CN114752605A

CN114752605A - Rice OsOFP22sGene and method for increasing rice grain length and thousand grain weight and improving amylose content by using gene

Info

Publication number: CN114752605A
Application number: CN202210594164.6A
Authority: CN
Inventors: 李钱峰; 白皇; 刘巧泉; 任新雨; 张昌泉; 张�林; 陆陈雅
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2022-05-27
Filing date: 2022-05-27
Publication date: 2022-07-15
Anticipated expiration: 2042-05-27
Also published as: CN114752605B

Abstract

The invention discloses rice OsOFP22^sGene and method for increasing rice grain length and thousand grain weight and improving amylose content by using same, rice OsOFP22^sThe gene is highly expressed in the seeds, can specifically improve the related characters of rice grains, including grain length, thousand grain weight and amylose content, has no obvious influence on other main agronomic characters of rice plants, and utilizes the gene engineering technology to improve the rice grainsIntermediate overexpression of OsOFP22^sThe thousand grain weight of the rice can be obviously improved, and the grain shape and the cooking taste quality are improved; by comparison, OsOFP22^sThe over-expressed rice is superior to the control in grain length and thousand grain weight, the amylose content is obviously reduced compared with the control, the quality of cooked food flavor is also obviously improved, and the OsOFP22^sThe gene has good application prospect in high-yield and high-quality breeding of rice.

Description

Rice OsOFP22sGene and method for increasing rice grain length and thousand grain weight and improving amylose content by using gene

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene OsOFP22 for increasing rice grain length and thousand grain weight and improving amylose content ^sAnd the application thereof, and also relates to a polypeptide sequence coded by the gene.

Background

Rice (Oryza sativa L.) is the staple food for more than half of the world population, and China is the first major country for global rice yield and consumption. With the increase of population and the gradual decrease of the cultivated land area, the improvement of the yield of rice per unit area becomes the most important way for improving the total yield of grains for ensuring the national grain safety. Meanwhile, with the improvement of living standard of people and the opening of rice market, rice is widely traded as a commodity, and people also put higher and higher requirements on the appearance, cooking taste and other qualities of rice. In China, high yield is always taken as a main target, quality improvement progresses relatively slowly, so that the varieties of high-quality rice in China are few, and the competitiveness in the international rice market is weak. Therefore, it is important to further improve the quality of rice while ensuring the yield. At present, the breeding of new rice varieties with high quality and high yield becomes the most important target of rice breeding in China.

The grain shape of the rice is an important factor for determining the yield of the rice, and is also an important index for measuring the appearance, processing and other qualities of the rice. In addition, the particle shape is less influenced by the environment, and the genetic effect is obvious. Therefore, the improvement of rice grain shape is an effective way for realizing high-yield and high-quality breeding of rice. In order to accelerate the breeding process of rice grain shape improvement, besides the conventional breeding method, more important is to explore more available grain shape genes, perfect the molecular network for rice grain shape regulation and control, construct an efficient molecular breeding technical system, and cultivate a new rice variety with specific grain shape by a molecular design breeding strategy.

The main indicators of the rice grain shape character comprise grain length, grain width, grain thickness, aspect ratio and the like. Wherein the grain length not only influences the appearance and the grinding quality of rice, but also has obvious positive correlation with the thousand grain weight of the rice. Before, a gene GS9 for specifically regulating rice grain shape is separated and cloned by a map-based cloning method, so that the grain of a rice material is knocked out to be slender, the appearance quality is improved, and the main agronomic traits such as plant height and thousand kernel weight are not obviously influenced. The GS9 gene knockout in different rice varieties obviously improves the grain shape traits. GS9 protein is used as bait, protein which interacts with the GS9 protein is screened from a rice seed cDNA library, and an ovoprotein family member OsOFP22 is screened^sThe protein can directly interact with GS9, and the interaction of the two proteins is further verified in plants by using a firefly enzyme complementation experiment.

Disclosure of Invention

The invention aims at the problems and provides a gene OsOFP22 for increasing the grain length and thousand grain weight of rice and improving the content of amylose^sAnd applications thereof.

