after the medium cools down after sterilization TMT 300mg/L, then dispense.

PDA solid medium: Weigh 7.4g of potato dextrose agar medium powder purchased from Sinopharm Group, add it to 200mL of distilled water, sterilize at 121°C for 15 minutes, store it in a refrigerator at 4°C after cooling, and heat it in a microwave oven when in use When the liquid is cooled to about 50°C, add antibiotics, shake well and immediately pour into sterile plates, about 20mL per plate.

Embodiment 1: Identification and acquisition of BnHBBD gene

In Brassica napus, HBBD has 5 members. The present invention utilizes transcriptome data and bioinformatics analysis for these 5 member genes, and obtains 2 genes with the highest expression and highest homology through phylogenetic tree and homology comparison HBBD genes——BnaA07g27400D and BnaC06g29530D (https://www.genoscope.cns.fr/brassicanapus/), (hereinafter briefly referred to as BnHBBD-A07 and BnHBBD-C06), due to the high similarity of these two genes, only There are several base differences, which are difficult to be distinguished by common PCR methods. In this embodiment, BnHBBD-A07 and BnHBBD-C06 are distinguished by sequencing methods.

Primers were designed according to the coding sequence (CDS sequence, gene numbers BnaA07g27400D and BnaC06g29530D) of the BnHBBD gene on the rape website (https://www.genoscope.cns.fr/brassicanapus/), and the primer sequences were:

HBBD-F (SEQ.ID.NO.13):ATGGCTCCGTGTCGTACG

HBBD-R (SEQ.ID.NO.14): TCAATGAGGATGAGAGTC;

Then, using the leaf DNA of rapeseed variety Y127 (from Huazhong Agricultural University) as a template, the CDS sequence of the BnHBBD gene was amplified using high-fidelity enzyme 2*Phanta MAX Master Mix (purchased from Nanjing Nuvizym Biotechnology Co., Ltd.), and PCR The reactions are shown in Table 1.

Table 1. High fidelity enzyme PCR amplification reaction system

PCR reaction system	volume
ddH 2 O	20 μL
2*Phanta Max Master Mix	25 μL
Upstream primer (10μM)	2μL
Downstream primer (10μM)	2μL

Template DNA (50-400ng)

1μL

The PCR reaction program was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, and a total of 35 cycles; final extension at 72°C for 5 min. After the PCR reaction, the PCR product was subjected to gel electrophoresis in 2% agarose gel (mass volume fraction) at 120V for 30 min, and then photographed under an ultraviolet gel imager, and the results were recorded. The results showed that the size of the target fragments amplified by the primers, namely the BnHBBD-A07 and BnHBBD-C06 gene fragments, was about 231bp.

Referring to the operating instructions in the UNIQ-10 Column DNA Gel Recovery Kit (purchased from Sangon Bioengineering (Shanghai) Co., Ltd.), the PCR amplification product BnHBBD gene was recovered from the agarose gel, and then the recovered PCR amplification product was The BnHBBD gene was connected to the pMD19-T vector (purchased from Treasure Bioengineering (Dalian) Co., Ltd.), and the connection system was: 4.5 μL gel recovery product, 0.5 μL pMD-19T vector, 5 μL Solution Ⅰ (purchased from Treasure Bioengineering (Dalian) Co., Ltd. Co., Ltd.) at 16°C overnight to obtain the ligation product.

Add 10 μL of the ligation product to 30 μL Escherichia coli competent cells (purchased from Nanjing Novozyme Biotechnology Co., Ltd.), transfer the ligation product into E. coli by heat shock method, and then use Amp's LB medium screened positive colonies, picked 10 single colonies and cultured them with shaking for 12-16 hours, took 2 μL of bacterial liquid as a template for PCR amplification for identification, and the primers for the PCR reaction were:

M13-F (SEQ.ID.NO.15): TGTAAAACGACGGCCAGT

M13-R (SEQ. ID. NO. 16): CAGGAAACAGCTATGACC.

The PCR amplification reaction system is shown in Table 2. The PCR reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1 min, for a total of 28 cycles; final extension at 72°C for 10 min.

