CN111434679A - Application of plant type related protein in regulation and control of plant type - Google Patents

Abstract

The invention discloses application of plant type related protein in regulation and control of plant types. The plant type related protein disclosed by the invention is A1), A2) or A3) as follows: A1) the amino acid sequence is the protein of sequence 3; A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3 in the sequence table and has the same function; A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2). The protein has the function of regulating the plant type of the plant, can be used for preparing products for regulating the plant type of the plant, and is further used for plant breeding.

Description

Application of plant type related protein in regulation and control of plant type

Technical Field

The invention relates to the application of plant type related protein in regulating plant type in the field of biotechnology.

Background

Rice is an important grain crop in China, and the yield of the rice is directly related to the national grain safety and economic development. The rice yield is closely related to the planting density, photosynthetic efficiency and grain size of rice. The leaf angle of rice refers to the angle between a leaf and a stalk where the leaf is located, and is also an important factor influencing the plant type and yield of the rice. Plants with smaller leaf angles have a more compact plant type, which is beneficial to the efficiency of the plants for acquiring sunlight, so that the increase of photosynthetic efficiency leads to the increase of biomass. Meanwhile, the compact plant type is also beneficial to reasonable close planting, and the problem that the cultivated area is gradually reduced can be relieved to a great extent.

The regulatory mechanisms of rice leaf angle are mostly related to phytohormones, especially Brassinosteroids (BR), in addition, there are several non-hormone related regulatory pathways (L AX, OsAGO7, I L a1, etc.).

The rice leaf angle regulation mediated by BR pathway mainly relates to BR synthesis pathway and BR signal pathway, BR synthesis deletion mutants such as dwerf 4-1, D2, D11 and brd1 all have leaf angles obviously smaller than wild type thereof, and BR signal pathway defects can also cause the rice leaf angle to be reduced, such as D61-1, D61-2 and dlt, on the contrary, BR synthesis or signal enhancement can cause the rice leaf angle to be increased, such as mutant strain m107 of over-expression BR synthesis gene D11, transgenic strain Gi-2 of knocking out negative regulator of BR signal and transgenic plant of over-expression BR signal factor I L I1.

In the auxin regulation way, OsIAA1 overexpression plants can show a phenotype of increased leaf angle, and overexpression OsARF19 can also cause the increase of the leaf angle, in the gibberellin regulation way, the reduction of the expression of OsGSR1 can show a phenotype similar to BR deficiency, OsSPY serving as a negative regulation factor of the gibberellin way can play a positive regulation function in regulating the leaf angle of rice, the hormone regulation ways are also more or less related to BR, the overexpression plants of OsIAA1 show enhanced BR perception, the RNAi plants of OsGSR1 can cause the reduction of the content of endogenous BR, OsSPY can influence the signal transmission of gibberellin by influencing DE LL A protein S L R, and the rice DE LL A protein S L R can also interact with BR signal factor OsBZR1 to influence the approach of rice.

Sakamoto et al, 2006, reported that the BR related mutant dwarf4-1 could increase rice yield per mu by as much as 30% under reasonable close planting conditions. Morinaka et al, 2006 reported that slightly down-regulating the BR signal receptor gene OsBRI1 could increase rice yield by about 35%. It shows that the BR-mediated regulation of rice plant type has important effect on rice yield.

Disclosure of Invention

The invention aims to solve the technical problem of how to regulate and control the plant type of a plant.

In order to solve the technical problems, the invention firstly provides any one of the following applications of the plant-type related protein or the substance for regulating the activity or the content of the plant-type related protein:

D1) regulating and controlling plant types of plants;

D2) preparing a plant type regulating product;

D3) regulating and controlling the included angle of plant leaves;

D4) preparing a product for regulating and controlling the included angle of plant leaves;

D5) cultivating plants with reduced leaf angle;

D6) plant breeding;

the plant type related protein is derived from rice (Oryza sativa) and is named as POW1 and is A1), A2) or A3:

A1) the amino acid sequence is the protein of sequence 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

In order to facilitate the purification of the protein of A1), the amino terminal or the carboxyl terminal of the protein consisting of the amino acid sequence shown in sequence 1 in the sequence listing may be labeled as shown in the following table.

Table: sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The POW1 protein in A2) above is a protein having 75% or more identity to the amino acid sequence of the protein shown in SEQ ID NO. 3 and having the same function. The identity of 75% or more than 75% is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

The POW1 protein in A2) above may be artificially synthesized, or may be obtained by synthesizing the encoding gene and then performing biological expression.