The purpose of the invention is realized by the following technical scheme: rice OsOFP22^sGene, OsOFP22^sThe gene is located on the No. 1 chromosome of rice, and has the gene number of Os05g0477200(NCBI number) and LOC _ Os05g39950(MSU number). OsOFP22 ^sThe CDS of the gene coding region has the full length of 1155bp and no intron, and the OsOFP22^sThe sequence of the coding region of the gene is shown as SEQ ID NO.1 (ATGGGCCGGCGGAAGTTCAGGCTCTCCGACATGATGCCCAACGCGTGGTTCTACAAGCTCCGCGACATGCGCGCGCGGGGCGGCCGCGGTGCAACTGCGATGCAGCCGCCGTCGTCGTCGTCGTTGATGAGGGGGAGCAGGGCGGCGCAGCAGCAGGCGGGCACGTGGAGGCTGGGGACGTCGTCGTCGTCGTCGTCGTTGCTGCCGCACAGGGCGTCGTACTACTACACCACCCGGGACAGGGAGGTCCCGCCGCTGCCGCCGCCGCCACCGCCGAGGGGCGTGGATGATCAATTCCCTTCCCTCACGCTGTCGCCGCCGTTGCCGACGAGGAACAGCAGGAGGCGGCACAGGGTTGGGAGATTTGGTTCGACGGAGATGGATGGC)GGCGAGCTCGTACTAGCGCCGTCCGACGACCACGACGGCTGCAGCCACCAGGAGCCGCCAGTGGCCGATGCGTCCGGGAGCTCCCGGTGCCGTCGCGACATGTTCATCGGGAGAGATGGCGGCCGGGGCGTGGAGTTCCGGCGCCGGGCGACGACGGTGGATGGTCCTGAGGAGGACGCCGCCGTCGATGTCAAGGTGATCACGTCGGACGCGGACATAATCATCGACCTCGGCGCTGACGACGACGACGACACGCCGGAGAGGGTGCTCCGGCCTGTCGTGACCAGGCCCGCGAGGAGGGAGCTCGACTGGTGCGAGCCGGCGGAGGTGAAGCACGTCGACCTCGCCGAGCTGATGACACCGAGAGCGAGCTCTGCCTCTGCCTCCTCGGAGAAGAGCATCAGCACGGGCAAGCCGAGGCGTTCGTCCGTGTCGTCTCGACGCCGCCTCAAGACGCGCACCAACAGCCCGCGCCTCGCCGCGTGCAGGAAAGGCAAGCCGACGGCGCGGGCAACGACGACGACGCCGACGCAGCCGCCGCTCGCGCACAGCTTCGCGGTGGTGAAGACGTCGTCGGACCCGAGGAGGGACTTCCTCGAGTCCATGGAGGAGATGATCGCCGAGAACGGCATCCGCGACGCCGGCGACCTGGAGGACCTCCTCGCCTGCTACCTCTCCCTCAACTCCGGCGAGTACCATGACCTCATCGTCGAGGTGTTCGAGCAGGTCTGGACCGGCCTCGCCGCTGCCTGTGGCGTCATGCCATGA)；OsOFP22^sThe gene codes 384 amino acids, and the OsOFP22^sThe coded amino acid sequence is shown as SEQ ID NO.2 (MGRRKFRLSDMMPNAWFYKLRDMRARGGRGATAMQPPSSSSLMRGSRAAQQQAGTWRLGTSSSSSSLLPHRASYYYTTRDREVPPLPPPPPPRGVDDQFPSLTLSPPLPTRNSRRRHRVGRFGSTEMDGGELVLAPSDDHDGCSHQEPPVADASGSSRCRRDMFIGRDGGRGVEFRRRATTVDGPEEDAAVDVKVITSDADIIIDLGADDDDDTPERVLRPVVTRPARRELDWCEPAEVKHVDLAELMTPRASSASASSEKSISTGKPRRSSVSSRRRLKTRTNSPRLAACRKGKPTARATTTTPTQPPLAHSFAVVKTSSDPRRDFLESMEEMIAENGIRDAGDLEDLLACYLSLNSGEYHDLIVEVFEQVWTGLAAACGVMP).

The rice OsOFP22^sOverexpression recombinant vector pActin-OFP22 of gene ^s-3Flag, characterized in that said pActin-OFP22^s-3Flag comprises OsOFP22^sThe gene and the vector are plant binary expression vectors pActin-3 Flag.