Table 2. Bacteria Liquid PCR Amplification Reaction System

PCR reaction system	volume
ddH 2 O	6μL
rTaq	10 μL
Upstream primer (10μM)	1μL
Downstream primer (10μM)	1μL
Bacteria	2μL

The result of PCR amplification was detected on 2% agarose gel, and the DNA fragment obtained by detection was found to be about 400bp, indicating that the transformation was successful. Select 10 parts of successfully transformed bacterial solutions to draw 100 μL each and send them to Sangon Bioengineering ( Shanghai) Co., Ltd. sequencing. The sequence of BnHBBD-A07 and BnHBBD-C06 can be obtained by analyzing the sequencing results, the nucleotide sequences of which are shown in SEQ.ID.NO.4 and SEQ.ID.NO.5, and the amino acid sequences are shown in SEQ.ID.NO.6 and SEQ.ID.NO.6 .ID.NO.7 shown.

According to the sequence table comparison, it is found that the nucleotide sequences of BnHBBD-C06 and BnHBBD-A07 differ by 4 bases in total, and these 4 bases are the 59th G→A and the 129th in BnHBBD-C06 and BnHBBD-A07, respectively. Bit T→C, 140th bit T→A, and 159th bit C→G. The above-mentioned nucleotide sequence differences lead to two amino acid changes, which are N→S at position 20 and H→L at position 47 in BnHBBD-C06 and BnHBBD-A07, respectively. See Figure 1 for the comparison diagram.

Example 2: Construction of BnHBBD-A07 and BnHBBD-C06 editing vectors for directed mutation of Brassica napus genes based on CRISPR/Cas9 system

Submit the BnHBBD-A07 and BnHBBD-C06 gene sequences to the website http://cbi.hzau.edu.cn/cgi-bin/CRISPR, screen the targets, and select the target sites Target1 and Target2, the Target1 sequence is: 5 '-TACGATGGTTCTGCTCTGTC-3'(SEQ.ID.NO.1), Target2 sequence is 5'-TGCAAGAATTGGAGCCACCG-3'(SEQ.ID.NO.2), connect the above two target sequences to two identical The 5' end of the sgRNA sequence: [(20bptarget)GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTT](SEQ.ID.NO.3), where (20bp target) is the length of Target1 and Target2, making the double-target gene editing vector pKSE401-BnHBBD -CRISPR can knock out the target sequence twice to ensure effective editing.

Design CRISPR/Cas9 vector target primers according to the screened targets, and the primer sequences are shown in Table 3 to ensure that the two designed targets can simultaneously knock out BnHBBD-A07 and BnHBBD-C06.

Table 3. CRISPR/Cas9 Vector Target Primers

Primer	Sequence 5'-3'
HBBD-DT1-F0 (SEQ.ID.NO.9)	TGTACGATGGTTCTGCTCTGTCGTTTTGAGCTAGAAATAGC
HBBD-DT2-R0 (SEQ.ID.NO.10)	AACCGGTGGCTCCAATTCTTGCACAATCTCTTAGTCGACTCTAC
HBBD-DT1-Bs (SEQ.ID.NO.11)	ATATATGGTCTCGATTGTACGATGGTTCTGCTCTGTCGTT
HBBD-DT2-BsR (SEQ.ID.NO.12)	ATTATTGGTCTCGAAACCGGTGGCTCCAATTCTTGCACAA

Then use the four primers in Table 3 to perform PCR amplification on the template entry vector pCBC-DT1T2 (from teacher Hong Dengfeng of Huazhong Agricultural University). The PCR reaction system is the same as that in Table 1. Denaturation at ℃ for 15s, annealing at 52℃ for 15s, extension at 72℃ for 30s, 35 cycles; final extension at 72℃ for 5min. The normal primer concentration of primers HBBD-DT1-BsF and HBBD-DT2-BsR is 10 μM; HBBD-DT1-F0 and HBBD-DT2-R0 are diluted 20 times, and the primer concentration should be 5 μM. Purify and recover the above PCR product, the length of the PCR product 626bp, and then set up the enzyme cleavage-ligation reaction system. The specific reaction system is shown in Table 4. The reaction conditions are 37°C for 5h, 50°C for 5min, and 80°C for 10min.