The gene encoding the POW1 protein in A2) above can be obtained by deleting one or several amino acid residues from the DNA sequence shown in SEQ ID NO. 2, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching a coding sequence of the tag shown in the above table to the 5 'end and/or 3' end thereof. Wherein, the DNA molecule shown in the sequence 2 encodes POW1 protein shown in the sequence 3.

The invention also provides any one of the following applications of the biological material related to the POW1 protein:

D1) regulating and controlling plant types of plants;

D2) preparing a plant type regulating product;

D3) regulating and controlling the included angle of plant leaves;

D4) preparing a product for regulating and controlling the included angle of plant leaves;

D5) cultivating plants with reduced leaf angle;

D6) plant breeding;

the biomaterial is any one of the following B1) to B22):

B1) a nucleic acid molecule encoding a POW1 protein;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic plant cell line comprising the nucleic acid molecule of B1);

B10) a transgenic plant cell line comprising the expression cassette of B2);

B11) a transgenic plant cell line comprising the recombinant vector of B3);

B12) a transgenic plant cell line comprising the recombinant vector of B4);

B13) transgenic plant tissue comprising the nucleic acid molecule of B1);

B14) transgenic plant tissue comprising the expression cassette of B2);

B15) transgenic plant tissue containing the recombinant vector of B3);

B16) transgenic plant tissue containing the recombinant vector of B4);

B17) a transgenic plant organ containing the nucleic acid molecule of B1);

B18) a transgenic plant organ containing the expression cassette of B2);

B19) a transgenic plant organ containing the recombinant vector of B3);

B20) a transgenic plant organ containing the recombinant vector of B4);

B21) a nucleic acid molecule which reduces the expression level of the POW1 protein;

B22) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule according to B21).

In the above application, the nucleic acid molecule of B1) may be any one of the following B1) -B5):

b1) the coding sequence is cDNA molecule or DNA molecule of sequence 2 in the sequence table;

b2) a cDNA molecule or a DNA molecule shown in a sequence 2 in a sequence table;

b3) DNA molecule shown in sequence 1 in the sequence table;

b4) a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in b1) or b2) or b3) and encoding a POW1 protein;

b5) a cDNA molecule or a genomic DNA molecule which hybridizes with the nucleotide sequence defined by b1) or b2) or b3) or b4) under strict conditions and codes for a POW1 protein;

B21) the nucleic acid molecule is shown as the 1041-171 site of the sequence 2 in the sequence table.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the POW1 protein of the invention can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of the POW1 protein isolated in the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the POW1 protein and have the function of the POW1 protein.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 3 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

In the above application, the stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO₄Hybridizing with 1mM EDTA, rinsing in2 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridizing with 1mM EDTA, rinsing in1 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridizing with 1mM EDTA, rinsing in 0.5 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridizing with 1mM EDTA, rinsing in 0.1 × SSC, 0.1% SDS at 50 deg.C, 7% SDS, 0.5M NaPO at 50 deg.C₄Hybridization with 1mM EDTA in a mixed solution, rinsing in 0.1 × SSC, 0.1% SDS at 65 ℃, or hybridization in 6 × SSC, 0.5% SDS at 65 ℃ followed by washing once with 2 × SSC, 0.1% SDS, 1 × SSC, 0.1% SDS, or hybridization and washing 2 times for 5min at 68 ℃ in2 × SSC, 0.1% SDS, and again in 0.5 × SSC,0.The membrane was hybridized and washed 2 times for 15min at 68 ℃ in a solution of 1% SDS, or in a solution of 0.1 × SSPE (or 0.1 × SSC) and 0.1% SDS at 65 ℃.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