The first strand of cDNA obtained by reverse transcription was amplified by PCR to obtain a desired band. After amplification, the product containing the target gene is ligated to an intermediate vector, and the ligation product is transformed into E.coli competent cells. Shaking the bacteria, selecting a single bacterial colony, performing enzyme digestion identification and sequencing. If the sequencing result is correct, extracting the plasmid, cutting out the target gene and connecting the target gene into a final expression vector pActin-OFP22^s-3Flag。

Further, the overexpression recombinant vector pActin-OFP22^sThe preparation method of-3 Flag is as follows:

the plant binary expression vector pCAMBIA1300 is double digested by Sam I and Xba I, and the digested vector is combined with a vector containing OsOFP22 by using homologous recombinase^sAnd connecting PCR amplification products of the full-length cDNA of the gene.

Preferably, the composition comprises OsOFP22^sThe PCR amplification method of the full-length cDNA of the gene comprises the following steps:

taking RNA of wild Nipponbare as a template, the primer sequences are as follows:

sequence name	Sequence of	Sequence numbering
			OFP22^s-OE-F	5-TAGGTAGAAGAGGTACCCGGGCTCTGGCCTGGCCCCCCA-3	SEQ ID NO.3
OFP22^s-OE-R	5-GTAATCTCCGTCGACTCTAGATGGCATGACGCCACAGGC-3	SEQ ID NO.4

。

Further, the rice OsOFP22^sThe gene is applied to the aspects of increasing the grain length and thousand grain weight of rice and improving the content of amylose.

Preferably, the method of application is as follows: using said rice OsOFP22 ^sThe gene sequence constructs a recombinant vector which can be over-expressed in rice, agrobacterium is transformed, and then agrobacterium-mediated rice is usedThe genetic transformation method transfers the carrier into the rice callus, and the rice plant is obtained after resistance screening and tissue culture.

Preferably, the recombinant vector overexpressed in rice is the overexpression recombinant vector pActin-OFP22^s-3Flag。

Preferably, the application method comprises the following steps:

(1) construction of engineering bacteria: coupling pActin-OFP22^sThe-3 Flag vector is transformed into agrobacterium strain EHA105 by an electric shock method, and screened by kanamycin and rifampicin to obtain a vector containing pActin-OFP22^s-3Flag vector agrobacterium;

(2)pActin-OFP22^s-3 transforming rice callus and obtaining rice regeneration seedlings by Flag vector: with a solution containing pActin-OFP22^sInfecting the rice callus by EHA105 of a Flag carrier, co-culturing for 3 days in a culture room at 28 ℃, washing away agrobacterium by using a liquid culture medium, and culturing the rice callus on a screening culture medium containing a proper antibiotic; after two times of culture, resistant callus can be obtained, the resistant callus is transferred to a differentiation culture medium to carry out differentiation culture to obtain plantlets, the differentiated plantlets are transferred to a rooting culture medium to be cultured, and then the plantlets are transplanted after hardening.

Molecular detection of transgenic plants: according to OsOFP22^sCDS sequence of gene coding region and pActin-OFP22^s3Flag vector sequences forward and reverse primers were created, respectively, and these primers were used to identify whether the creation of over-expressed material was successful. The primer sequences are as follows:

sequence name	Sequence of	Sequence numbering
			pActin-F	5-TGCTGCTTCGTCAGGCTTAG-3	SEQ ID NO.5
OFP22s-OE-cs-R	5-CGTTGGGCATCATGTCGG-3	SEQ ID NO.6

The PCR product was 320 bp.

Quantitative RT-PCR analysis with fluorescent reagent: taking the extracted and stored rice leaf RNA, and obtaining first strand cDNA after reverse transcription. And (3) carrying out reagent quantitative PCR analysis, wherein the rice gene Actin01 is an endogenous reference gene, and detecting whether the expression level is increased. The primer sequences are as follows:

sequence name	Sequence of	Sequence numbering
			OFP22^s-qRT-F	5-GACATGATGCCCAACGC-3	SEQ ID NO.7
OFP22^s-qRT-R	5-AACCAAATCTCCCAACCCT-3	SEQ ID NO.8

。

The invention has the following beneficial effects: (1) the inventionOsOFP22 in (1)^sThe protein amino acid and the OFP22 protein have 88 amino acids at the N end, and the expression analysis result shows that the identified short transcript OsOFP22^sThe expression quantity in rice seeds is far higher than that of OFP22 long transcripts, and the sequencing analysis result of three generations of transcriptome of rice developing seeds shows that OsOFP22^sTranscripts are the predominant form present in rice seeds.