Table 4. Digestion-ligation reaction system

Element	volume
PCR product (626bp)	2μL

pKSE401		2μL
10*NEB T4 Buffer	1.5μL
10*BSA	1.5μL
Bsa I (NEB)	1μL
T4 Ligase(NEB)/high concentration	1μL
ddH2O	6μL

At the end of the reaction, take 5 μL of the ligation product and transform it into competent Escherichia coli DH5α, use solid LB plate medium containing 50 mg/mL Kan for screening, and after overnight culture at 37°C, pick positive clones in 400 μL liquid LB medium containing 50 mg/mL Kan Perform shaking culture for 4-6 hours, take 2 μL of the bacterial liquid as a template for PCR amplification for identification, use the sequence in the U6 promoter on the pKSE401 vector to design and identify primers, and change the annealing temperature to 57°C. Other PCR amplification reaction systems and conditions are as shown in the table 2. The PCR amplification reaction of the bacterial solution is the same, and the specific primer sequences are as follows:

U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ.ID.NO.17)

U629-IDR:AGCCCTCTTCTTTCGATCCATCAAC (SEQ.ID.NO.18);

After PCR identification, the size of the fragment obtained after running the gel was 726bp. Take 100 μL of the positive clone liquid with the correct fragment size and send it to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing, and then design the sequence in the U6 promoter on the pKSE401 vector Forward sequencing primers, the primer sequences are as follows:

U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ.ID.NO.17)

U629-IDF: TTAATCCAAACTACTGCAGCCTGAC (SEQ.ID.NO.19);

The positive clones containing the two designed targets Target1 and Target2 in the sequencing results were expanded and cultured to extract the plasmid, so as to obtain the pKSE401-BnHBBD-CRISPR plasmid, and finally the plasmid was transformed into Agrobacterium GV3101, expanded and cultured to preserve the bacteria. to be used.

Figure 2 is a schematic diagram (a) of the positions of the selected Target1 and Target2 targets on the gene and a schematic diagram (b) of the LB and RB ranges in the pKSE401-BnHBBD-CRISPR plasmid. In the figure, LB: left border; RB: right border; Kan: kanamycin resistance gene; P-CaMV35S: CaMV35 promoter; U6-26p-Target1-gRNA: including promoter U6-26p, gRNA backbone structure and Target 1 (Target1); U6-26p-Target2-gRNA: gRNA expression element group, including promoter U6-26p, gRNA backbone structure and target 2 (Target2); Cas9: according to the Cas9 gene after codon optimization, the The Cas9 gene is derived from the sequence of Streptococcus pyogenes and based on maize codon optimization, and the codon-optimized Cas9 gene is purchased from http://www.addgene.org/62202/.

Example 3: Transformation of Brassica napus with pKSE401-BnHBBD-CRISPR gene editing recombinant vector

A. Sowing:

In order to quickly obtain the required new germplasm of rapeseed, select Brassica napus Y127 seeds that can grow quickly without vernalization (the seeds are from teacher Hong Dengfeng of Huazhong Agricultural University), put them in a 10mL centrifuge tube, and add alcohol with a volume fraction of 75% , turn it upside down, soak for 1min, absorb alcohol with a pipette, add an appropriate amount of sterile water to rinse 3-5 times; then add 15% bleach solution (8.115mL sterile water + 1.875mL sodium hypochlorite + 10μL triton), Turn the centrifuge tube upside down and soak the seeds for 6 minutes. The time for alcohol disinfection and sterilization of heavily polluted seeds can be extended appropriately, but too long time will affect the germination of the seeds. Then suck off the disinfectant, add an appropriate amount of sterile water to rinse 3-5 times, and turn it upside down each time to keep the centrifuge tube in a sterile environment. Finally, suck out the sterile water, sow the sterilized seeds on the M0 medium with the boiled sterile tweezers, about 25 seeds per bottle, and culture them under dark light at 24°C for 6 days to obtain rapeseed of the required length. hypocotyl.

B. Bacterial solution preparation:

5-7 days after sowing, cultivate the Agrobacterium containing the pKSE401-BnHBBD-CRISPR plasmid obtained in Example 2 with liquid LB. Add 20 μL of Agrobacterium containing the pKSE401-BnHBBD-CRISPR plasmid to L Rif), and incubate for about 14-16 hours at 28°C in a shaker at 180-220rpm.