For the above applications, the expression cassette containing a nucleic acid molecule encoding a POW1 protein (POW1 gene expression cassette) described in B2) means a DNA capable of expressing a POW1 protein in host cells, which DNA may include not only a promoter for promoting transcription of a POW1 gene but also a terminator for terminating transcription of a POW1 gene further, the expression cassette may further include an enhancer sequence the promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue-, organ-and development-specific promoters, and inducible promoters, examples of promoters include, but are not limited to, a constitutive promoter of cauliflower mosaic virus 35S, a wound-inducible promoter from tomato, leucine aminopeptidase ("L AP", Chao et al (1999) Plant Physiol 120: 979-992), a chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (promoters of salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester) inducible promoter), a promoter of a DNA synthase II (SBA) or a promoter of a DNA sequence capable of inducing transcription of a DNA sequence from a DNA sequence of a DNA sequence encoding a POW1 protein, such as described in a promoter of a DNA sequence encoding a POW1 (see, a promoter of a DNA sequence of a promoter of a DNA encoding a POW1, such as a DNA sequence of a promoter including, such as a promoter of a cauliflower mosaic virus including, a promoter of a⁹⁸⁵) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.Genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant vector containing the POW1 gene expression cassette can be constructed by using an existing expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA Corp.), etc. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound capable of producing a color change (GUS gene, luciferase gene, etc.), a marker gene for antibiotics (e.g., nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to phosphinothricin as an herbicide, hph gene conferring resistance to hygromycin as an antibiotic, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or a marker gene for chemical resistance (e.g., herbicide resistance), a mannose-6-phosphate isomerase gene providing the ability to metabolize mannose, which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above application, the vector may be a plasmid, a cosmid, a phage, or a viral vector. The plasmid may specifically be vector pZH2B or vector pZH2 Bi.

B3) The recombinant vector can be specifically pZH2B-POW1, the pZH2B-POW1 is a recombinant vector obtained by replacing a DNA fragment between XbaI and KpnI-HF recognition sequences of the vector pZH2B with a genome sequence of a POW1 gene shown in a sequence 1 in a sequence table, and pZH2B-POW1 can express a POW1 protein shown in a sequence 3 in the sequence table.

B22) The recombinant vector can be pZH2Bi-POW1-RNAi, wherein pZH2Bi-POW1-RNAi is a recombinant vector obtained by inserting a DNA fragment shown in the 1041-th and 1271-th positions of the sequence 2 in the sequence table into the vector pZH2Bi by using a restriction enzyme XbaI, and inserting a DNA fragment shown in the 1041-th and 1271-th positions of the sequence 2 in the sequence table into the vector pZH2Bi by using a restriction enzyme SpeI-HF, and the directions of two insertions of the DNA fragment shown in the 1041-th and 1271-th positions of the sequence 2 in the sequence table are opposite in the vector pZH2 Bi. pZH2Bi-POW1-RNAi can be used for inhibiting the expression of POW1 protein coding gene. .

In the above application, the microorganism may be yeast, bacteria, algae or fungi. Wherein the bacteria can be Agrobacterium, such as Agrobacterium EHA 105.

In the above application, the transgenic plant cell line, the transgenic plant tissue and the transgenic plant organ do not comprise propagation material.

In the above application, the plant may be m1) or m2) or m 3):

m1) a monocotyledonous or dicotyledonous plant;

m2) a gramineous plant;

m3) rice.

The invention also provides a product for regulating plant type, which contains the POW1 protein or the biological material.

The plant type can be embodied on the leaf angle.

The product can be specifically a product for reducing the included angle of plant leaves.

The product can use POW1 protein or the biological material as the active component, and can also use POW1 protein or the biological material and other substances with the same function as the active component.

In the above product, the plant may be m1) or m2) or m 3):

m1) a monocotyledonous or dicotyledonous plant;

m2) a gramineous plant;

m3) rice.

The invention also provides a method for reducing the included angle of plant leaves, which comprises the following steps: increasing the activity and/or content of the POW1 protein in a receptor plant, or promoting the expression of a coding gene of the POW1 protein to obtain a target plant with reduced leaf angle compared with the receptor plant.

The invention also provides a method for cultivating plants with reduced leaf included angles, which comprises the following steps: increasing the activity and/or content of the POW1 protein in a receptor plant, or promoting the expression of a coding gene of the POW1 protein to obtain a target plant with reduced leaf angle compared with the receptor plant.

In the above method, the plant of interest may be a transgenic plant having increased expression of POW1 protein as compared to the recipient plant, which is obtained by introducing a gene encoding POW1 protein into the recipient plant.

In the above method, the gene encoding the POW1 protein may be B1) the nucleic acid molecule.