(2) Rice OsOFP22 of the invention^sThe gene has high expression in rice seeds, the protein product can directly interact with GS9, and more importantly, OsOFP22 ^sAfter overexpression, multiple properties such as rice grain shape, thousand grain weight, amylose and the like can be improved synergistically, and no obvious negative effect is caused on other main agronomic properties, so that good breeding application value is embodied.

(3) Rice OsOFP22 used in the invention^sConstruction of recombinant vector capable of being over-expressed in rice, rice OsOFP22^sAfter gene overexpression, the grain length and thousand grain weight of the rice are improved compared with a control, the rice grain width, thousand grain weight and rice physical and chemical quality are obviously influenced, and OsOFP22^sThe over-expressed rice has softer and more glutinous taste, improves the steaming quality of the rice to a certain extent, and has important significance for improving the yield and the quality of the rice.

Drawings

FIG. 1 is GS9 and OsOFP22^sAnd (3) carrying out yeast double-hybrid interaction verification on the protein.

FIG. 2 shows the verification of GS9 and OsOFP22 in the in vivo firefly luciferase complementation experiment in tobacco^sThe interaction of (a).

FIG. 3 is OsOFP22^sAnd OFP22 in seeds.

FIG. 4 shows Zhonghua 11 and OsOFP22^sThe phenotype of mature grains of the over-expressed material is shown as the top flower 11 and the bottom three rows as OsOFP22^sThree different lines of over-expressed material.

FIG. 5 wild type middle flower 11 and OsOFP22^sStatistical comparison of grain types of over-expressed materials.

FIG. 6 shows wild type Zhonghua 11 and OsOFP22^sStatistical comparison of thousand grain weight of over-expressed Material Rice。

FIG. 7 shows wild type Zhonghua 11 and OsOFP22^sAnd comparing the plant types of the over-expressed materials.

FIG. 8 shows wild type Zhonghua 11 and OsOFP22^sComparison of the amylose content (AAC) of over-expressed material rice.

Detailed Description

In order to understand the present invention, the following examples are given to illustrate the present invention, but not to limit the scope of the present invention.

The following examples were conducted in accordance with the conventional procedures, and the materials used and the actual products were all commercially available.

Example 1

GS9 and OsOFP22^sVerification of interactions

The interaction between proteins is the basis of cell life activities and also an important component of a cell biochemical reaction network, and has important significance for controlling cell signals. GS9 is an important granule type gene, and is used for verifying GS9 and OsOFP22^sProtein interaction, and further study of OsOFP22^sSpecific protein segment for protein interaction with GS9, we combined OsOFP22^sFull-length, N-end and C-end truncated gene fragments are respectively constructed on pGADT7 vector to form pGADT7-OsOFP22^s、pGADT7-OsOFP22^sN、pGADT7-OsOFP22^sC multiple constructs (fig. 1). The primer sequences are respectively as follows:

Sequence name	Sequence of	Sequence numbering
			OFP22^s-F	5-CGGAATTCATGGGCCGGCGGAAGTTCAG-3	SEQ ID NO.9
OFP22^s-R	5-CGGGATCCTCATGGCATGACGCCACAGG-3	SEQ ID NO.10
			OFP22^s-N-F	5-CGGAATTCATGGGCCGGCGGAAGTTCAG-3	SEQ ID NO.11
OFP22^s-N-R	5-CGGGATCCTCAGCTGTGCGCGAGCGGCG-3	SEQ ID NO.12
			OFP22^s-C-F	5-CGGAATTCATGTTCGCGGTGGTGAAGAC-3	SEQ ID NO.13
OFP22^s-C-R	5-CGGGATCCTCATGGCATGACGCCACAGG-3	SEQ ID NO.14
			GS9C1-F	5-GGAATTCCATATGCAGAGCAGCAGCAAGCG-3	SEQ ID NO.15
GS9C1-R	5-CGGAATTCCTAGCCTCTGGTTCGTATG-3	SEQ ID NO.16

。

The above-mentioned vector and pGBKT7-GS9C1 are co-transformed into yeast AH109, then screened and identified on the correspondent nutrient-deficient culture medium. The results showed full length OsOFP22^sProtein interacts with GS9C1, truncated OsOFP22^sOsOFP22 only^sC interacts with GS9C1 (FIG. 1), indicating that OsOFP22^sIs a critical region mediating its interaction with GS 9.