Since the propagation speed of Agrobacterium in the culture medium is related to its activity, and the Agrobacterium in the logarithmic phase has the best vigor and is most likely to infect plants, so the inoculation time must be strictly calculated. Choose repeated inoculation intervals of 2 hours, such as inoculation at 18:00 and 20:00 respectively, and select an appropriate concentration at 8:00 the next morning, which can prevent excessive bacterial concentration. Before shaking the bacteria, select a positive single colony to inoculate the bacteria on the resistant plate, and incubate at 28°C for 48 hours. After the positive bacteria reproduce a single colony on the plate, use a 10 μL pipette tip to absorb the single colony and repeatedly blow it in the culture medium several times. make the bacteria grow evenly.

C. Infection and co-culture:

Prepare the co-cultivation medium M1 and DM solution. The M1 medium is sterilized at 121°C for 15 minutes and then cooled rapidly (about 50°C). AS was also added (final concentration 100 μM), recorded as DM (AS ⁺ ), and set aside.

Use a spectrophotometer to measure the OD value of the bacteria in the LB medium described in step B. It is better to select the bacterial solution with an OD value of about 0.4, and generally shake the bacteria for 14-16 hours. Draw 2mL of the cultured bacterial solution into a sterile centrifuge tube, centrifuge at 3000rpm for 3min, discard the supernatant; then add 2mL of DM (AS ⁺ ) solution to suspend, centrifuge at 3000rpm for 3min, discard the supernatant; then add 2mL of DM(AS ⁺ ) Suspended in liquid, put in refrigerator at 4°C for later use.

Use sterile dissecting scissors to cut the rape hypocotyls grown after sowing in step A, cut them into small pieces of 0.8cm-1.0cm, put them in a petri dish containing 18mL of DM liquid, wait until the hypocotyls are all cut into small pieces , and then pour 2mL of the bacteria solution resuspended with DM (AS ⁺ ) solution above, at this time the volume of the liquid in the dish is 20mL, soak for 10-15min (the time should not be long, otherwise the explants will easily die), and shake it at intervals 1 time, 4 to 5 times. When infecting for 8 minutes, start to suck off the DM (AS ⁺ ) bacterial solution with a pipette, use sterile tweezers to clamp the explants and place them on sterile filter paper for a while, suck away the excess bacterial solution on the explants, and then put The explants were then transferred to the M1 solid medium, and the explants were placed at 24°C in the dark or in a dark place in a light culture room.

D. Selection culture and callus induction:

Transfer the explants cultured in the M1 medium for 36-48 hours to the M2 medium, and culture them normally under the light at 24°C, and alternately cultivate them for 16 hours during the day and 8 hours at night for 2-3 weeks Induce healing.

E. Redifferentiation:

Transfer the explants to M3 medium and subculture every 2-3 weeks until green shoots appear.

F. Rooting culture

The green shoot that will have complete growth point is transferred in the M4 medium and grows up and takes root, needs about 20 days. After rooting, it can be directly placed in the cultivation room for seedling hardening. After the seedlings are in a stable state, take them out of the medium. Do not damage the root system of the plant during the seedling taking process, and then move the seedlings to the soil for cultivation. During cultivation, they need to be kept moist with plastic wrap In 1-2 weeks, the transgenic rape waiting to be identified can be obtained.

Example 4: Identification of transgenic Brassica napus and detection of gene editing sites

After the growth of the transgenic rapeseed plant in Example 3 is stable, the DNA in the transgenic rapeseed leaf is extracted by the CTAB method, and the specific steps are as follows:

A. Take a small amount of leaves and put them into a 1.5mL centrifuge tube, grind them with liquid nitrogen, and then add 600μL CTAB, then put the samples in a 65℃ water bath and incubate for 60min.

B. After the incubation is completed, add 600 μL of chloroform/isoamyl alcohol (volume ratio 24:1) solution to the tube, shake vigorously to fully remove the protein, and then put it in a centrifuge for 10 minutes at 12000g.