In the above method, the gene encoding the POW1 protein may be modified as follows and then introduced into a recipient plant to achieve a better expression effect:

1) modifying and optimizing according to actual needs to enable the gene to be efficiently expressed; for example, the codon of the gene encoding the POW1 protein of the present invention may be changed to conform to the preference of plants while maintaining the amino acid sequence thereof according to the preference of the plant of interest; during the optimization, it is desirable to maintain a GC content in the optimized coding sequence to best achieve high expression levels of the introduced gene in plants, wherein the GC content can be 35%, more than 45%, more than 50%, or more than about 60%;

2) modifying the sequence of the gene adjacent to the initiating methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants;

3) linking with promoters expressed by various plants to facilitate the expression of the promoters in the plants; such promoters may include constitutive, inducible, time-regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space requirements of expression, and will also depend on the target species; for example, tissue or organ specific expression promoters, depending on the stage of development of the desired receptor; although many promoters derived from dicots have been demonstrated to be functional in monocots and vice versa, desirably, dicot promoters are selected for expression in dicots and monocot promoters for expression in monocots;

4) the expression efficiency of the gene of the present invention can also be improved by linking to a suitable transcription terminator; tml from CaMV, E9 from rbcS; any available terminator which is known to function in plants may be linked to the gene of the invention;

5) enhancer sequences, such as intron sequences (e.g., from Adhl and bronzel) and viral leader sequences (e.g., from TMV, MCMV, and AMV) were introduced.

The gene encoding the POW1 protein can be introduced into a recipient plant using a recombinant expression vector containing the gene encoding the POW1 protein. The recombinant expression vector can be specifically the pZH2B-POW 1.

The recombinant expression vector can be introduced into Plant cells by using conventional biotechnological methods such as Ti plasmid, Plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach,1998, Method for Plant molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey,1998, Plant molecular Biology (2nd Edition)).

The transgenic plants are understood to comprise not only the first generation transgenic plants but also their progeny. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The plant of interest includes seeds, callus, whole plants and cells.

In the above method, the recipient plant may be m1) or m2) or m 3):

m1) a monocotyledonous or dicotyledonous plant;

m2) a gramineous plant;

m3) rice.

In the above method, the plant type may be embodied in leaf angle. The leaf included angle can be the included angle between the leaf axis at the base part of the leaf and the stalk where the leaf axis is located.

Experiments prove that the POW1 protein and the coding gene thereof can regulate and control plant types: introducing a coding gene of POW1 protein into a plant, and reducing the leaf angle of the obtained transgenic plant; the expression of the coding gene of the POW1 protein in the plant is inhibited, and the leaf included angle of the obtained transgenic plant is increased. The POW1 protein and its coding gene can be used to regulate plant type, and also can be used to prepare the product for regulating plant type, and further used in plant breeding.

Biological material preservation instructions

Classification nomenclature of biological materials: japonica rice (Oryza sativa subsp. japonica)

Strain number of biological material: pow1

Deposit name of biological material: china general microbiological culture Collection center

The preservation unit of the biological material is abbreviated as: CGMCC (China general microbiological culture Collection center)

Deposit unit address of biological material: west road No.1, north west of the township, beijing, ministry of sciences, china, institute of microbiology, zip code: 100101

Preservation date of biological material: 6 and 12 months in 2018

Accession number to the collection of biological materials: CGMCC No.15452

Drawings

FIG. 1 shows the result of identification of transgenic plants. pow1 represents the pow1 mutant, EV (empty vector) represents the empty vector control plant, and pow1-C represents the positive transgenic plant.

FIG. 2 shows plant phenotype. pow1 represents the pow1 mutant, EV (empty vector) represents the empty vector control plant, and pow1-C represents the positive transgenic plant.

FIG. 3 shows plant phenotype. pow1 represents the pow1 mutant, EV represents the empty vector control plant, and pow1-RNAi represents the RNAi positive transgenic plant.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

Japonica rice (Oryza sativa subsp. japonica) pow1 is a mutant obtained by treating an air-cultivated rice variety 131(KY131) of northeast China cultivated rice with sodium azide by an inventor, and is marked as a pow1 mutant, and the air-cultivated rice variety 131(Oryza sativa L. ssp. japonica) is disclosed in the document "Donglong, Hoplongjun, Pandaling, and the influence of different densities of Huangyufu-air-cultivated 131 on yield relationship", which is published in agricultural and technical No. 2008 5 ", the public can obtain from the institute of genetics and developmental biology, the pow1 mutant is deposited in China general microbiological culture Collection center (CGMCC; the address: Beijing Nakan microbial Collection No.1 of Beijing area, institute of sciences; the accession number: 154101) and is No. 52.