To further validate GS9 and OsOFP22^sWhether there is interaction in plants, we performed a Luciferase complementation Assay (Split Firefoluciferase complementation Assay) validation. The full-length OsOFP22^sAnd GS9C1 were cloned into JW771(35S-NLuc) and JW772(35S-CLuc) vectors, respectively, with the following primer sequences:

the vectors constructed as described above were transformed into Agrobacterium GV3101, and shake-cultured overnight in LB medium (5mL) containing kanamycin. Setting a proper combination, injecting the combination into tobacco epidermal cells, detecting the activity of luciferase by using a plant living body molecular imaging system (CCD imaging system) after 48 hours, and verifying the interaction. The results are shown in FIG. 2. Empty vector combinations NLuc and CLuc, and empty vector and OsOFP22^sOr GS9C1 has no fluorescence signal, and only contains OsOFP22 ^sAnd GS9C 1. This experiment demonstrates GS9 and OsOFP22^sThere are also interactions in plant cells.

Example 2

OsOFP22^sGene over-expression recombinant vector pActin-OFP22^s-3 creation of Flag

First strand cDNA was synthesized using wild type Nipponbare RNA as a template, and OsOFP22 was used^sOligonucleotides at the 5 'and 3' ends of the gene coding sequence were used as PCR primers with the following sequences:

。

The plant binary expression vector pActin-3Flag (see www.cambia.org for details) is subjected to double digestion by Sam I and Xba I, and the digested vector is subjected to homologous recombinase digestion with a vector containing OsOFP22^sConnecting PCR amplification products of gene full-length cDNA; obtaining an overexpression recombinant vector pActin-OFP22^s-3 Flag; coli competent cells of DH5 α were transformed, screened by kanamycin on LB plate medium and verified by sequencing. Wherein the sequencing primer sequence is as follows:

sequence name	Sequence of	Sequence numbering
			p1300-3Flag-F	5-ATGGGGCTCTCGGATGTAGA-3	SEQ ID NO.21
p1300-3Flag-R	5-CGATCATAGGCGTCTCGCAT-3	SEQ ID NO.22

。

Example 3

Rice OsOFP22^sMethod for applying gene in improving rice grain length, thousand grain weight and amylose content

(1) Constructing engineering bacteria: mixing pActin-OFP22^sThe-3 Flag vector is transformed into an agrobacterium strain EHA105 by an electric shock method, and screened by kanamycin and rifampicin to obtain pActin-OFP22 ^s-3Flag vector agrobacterium;

(2)pActin-OFP22^s-3 transforming rice callus and obtaining rice regeneration seedlings by Flag vector: firstly, removing shells of mature 11 seeds of the medium flower, soaking and disinfecting the seeds for 1-2h by using a 2% sodium hypochlorite solution, washing the seeds by shaking continuously during disinfection, then washing the seeds for 3-5 times by using sterilized distilled water, peeling young embryos on a sterile super clean workbench by using pointed tweezers and a dissection knife, transferring the embryos to an induction culture medium, and using the grown calluses for subsequent genetic transformation. Selecting a single agrobacterium tumefaciens colony subjected to PCR verification, inoculating the single agrobacterium tumefaciens colony into 4mL of LB liquid culture medium containing 50mg/L of kanamycin, and carrying out overnight culture at 28 ℃ and 250 rpm; transferring into 50mL of the same culture medium according to the inoculation amount of 1% on the next day, and performing amplification culture for 6-8h under the same condition until logarithmic phase; centrifuging at 4000rpm and 4 ℃ for 5min, collecting thalli, suspending in 10mL AAM liquid culture medium containing 100-400 mu mol/L acetosyringone, and then infecting the exfoliated rice callus for 20 min; after infection, the inoculum solution was decanted and the residual inoculum solution was removed by blotting with sterile filter paper, transferring the callus to N₆D₂Culturing on C culture medium at 28 deg.C in dark for 3 days, and culturing the callus after 3 daysTissue transfer to N containing 600mg/L cefuroxime and 25mg/L hygromycin ₆D₂S₁Performing first round screening culture on the culture medium; two weeks later, the transfer was made to a new N containing 300mg/L of cefuroxime axetil and 50mg/L of hygromycin₆D₂S₂Performing a second round of screening culture on the culture medium; then transferring the resistant callus with strong activity to a differentiation medium for differentiation culture, transferring the differentiated plantlets to 1/2MS₀Culturing on rooting culture medium, hardening seedling, transplanting to transgenic rice field.