C. Gently take out the centrifuge tube after centrifugation. At this time, the solution is divided into three layers, which are the water phase, the leaf debris impurity layer, and the organic phase. Take 400-500 μL of the supernatant water phase and transfer it to a new centrifuge tube, and then supernatant Add 400-500 μL of isopropanol to the sample, invert and mix gently, and then place the sample in a -20°C refrigerator to cool for at least 10 minutes, so that isopropanol can precipitate DNA more effectively.

D. Put the centrifuge tube into the centrifuge and centrifuge at 12000g for 10min at room temperature.

E. Discard the supernatant after centrifugation, add 700 μL of pre-cooled 70% ethanol to wash, pop up the precipitate, gently invert to wash, and spin at 12000g.

F. Discard the supernatant after centrifugation, absorb the ethanol solution with a pipette, and then dry the precipitate in an ultra-clean typhoon to remove the volatile organic solution.

G. Add 50-100 μL ddH ₂ O to the centrifuge tube to dissolve the precipitate, put it in a 37° C. water bath for 30 minutes, and obtain the genome sample.

H. Take 1 μL of the genome sample to measure the concentration. After passing the test, put the genome sample into a -20°C refrigerator for later use.

Use the genomic sample obtained in the above steps as a template, the pKSE401-BnHBBD-CRISPR plasmid as a positive control, and the untransformed recipient material DNA and ddH ₂ O as a negative control for PCR identification. Identification primers were designed for the Cas9 protein sequence and Cas9 protein sequence (two pairs of primers were used to identify the transgenic rapeseed genome to be identified at the same time to ensure the credibility of the results). The annealing temperatures were 57°C and 62°C, respectively. The bacterial liquid PCR reaction of table 2 is the same, and the primer sequences are as follows:

Primer set 1: the length of the amplified fragment is 726bp

U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ.ID.NO.17)

U629-IDR:AGCCCTCTTCTTTCGATCCATCAAC (SEQ.ID.NO.18);

Primer set 2: the length of the amplified fragment is 701bp

Cas9-F: TGCAGGAGATTTTTCTCCAACGA (SEQ.ID.NO.20)

Cas9-R: AGCCTTCGTAATCTCGGTGTTCA (SEQ.ID.NO.21)

After the PCR is completed, electrophoresis is performed on the amplified product in 1% agarose gel, and the results are recorded by using a UV gel imager to take pictures. Figure 3 is the gel map of PCR identification of leaf genome extracted from two positive plants obtained through transformation; in the figure, WT: wild type; hbbd-1, hbbd-2: mutant transgenic plants; +: positive control, pKSE401-BnHBBD- CRISPR plasmid; -: negative control, ddH2O; Marker: Takara DL2000 DNA Marker.

It can be confirmed in the figure that the gene editing vector constructed in Example 3 was successfully transformed into rapeseed, and it was confirmed that through the process of plant tissue culture, a positive strain with successful identification was obtained.

In order to further confirm the gene editing of the positive strains, it is necessary to use high-fidelity enzymes to perform PCR amplification, gel running, gel recovery, and ligation of pMD19- T vector, transform Escherichia coli, pick and identify the bacteria, and send the monoclonal bacterial liquid to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. The specific experimental operation and method are the same as in Example 1.

The obtained sequencing results were analyzed, as shown in Figure 4, and the sequencing results were compared with the real sequencing results of BnHBBD-A07 and BnHBBD-C06 wild type obtained in Example 1, and more single The clone showed the insertion of a T base at the target site 1, so it was further analyzed, and the analysis results are shown in Figure 5.

Figure 5 is a schematic diagram of the frameshift mutation caused by the T insertion at the target point 1 of the hbbd mutant; (a) in the figure is the change of the BnHBBD-A07 gene in the mutant compared with the wild type; (b) is the change compared with the wild type Compared with the changes in the BnHBBD-C06 gene in the mutant. It can be seen from the figure that frameshift mutations occur in the BnHBBD-A07 and BnHBBD-C06 genes of the hbbd mutant, resulting in premature termination of the HBBD gene translation process, and HBBD protein cannot be synthesized normally, which can confirm the success of the gene editing vector Exercising function at the target site, successfully knocking out the BnHBBD-A07 and BnHBBD-C06 genes in Brassica napus.