Example 1 POW1 Gene and its encoded protein can regulate rice leaf angle

The embodiment provides a gene which is derived from rice (Oryza sativa) empty-breeding 131 and codes plant type related protein and the coded protein thereof, wherein the name of the gene is POW1 gene, the genome sequence of the gene in the rice empty-breeding 131 is sequence 1 in a sequence table, the coding sequence is sequence 2 in the sequence table, and POW1 protein is shown as coding sequence 3. The POW1 gene and the POW1 protein coded by the gene can regulate and control the leaf angle of rice, and the specific detection method comprises the following steps:

1. constructing a recombinant vector:

PCR was carried out using primers Com-XbaI-F: tctagaGCCCAGAGACCATAGGTGGAGACT and Com-KpnI-R: ggtaccGCTCGTGCGTGCATGGGCCTTA using genomic DNA of wild type KY131 as a template, and the obtained PCR product with the correct sequence was ligated into intermediate vector pEASY (Beijing holotype gold organism, cat # CB101-01) to obtain a recombinant, and then the plasmid was digested with restriction enzymes XbaI (NEB, # R0145V) and KpnI-HF (NEB, # R3142V) to obtain a DNA fragment having a cohesive end, and the DNA fragment was ligated with vector pZH2B (Song, L., Wang, R, Zhang, L., Wang, Y., and Yao, S. (2016) (CRR 1encoding calcose synthase) in sequences of amplification coding plasmid vector in sequence attached to plasmid vector 5827, and the DNA fragment was ligated with the vector DNA fragment represented by KpnI-DNA 468, plasmid DNA sequence No. P-III-P358, DNA fragment was ligated with the vector DNA fragment represented by plasmid DNA 468, DNA sequence of plasmid DNA sequence No. KR, strain 468, and DNA sequence No. KR-K-DNA, and DNA fragment was ligated into the plasmid vector No. DNA sequence of plasmid vector 468, which was ligated to obtain recombinant DNA fragment represented by plasmid DNA-K-DNA, and ligated to obtain a plasmid vector, and ligated to.

2. Obtaining of transgenic plants:

introducing pZH2B-POW1 obtained in the step 1 into agrobacterium EHA105, infecting callus induced by embryo of POW1 mutant by using the obtained recombinant agrobacterium, and redifferentiating the infected callus on a hygromycin-containing culture medium to obtain a plant, namely a transgenic plant of the POW1 gene.

According to the method, pZH2B-POW1 is replaced by the vector pZH2B, and other steps are not changed to obtain an empty vector control plant.

3. Identification of transgenic plants:

and (3) carrying out PCR amplification on the genome DNA of the transgenic plant obtained in the step (2) by utilizing POW1-MS-F and POW1-MS-R, carrying out enzyme digestion on an obtained PCR product by using a restriction enzyme StuI (NEB, # R0187V), carrying out electrophoresis, and determining whether the transgenic plant is a positive transgenic plant or not according to the size of the obtained fragment. Wild type KY131, pow1 mutant and empty vector control plants were used as controls. The primer sequences are as follows:

POW1-MS-F:AGCTTTAATGCTAGGCAGAAGGCT

POW1-MS-R:TTAGATTTGAAGATATCCTGTAATG

the results show that the wild KY131(WT) and the pow1 mutant have different band types and the empty vector control plant has the same band type, the pow1 mutant and the empty vector control plant have the same band type, and the transgenic plant containing the specific bands of the wild KY131 and the pow1 mutant is a positive transgenic plant (figure 1). The obtained positive transgenic plant is subjected to PCR amplification on the genome DNA of the positive transgenic plant by using a primer pair consisting of Com-XbaI-F and Com-KpnI-R, and the result shows that the sequence of the obtained PCR product contains the correct genome sequence of the POW1 gene.

4. Phenotypic identification of transgenic plants

Seeds of the positive transgenic plants are harvested and planted in the field, the leaf included angle (namely the included angle between the leaf axis at the base of the leaf and the stem where the leaf axis is located) is determined after complete heading, wild KY131(WT), pow1 mutant and empty carrier control plants are used as controls, and the results are shown in Table 1 and figure 2.

TABLE 1 leaf Angle measurement results (. degree.)

The results show that there is no significant difference in leaf angle between the empty vector control plant and the pow1 mutant, and compared with the empty vector control plant and the pow1 mutant, the leaf angle of the positive transgenic plant is significantly reduced, the plant is more compact, and there is no significant difference in leaf angle between the wild type KY131 and the positive transgenic plant. The POW1 gene and the protein coded by the gene can regulate the leaf angle of rice.