(3) Molecular detection of transgenic plants: extracting target gene genome DNA from transgenic rice leaf to be detected according to OsOFP22^sCDS sequence of Gene coding region and pActin-OFP22^s3Flag vector sequences forward and reverse primers were created, respectively, and these primers were used to identify whether the creation of over-expressed material was successful. The primer sequences are as follows:

。

Whether the expression vector is successfully transferred into the rice is detected through PCR amplification and gel electrophoresis. The size of an electrophoresis strip of the PCR product is 320bp, if a plant with the same size as the target fragment is amplified, the plant is a positive plant, otherwise, the plant is a negative plant; on the other hand, the hygromycin resistance of the rice leaves is detected in vitro, and positive transgenic plants are further confirmed and screened. Hygromycin detection primers were as follows:

Sequence name	Sequence of	Sequence numbering
			Hyg-F	5-GCTTCTGCGGGCGATTTGTGT-3	SEQ ID NO.23
Hyg-R	5-GGTCGCGGAGGCTATGGATGC-3	SEQ ID NO.24

。

Example 4

Investigation of OsOFP22 gene overexpression in aspect of improving rice grain length and thousand grain weight

OsOFP22^sThe gene has high application value in the aspects of rice grain length and thousand grain weight after overexpression. After overexpression, the grain length of the transgenic corn is obviously improved compared with that of a control, specifically shown in fig. 4, and specific data statistics and comparison are shown in fig. 5. Thousand kernel weight was very significantly increased compared to the wild type control, see in particular fig. 6. The gene and the gene engineering technical means provided by the invention can obviously improve the rice without influencing other agronomic traits of the rice (figure 7)High output and high application value.

Example 5

OsOFP22^sGene overexpression obviously reduces the content of amylose in rice

The most important factor of amylose content (AAC) influencing the rice cooking taste quality (ECQ) is analyzed, and the result shows that OsOFP22^sThe overexpression of (a) resulted in a very significant reduction in AAC in rice (fig. 8). The results indicate OsOFP22^sThe taste of the over-expressed rice is softer and more glutinous, and the cooking quality of the rice is improved to a certain extent.

The above description is only a preferred embodiment of the present invention, but not intended to limit the present invention, and those skilled in the art can make possible variations and modifications of the present invention, or modify equivalent embodiments using the technical content disclosed above without departing from the technical scope of the present invention, and any simple modification, equivalent variation and modification made to the above embodiments according to the technical spirit of the present invention fall within the technical scope of the present invention.

Sequence listing

<110> Yangzhou university

<120> a rice OsOFP22s gene and a method for increasing rice grain length, thousand grain weight and improving amylose content by using the same

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1155

<212> DNA

<213> Rice (Oryza sativa var.)