Example 5: Analysis of non-shedding phenotype of flower organs of transgenic Brassica napus

Place the successfully verified hbbd mutant in Example 4 in an incubator with 16 hours of light, 8 hours of darkness, and a relative humidity of 70%. ) and mutants to observe and record the petal shedding. Three biological repetitions were carried out in this experiment. The attachment of flower organs refers to the natural shedding situation not affected by external force. The specific time is from flower bud opening to complete shedding. The results are shown in Table 5.

Table 5. Statistical table of flower organ attachment

Strain name	Investigate the number of flower organs	Attachment status of floral organs (days)
WT	10	5±0.5
hbbd-1	12	∞
hbbd-2	10	∞
hbbd-3	11	∞

Figure 6 is a comparison of the flowering period of the wild type (a) and the hbbd mutant's floral organ non-shedding phenotype (b), it can be clearly found that the mutant's floral organ is attached to the detachment area, and through the statistics of Table 5, it can be found that the hbbd mutant's Under the influence of no external force, flower organs can continue to exist from the flower bud stage, early bloom stage, full flower stage, pollination stage, and mature stage. Fig. 7 is a comparison chart of the silique maturity period of the flower organ non-shedding phenotype (hbbd) and the wild type (WT) of three different lines of the hbbd mutant. It can be seen from the picture that the color of the flower organs gradually changes from yellow to white, and even in the silique growth period and the silique mature stage, the phenotype that the flower organs will not fall off will continue. Figure 8 is a comparison of inflorescence stages between the hbbd mutant type (hbbd) and the wild type (WT). The numbers in the figure represent the position numbers of the rapeseed inflorescences. And so on. It can be seen from the figure that if the flower is marked according to the position of the inflorescence, the phenotype that the flower organ does not detach can be seen more clearly.

As the ascospores of Sclerotinia in nature fall on the petals, as the wild-type flower organs fall off, when they fall on the leaves or stems, the hyphae of Sclerotinia begin to grow and form an infection environment. The sclerotium is formed in the stem, and the stem of rape will become hollow due to the infection of Sclerotinia sclerotiorum, which will cause the death of the whole plant and bring great economic losses. Fig. 9 is a schematic diagram showing the comparison of pathogenesis pathways of S. sclerotiorum infecting hbbd mutant and wild type under natural conditions. It can be seen from the figure that the floral organ of the hbbd mutant does not fall off, and the ascospores floating on the floral organ will not grow.

In the present embodiment, the hbbd mutant flower organ is also tested in the incubator environment to avoid the disease phenotype of Sclerotinia sclerotiorum, and the specific test method is: inoculate the Sclerotinia sclerotia obtained by separating in the test field on PDA solid culture In the dish, cultured upside down at 28°C for 6 days. After the hyphae grow to the edge of the dish, take a 0.3cm*0.3cm stack of bacteria from the edge and inoculate them on the petals of 3 wild-type and 3 mutant strains respectively. 6 petals were inoculated, and then the inoculated plants were placed in an artificial climate box (purchased from Shanghai Yiheng Scientific Instrument Co., Ltd.) for cultivation. In order to simulate natural conditions, the cultivation conditions were 22° C. of temperature, 90% humidity, 12h weak light, 12h dark culture, every 12h to observe the growth of mycelia. . . Table 6 shows the statistics of the disease after inoculation of S. sclerotiorum on the petals.

Table 6. Statistical table of the incidence of sclerotinia after inoculation on the petals

Strain name	Number of petals to inoculate	Number of cases after vaccination
WT-1	6	6
WT-2	6	5
WT-3	6	5

hbbd-1	6	1
hbbd-2	6	0
hbbd-3	6	0

Table 6 is a statistical table of the incidence of Sclerotinia sclerotiorum on the petals. It can be seen from the table that after S. sclerotiorum infects the hbbd mutant and wild-type WT, the petals of the wild-type WT basically all fell ill after inoculation, while hbbd The mutants were basically free of disease after inoculation.