Example 2 POW1 Gene can regulate the leaf angle of rice

1. Constructing a recombinant vector:

PCR is carried out by using primers POW1-RNAi-XbaI-F: tctagaGCAGAAGGCTGCAAGAACGCTTG and POW1-RNAi-SpeI-R: actagt ACTTGCTCGCACTTCTCTT and cDNA of wild-type KY131 as a template, the obtained PCR product with correct sequence is connected with an intermediate vector pEASY (Beijing holotype gold organism, cat # 101-01), after obtaining recombinants, restriction endonucleases XbaI (NEB, # R0145V) and SpeI-HF (NEB, # R3V) are respectively used for enzyme digestion, and then are inserted into pZH2Bi vector twice (Song, L., Wang, R., Zhang, L, Way, Yang, S. (2016) sequence table R1encoding calophyllostinescence funotionals in sequence table in sequence listing R1encoding restriction endonuclease fusion polypeptides in vitro fusion by using the corresponding restriction endonuclease sequence insert DNA of the plasmid DNA 4624, which is inserted into the plasmid DNA of the plasmid DNA strain 1048-4646, strain 4624, the plasmid DNA which is inserted into the plasmid DNA equivalent to obtain the plasmid DNA which is inserted into the plasmid DNA of plasmid DNA strain 1048-465, the plasmid DNA which is inserted into the plasmid DNA equivalent sequence of the plasmid DNA strain 10424, which is used for inhibiting expression of the RNAi-DNA equivalent sequence of the plasmid DNA strain 1048, strain, the plasmid DNA equivalent sequence which is inserted twice, the plasmid DNA equivalent sequence of the plasmid DNA equivalent sequence No. 1048, the plasmid DNA equivalent sequence No. 1048, No. 7, No. 1.

2. Obtaining of transgenic plants:

introducing pZH 2-2 Bi-POW1-RNAi obtained in the step 1 into agrobacterium EHA105, infecting callus induced by wild KY131 embryo with the obtained recombinant agrobacterium, and redifferentiating the infected callus on a hygromycin-containing culture medium to obtain a plant, namely a transgenic plant of POW 1-RNAi.

According to the method, pZH2Bi-POW1-RNAi is replaced by the vector pZH2Bi, and other steps are not changed to obtain an empty vector control plant.

3. Identification of transgenic plants:

extracting total RNA of various materials, detecting the expression level of POW1 in the various materials by utilizing a qRT-PCR method, extracting the total RNA by adopting a trizol extraction method, namely burning tweezers, scissors and blades required by sampling by using alcohol lamp flame before sampling, taking down the materials used for extracting the RNA, putting the materials into tin foil paper, wrapping the materials, quickly putting the materials into liquid nitrogen for quick freezing, transferring a sample without immediately extracting the RNA into an ultra-low temperature refrigerator at minus 80 ℃ for standby, fully grinding a proper amount of tissues into powder in a mortar, adding 1m L trizol extracting solution, quickly rotating the mortar rod to enable the trizol to fully cover plant tissues, fully grinding mixed liquor to be clear and transparent by the mortar rod after melting, transferring grinding liquor into 1.5m L of RNase-free, standing at room temperature for 5min, standing at 4 ℃, centrifuging for 5min at 12,000rpm, transferring supernatant into a new centrifuge tube, adding one fifth volume of chloroform, standing for 5min at room temperature after 15s, standing at 4 ℃, 12,000rpm, transferring supernatant into a new centrifuge tube, centrifuging 5min at room temperature, discarding supernatant, adding 10 rpm, adding 10% of supernatant of soft agarose, adding 10% of supernatant, washing gel at room temperature, adding 30,000, drying, adding 30 mu of DE000, adding supernatant, performing reverse transcription, and performing electrophoresis, and using equal volume of PCR, and removing supernatant, and drying, and adding 30 mu g of supernatant, and using equal volume of PCR to obtain supernatant, and using equal volume, and drying the supernatant, wherein the supernatant, and performing.

First strand cDNA Synthesis by measuring RNA concentration with a Nanodrop apparatus, taking 1. mu.g of total RNA, digesting with 1. mu. L DNaseI (thermo scientific) at 37 ℃ for 30min, heating at 70 ℃ for 10min to denature DNase I, then placing on ice, adding reagents required for reverse transcription according to the amount of a Promega reverse transcription kit, incubating at 42 ℃ for 1h, denaturing at 95 ℃ for 5min, immediately placing the reaction system on ice, separating the first strand cDNA from the RNA template, adding four times the volume of sterilized ultrapure water, and storing at-20 ℃ for later use.

qRT-PCR detection analysis: adding Roche SYBR Green Master I enzyme premix and qRT primer to the first strand cDNA as template, and using Roche

The Nano instrument performs PCR. PThe reaction conditions for CR were: 5min at 94 ℃; 5s at 94 ℃; the annealing temperature (55-60 ℃) of the corresponding primer is 15 s; 10s at 72 ℃; 45 cycles, and OsActin1 of rice is used as an internal reference gene.