<400> 1

atgggccggc ggaagttcag gctctccgac atgatgccca acgcgtggtt ctacaagctc 60

cgcgacatgc gcgcgcgggg cggccgcggt gcaactgcga tgcagccgcc gtcgtcgtcg 120

tcgttgatga gggggagcag ggcggcgcag cagcaggcgg gcacgtggag gctggggacg 180

tcgtcgtcgt cgtcgtcgtt gctgccgcac agggcgtcgt actactacac cacccgggac 240

agggaggtcc cgccgctgcc gccgccgcca ccgccgaggg gcgtggatga tcaattccct 300

tccctcacgc tgtcgccgcc gttgccgacg aggaacagca ggaggcggca cagggttggg 360

agatttggtt cgacggagat ggatggcggc gagctcgtac tagcgccgtc cgacgaccac 420

gacggctgca gccaccagga gccgccagtg gccgatgcgt ccgggagctc ccggtgccgt 480

cgcgacatgt tcatcgggag agatggcggc cggggcgtgg agttccggcg ccgggcgacg 540

acggtggatg gtcctgagga ggacgccgcc gtcgatgtca aggtgatcac gtcggacgcg 600

gacataatca tcgacctcgg cgctgacgac gacgacgaca cgccggagag ggtgctccgg 660

cctgtcgtga ccaggcccgc gaggagggag ctcgactggt gcgagccggc ggaggtgaag 720

cacgtcgacc tcgccgagct gatgacaccg agagcgagct ctgcctctgc ctcctcggag 780

aagagcatca gcacgggcaa gccgaggcgt tcgtccgtgt cgtctcgacg ccgcctcaag 840

acgcgcacca acagcccgcg cctcgccgcg tgcaggaaag gcaagccgac ggcgcgggca 900

acgacgacga cgccgacgca gccgccgctc gcgcacagct tcgcggtggt gaagacgtcg 960

tcggacccga ggagggactt cctcgagtcc atggaggaga tgatcgccga gaacggcatc 1020

cgcgacgccg gcgacctgga ggacctcctc gcctgctacc tctccctcaa ctccggcgag 1080

taccatgacc tcatcgtcga ggtgttcgag caggtctgga ccggcctcgc cgctgcctgt 1140

ggcgtcatgc catga 1155

<210> 2

<211> 384

<212> PRT

<213> Rice (Oryza sativa var.)

<400> 2

Met Gly Arg Arg Lys Phe Arg Leu Ser Asp Met Met Pro Asn Ala Trp

1 5 10 15

Phe Tyr Lys Leu Arg Asp Met Arg Ala Arg Gly Gly Arg Gly Ala Thr

20 25 30

Ala Met Gln Pro Pro Ser Ser Ser Ser Leu Met Arg Gly Ser Arg Ala

35 40 45

Ala Gln Gln Gln Ala Gly Thr Trp Arg Leu Gly Thr Ser Ser Ser Ser

50 55 60

Ser Ser Leu Leu Pro His Arg Ala Ser Tyr Tyr Tyr Thr Thr Arg Asp

65 70 75 80

Arg Glu Val Pro Pro Leu Pro Pro Pro Pro Pro Pro Arg Gly Val Asp

85 90 95

Asp Gln Phe Pro Ser Leu Thr Leu Ser Pro Pro Leu Pro Thr Arg Asn

100 105 110

Ser Arg Arg Arg His Arg Val Gly Arg Phe Gly Ser Thr Glu Met Asp

115 120 125

Gly Gly Glu Leu Val Leu Ala Pro Ser Asp Asp His Asp Gly Cys Ser

130 135 140

His Gln Glu Pro Pro Val Ala Asp Ala Ser Gly Ser Ser Arg Cys Arg

145 150 155 160

Arg Asp Met Phe Ile Gly Arg Asp Gly Gly Arg Gly Val Glu Phe Arg

165 170 175

Arg Arg Ala Thr Thr Val Asp Gly Pro Glu Glu Asp Ala Ala Val Asp

180 185 190

Val Lys Val Ile Thr Ser Asp Ala Asp Ile Ile Ile Asp Leu Gly Ala

195 200 205

Asp Asp Asp Asp Asp Thr Pro Glu Arg Val Leu Arg Pro Val Val Thr

210 215 220

Arg Pro Ala Arg Arg Glu Leu Asp Trp Cys Glu Pro Ala Glu Val Lys

225 230 235 240

His Val Asp Leu Ala Glu Leu Met Thr Pro Arg Ala Ser Ser Ala Ser

245 250 255

Ala Ser Ser Glu Lys Ser Ile Ser Thr Gly Lys Pro Arg Arg Ser Ser

260 265 270

Val Ser Ser Arg Arg Arg Leu Lys Thr Arg Thr Asn Ser Pro Arg Leu

275 280 285

Ala Ala Cys Arg Lys Gly Lys Pro Thr Ala Arg Ala Thr Thr Thr Thr

290 295 300

Pro Thr Gln Pro Pro Leu Ala His Ser Phe Ala Val Val Lys Thr Ser

305 310 315 320

Ser Asp Pro Arg Arg Asp Phe Leu Glu Ser Met Glu Glu Met Ile Ala

325 330 335

Glu Asn Gly Ile Arg Asp Ala Gly Asp Leu Glu Asp Leu Leu Ala Cys

340 345 350

Tyr Leu Ser Leu Asn Ser Gly Glu Tyr His Asp Leu Ile Val Glu Val

355 360 365

Phe Glu Gln Val Trp Thr Gly Leu Ala Ala Ala Cys Gly Val Met Pro

370 375 380

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

taggtagaag aggtacccgg gctctggcct ggcccccca 39

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtaatctccg tcgactctag atggcatgac gccacaggc 39