Figure 10 is a schematic diagram of the comparison of the incidence of hbbd mutants and wild-type WT infected by S. Arrows represent wild-type petals shedding on leaves, (d) long arrows and crosses represent mutant petals not falling on leaves, dpi (day of post-inoculation), 0dpi and 4dpi represent 0 days and 4 days of inoculation with Sclerotinia sclerotiorum sky. It can be seen from the figure that the petals of wild-type WT will fall off, and with a high probability, the sclerotinia that has started to grow will detach and attach to the leaves. The continuous infection of sclerotinia makes the leaves of the plant rotten, resulting in Great disease; while the hbbd mutant flower organ does not fall off, and is in the top layer of the plant, the humidity is not high, the ventilation is better, the sclerotinia is not easy to grow, there is no disease phenomenon, the plant grows normally, and will not be invaded by the sclerotinia infection, resulting in plant death.

Figure 11 is a statistical chart of the number of diseased petals after inoculation with Sclerotinia sclerotiorum. After the t test, P<0.001, it can be seen that the number of diseased petals of the mutant hbbd is significantly lower than that of the wild-type WT.

In this example, the hbbd mutant and wild-type siliques were also tested for cracking force. The specific test steps are as follows: take a total of 10 mature siliques of the wild-type and hbbd mutant 40 days after flowering, and place them in a temperature of 25°C and a humidity of 50°C. % environment for one week, then stick the siliques on the thin board with glue, so that the plane where the rape silique pseudo-diaphragm is located is parallel to the plane of the plank, the tail of the silique is aligned with the edge of the plank, and the silique stalk is outside the plank. Use the TA.XT Plus physical property analyzer (UK Stable Micro System Company) to fix the L-shaped hook on the probe, hook the silique base in the direction perpendicular to the plate, and fix it on the joint of the silique and the stalk on the plate. During the measurement, press the plate with your hand and move upward at a constant speed of 1mm/min. When it touches the silique stalk, turn to move upward at a constant speed of 0.5mm/min, pull the silique, and record the wild type and mutant at the same time tear force data.

Before the siliques crack, the force received is continuously increasing, and after the siliques are cracked, the force received is suddenly reduced. The peak value of the force is the maximum cracking force data of the silique cracking force. The larger the peak value, the better the silique resistance big. Figure 12 is the measurement diagram of the cracking force of mutant (hbbd) and wild type (WT) siliques. It can be seen from the figure that the maximum cracking force data of wild type siliques is about 0.3-0.5N, and the maximum tensile force of mutant siliques is The cracking force data is about 0.6-0.8N. After the t test, P<0.05, the cracking force of the mutant is significantly increased compared with the wild type, that is, the ability of the silique to resist cracking is enhanced.

The above experimental results can show that the HBBD protein in Brassica napus is also one of the important proteins that regulate the shedding of floral organs, and it provides certain utilization resources for prolonging the flowering period, anti-sclerotinia and mechanized harvesting.

The basic principles, main features and advantages of the present invention have been shown and described above. Those skilled in the industry should understand that the present invention is not limited by the above-mentioned embodiments. What are described in the above-mentioned embodiments and the description only illustrate the principle of the present invention. Without departing from the spirit and scope of the present invention, the present invention will also have Variations and improvements are possible, which fall within the scope of the claimed invention. The protection scope of the present invention is defined by the appended claims and their equivalents.

Claims (12)

1. A CRISPR/Cas9 system sequence element group for site-directed mutation of Brassica napus BnHBBD gene, characterized in that, the sequence element group includes U6-26p-Target1-gRNA, U6-26p-Target2-gRNA and according to codon optimization After the Cas9 gene; the U6-26p-Target1-gRNA includes promoter U6-26p, gRNA backbone structure and Target1; the U6-26p-Target2-gRNA includes promoter U6-26p, gRNA backbone structure, Target2;

   Wherein, the Brassica napus BnHBBD gene includes BnHBBD-C06 and BnHBBD-A07, the Target1 is the target sequence of the gene BnHBBD-C06, and the -Target2 is the target sequence of the gene BnHBBD-A07.
2. The CRISPR/Cas9 system sequence element set for site-directed mutation of Brassica napus BnHBBD gene according to claim 1, wherein the nucleotide sequence of the Target1 is as shown in SEQ.ID.NO.1;

   The nucleotide sequence of the Target2 is shown in SEQ.ID.NO.2;