The primer sequence of the reference gene is as follows:

ACTIN-Q-F：TGCTATGTACGTCGCCATCCAG；

ACTIN-Q-R：AATGAGTAACCACGCTCCGTCA。

qRT-PCR detection the RNA levels of POW1 were analyzed using the primers:

POW1-Q-F：CGCTTGGACCAAGAGCACTG；

POW1-Q-R：GCTCGGCAACTTGTTCTTATCAG。

and selecting the plants with the expression quantity more than 3 times lower than that of the wild plants as positive transgenic plants for further phenotypic identification.

4. Phenotypic identification of transgenic plants

Seeds of the positive transgenic plants are harvested and planted in the field, the leaf angle is measured after complete heading, wild KY131(WT), pow1 mutant and empty carrier control plants are used as controls, and the results are shown in Table 2 and figure 3.

TABLE 2 leaf Angle measurement results (. degree.)

The result shows that the leaf included angle between the positive transgenic plant and the pow1 mutant is not obviously different; the leaf included angle between the empty carrier control plant and the wild KY131 is not obviously different; compared with the empty vector control plant and the wild KY131, the leaf included angle of the positive transgenic plant is obviously increased, which indicates that the leaf included angle of the rice can be increased by inhibiting the expression of the POW1 gene. The POW1 gene and the protein coded by the gene can regulate the leaf angle of rice.

<110> institute of genetics and developmental biology of Chinese academy of sciences

Application of <120> plant type related protein in regulation and control of plant type

<160>3

<170>PatentIn version 3.5

<210>1

<211>4586

<212>DNA

<213> Rice (Oryza sativa)