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgctgcttcg tcaggcttag 20

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgttgggcat catgtcgg 18

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gacatgatgc ccaacgc 17

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaccaaatct cccaaccct 19

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggaattcat gggccggcgg aagttcag 28

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgggatcctc atggcatgac gccacagg 28

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cggaattcat gggccggcgg aagttcag 28

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgggatcctc agctgtgcgc gagcggcg 28

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cggaattcat gttcgcggtg gtgaagac 28

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgggatcctc atggcatgac gccacagg 28

<210> 15

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggaattccat atgcagagca gcagcaagcg 30

<210> 16

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cggaattcct agcctctggt tcgtatg 27

<210> 17

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acgggggacg agctcggtac catgggccgg cggaagttc 39

<210> 18

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cgcgtacgag atctggtcga ctggcatgac gccacaggc 39

<210> 19

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tacgcgtccc ggggcggtac ccagagcagc agcaagcg 38

<210> 20

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

cgaaagctct gcaggtcgac ctagcctctg gttcgtatg 39

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atggggctct cggatgtaga 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

cgatcatagg cgtctcgcat 20

Claims

1. Rice OsOFP22 ^sGene characterized in that said OsOFP22^sThe sequence of the coding region of the gene is shown in SEQ ID NO. 1.

2. The rice OsOFP22 of claim 1^sGene characterized in that said OsOFP22^sThe coded amino acid sequence is shown in SEQ ID NO. 2.

3. A rice OsOFP22 according to claim 1 or 2^sOverexpression recombinant vector pActin-OFP22 of gene^s-3Flag, characterized in that said pActin-OFP22^s-3Flag comprises OsOFP22^sThe gene and the vector are plant binary expression vectors pActin-3 Flag.

4. The overexpression recombinant vector pActin-OFP22 of claim 3^s-3Flag, characterized in that said method is as follows:

the plant binary expression vector pActin-3Flag is double digested by Sam I and Xba I, and the digested vector is combined with a vector containing OsOFP22 by using homologous recombinase^sAnd connecting PCR amplification products of the full-length cDNA of the gene.

5. The overexpression recombinant vector pActin-OFP22 of claim 4^s-3Flag, characterized in that it comprises OsOFP22^sThe PCR amplification method of the full-length cDNA of the gene comprises the following steps:

。

6. The rice OsOFP22 of claim 1 or 2 ^sThe gene is applied to the aspects of increasing the grain length and thousand grain weight of rice and improving the content of amylose.

7. The application according to claim 6, characterized in that the method of application is as follows: using said rice OsOFP22^sThe gene sequence constructs a recombinant vector which can be over-expressed in rice, and transforms agrobacterium, then the vector is transformed into rice callus by using an agrobacterium-mediated rice genetic transformation method, and the rice callus is transformed into a rice plant after resistance screening and tissue culture.

8. Use according to claim 7, characterized in thatCharacterized in that the recombinant vector overexpressed in rice is the overexpressed recombinant vector pActin-OFP22 of claim 3^s-3Flag。

9. The use according to claim 8, characterized in that the method of application is as follows:

(1) construction of engineering bacteria: coupling pActin-OFP22^sThe-3 Flag vector is transformed into an agrobacterium strain EHA105 by an electric shock method, and screened by kanamycin and rifampicin to obtain pActin-OFP22^s-3 agrobacteria of Flag vector;

(2)pActin-OFP22^s-3, transforming rice callus by using Flag vector and obtaining rice regeneration seedlings: using a probe containing pActin-OFP22^sInfecting the rice callus by EHA105 of a Flag carrier, co-culturing for 3 days in a culture room at 28 ℃, washing away agrobacterium by using a liquid culture medium, and culturing the rice callus on a screening culture medium containing a proper antibiotic; after two times of culture, resistant callus can be obtained, the resistant callus is transferred to a differentiation culture medium to carry out differentiation culture to obtain plantlets, the differentiated plantlets are transferred to a rooting culture medium to be cultured, and then the plantlets are transplanted after hardening.