   The nucleotide sequence of the sgRNA is shown in SEQ.ID.NO.3.
3. The CRISPR/Cas9 system sequence element set for site-directed mutation of Brassica napus BnHBBD gene according to claim 1, characterized in that,

   The nucleotide sequence of BnHBBD-C06 is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ.ID.NO.6;

   The nucleotide sequence of BnHBBD-A07 is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7.
4. A gene editing vector pKSE401-BnHBBD-CRISPR, characterized in that the gene editing vector comprises the CRISPR/Cas9 system sequence element set for site-directed mutation of Brassica napus BnHBBD gene according to any one of claims 1 to 3.
5. A genetically engineered bacterium for site-directed mutation of Brassica napus BnHBBD gene, characterized in that the genetically engineered bacterium is obtained by transforming a host bacterium with the gene editing vector pKSE401-BnHBBD-CRISPR according to claim 4.
6. A kit for site-directed mutation of Brassica napus BnHBBD gene, characterized in that the kit includes the gene editing vector according to claim 4 or the genetically engineered bacterium according to claim 5.
7. The application of the sequence element group described in any one of claims 1-3, the gene editing vector pKSE401-BnHBBD-CRISPR described in claim 4, the genetically engineered bacteria described in claim 5, or the kit described in claim 6, It is characterized in that the application includes:

   A) Application in Brassica napus gene BnHBBD-C06 and/or gene BnHBBD-A07 site-directed mutation, the nucleotide sequence of the BnHBBD-C06 gene is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ. As shown in ID.NO.6, the nucleotide sequence of the BnHBBD-A07 gene is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7;

   B) use in the breeding of Brassica napus with a long flowering period; and/or

   C) application in the breeding of Brassica napus with anti-sclerotinia; and/or

   D) Application in the breeding of Brassica napus with siliques that are not easy to crack.
8. A method for site-directed mutation of Brassica napus BnHBBD gene utilizing CIRSPR/Cas9 system, is characterized in that, comprising:

   (1) Design screening targets Target1 and Target2 for the BnHBBD gene in Brassica napus, and design sgRNA sequences, connect the two targets Target1 and Target2 to the sgRNA sequences respectively, and construct the dual-target gene editing vector pKSE401-BnHBBD- CRISPR;

   (2) Transforming the gene editing vector pKSE401-BnHBBD-CRISPR into Agrobacterium GV3101 to obtain the Agrobacterium containing the gene editing expression vector pKSE401-BnHBBD-CRISPR;

   (3) expanding the culture, using the obtained Agrobacterium bacterium liquid to mediate the transformation of rape hypocotyl;

   (4) Rapeseed hypocotyl culture, callus induction, redifferentiation, rooting culture, seedling hardening, transplanting, to obtain transgenic rapeseed;

   (5) Identify the transgenic plants with mutations in the BnHBBD gene.
9. The method according to claim 8, wherein the Brassica napus BnHBBD gene comprises BnHBBD-C06 and BnHBBD-A07, the Target1 is the target sequence of the gene BnHBBD-C06, and the -Target2 is the gene BnHBBD- A07 target sequence,

   The nucleotide sequence of the Target1 is shown in SEQ.ID.NO.1,

   The nucleotide sequence of the Target2 is shown in SEQ.ID.NO.2,

   The nucleotide sequence of the sgRNA is shown in SEQ.ID.NO.3,

   The nucleotide sequence of the BnHBBD-C06 is shown in SEQ.ID.NO.4, and the amino acid sequence is shown in SEQ.ID.NO.6,

   The nucleotide sequence of the BnHBBD-A07 is shown in SEQ.ID.NO.5, and the amino acid sequence is shown in SEQ.ID.NO.7.
10. The method according to claim 8, characterized in that the mutation in the BnHBBD gene includes the insertion of a T base.
11. The application of the mutated BnHBBD gene obtained by the method according to any one of claims 8 to 10 in regulating the abscission of Brassica napus flower organs.
12. The application according to claim 11, characterized in that, the application includes inhibiting the normal synthesis of HBBD protein in Brassica napus, the breeding of Brassica napus with long flowering period, the breeding of Brassica napus with anti-sclerotinia, and the hard-to-crack rape of silique breeding.

Images