<400>1

gcccagagac cataggtgga gactgaaatt tacaaatttg caaactattt gctactctta 60

taagtggtaa ataagaattt gtcactggac acacatgtta tagacggtaa gtcgcaaatt 120

cttaattgcc gcgtcttaaa agtggcaaaa ggttaaatgc ccctgttttg ataccaattg 180

aattttctca aatactacat tcgtccaata taaattgtaa ttctaatttg tttagcatat 240

attaaggttt gagtagaaag actataatgt ctcttattaa atggtgtata ggtaagagtg 300

aaatggtagt tgaggataaa ataggaagaa atttaaatga aaagtgatta atgagatctt 360

tagtactcta ttgtaacaat tattttggga caaattcaaa tcctaaaaat acaattattt 420

tgggatagag gtagtaaaaa aaaaacagag aaacctatac taaaacttaa agaacttctt 480

tggcatgaag caatattatg aaaattttag aggaactgag ccatttcgtg tgaaaattag 540

tcgaagttca tgcgtctcaa aaggagccct tgtcatttcg ttgcatttag tttccagtat 600

taattttgtt gtaagagcat gttaatttga ttgttctttc ctaattccta ttagaattaa 660

ttagtgctaa tgtatgaaac aatcttttaa caacaataat atgaattagc caattgtaaa 720

agtttctatt ctatatatat tgttagatca tttttatcta tcgatagatt gcttcctagt 780

ctctactgcg tattgtttct tagtatgggc cgcaaaagaa agtgtgttag taatatcttt 840

tagtcgtaaa atttggggta tacaagtcac acagtttgag ttacatgtaa aagtttacta 900

atttcattca agaatgagtt tattaattgt tttggagtgg tcttaatttt atcattctgt 960

aaagaaatgg aatatgaaac ttcatacacc acatgcaaaa ttaaatttat agtcagggta 1020

cacagatagg ccgggcttat tgttttgggc cggcctactt taaacatata tctttaaaga 1080

tagatcggga acgttaattt cataacaggt agttaatcaa cggtgtcgat agtgggggca 1140

aggataatta gggtttatga taggtcatcc tatatataca tgctatggac ggcgccacac 1200

acgagtaaac aaaaccaagg taaacgataa ggtctatgat agatctcacc atacaaaatc 1260

gatagaagag ctagtcgtgt gcaaaggtga agaaactaag aacaggtaag atctttttct 1320

tttttatcaa gatgaaagtt agatattatt tgttttgttg aaaagtattagaagatttag 1380

gatttttgat tcagcgaata cataaaacta agaacatgta aggtgtcttt ctttcttact 1440

gagatggaag taatatatat ttgttttgtt gaaatgaact agaaaaaaat agatttagga 1500

ttctgattca gcgcttgaaa aactaaacta aaatcaacaa aaggacttct tttcacttct 1560

tttcttttat cttgttttgt tgaaatctaa tagataattt aagtttagga ttcgggtctg 1620

gcgggtatga aaaactaaaa acatatagga tctctctttt ctattgagat gaaaataaaa 1680

tttcatttgt tatattgaaa tgtaggagaa atttagggtt ccaacatagc aaacacaaaa 1740

aactaactct ttcattcttt ttaaccagat ggaagtaaac attcatttgg ttttgttgat 1800

atgtacttac ttactccatc ataaaacatt ctagcaattt ctagctatgc atttgaactt 1860

tatccttaat ttgttttatg aaatttttga gaaaatttag attttggatt ccgatctagc 1920

aaatgcgaaa acctaagaaa tctctttcat tttttatcga gatggaaaga aaattttatt 1980

tttgttttgt tgaaatgcaa cactattact tcaatccaca aatataggag taataatttt 2040

caggtatgta tctggatata ttcttatcta tatacatgac agtgcccaga aagttattag 2100

actgaattcc ttttttactg agatgaaatc aaagattcca tttgccccaa aaaaattact 2160

taaaaaaatg gatttacact agcaagtatt aaaaatcctc catatatagg agagatggag 2220

aagaaaacca aaaagaagaa ccctagcaag agggggagaa aaagaggagg aagaggggag 2280

ggaagggaga agaaagtgga ggagatcagc agcagcagca gcagccgcgg ccgcggccgc 2340

cggaggatgg cgccggtgaa gaagtccaag aaagggaagc gcaagtccaa ggactccggc 2400

aagctcaaga tcgtcaagta tggcggcggc gcccctcccc tcccccccga gctccgcggc 2460

ctcgacaccg agtggtggta caccttcctc cacaagcact ccgagctagg tatcgcttgt 2520

tccttcccaa gatttggtgc ggtcgacgat tctttaggtt gattgattgt ttcggcgtga 2580

tattccaatc ttgcaattcc aatctaggtc tgagcgcgcc gtcagatgag ggggaggcgt 2640

tcaggtattt cttcaggacg tcgaggagga cgttcgacta catctgctcg attgtgaggg 2700

aggatttgat ctctaggccg ccgtcagggc tgatcaacat cgaggggagg ctgctcagtg 2760

tggagaagca ggtggcgatt gccatgagga ggctggcgtc gggcgattcg caggtgtcgg 2820

tgggggcggc ttttggtgtc gggcagtcca ccgtctcgca ggtgacttgg aggttcatcg 2880

agtcgatgga agagcgggct cggcatcatc tggtgtggcc cgggcaggag aggatggagc 2940

agatcaaggc gaggttcgag gccgagtccg gtctgccgaa ttgttgcggc gccatcgatg 3000

cgacccacat tatcatgacg cttcctgctg tcgagtcgtc tgaggattgg tgcgacccgg 3060

cgaagaatta cagcatgttc ctgcagggga ttgttgatga tgagatgagg tttattgata 3120

ttgtcactgg ttggcctggc agcatgatgt tttcgcggtt gctgaagtgc tctgggtttt 3180

tcaagcactg cgatgctggg actcgcttgg atggccctgt catggtttca gcagagaatg 3240

gagaaatcag ggagtacatt gttggtaaca attgttatcc tttactccca tggcttatga 3300

ctccctatga aggggagagt ctgtctgctc caatggccag ctttaatgct aggcagaagg 3360

ctgcaagaac gcttggacca agagcactgt cacggctgaa gggctcctgg aggatcttaa 3420

acaaagtcat gtggaggcct gataagaaca agttgccgag cataattctt gtctgctgtt 3480

tgcttcacaa tataatcata gactgtgaag acgaactgct tccagatgta caacttccag 3540

atcaccatga tactggttat agtgaagaga agtgcgagca agtggatcct aatggcaaga 3600

taatgagaga tgtcattaca ggatatcttc aaatctaaga agcttcccat tgaacttagc 3660

taagctgact ggcagtactc tggagttgca agaaggcatc tctgttctta tgtttttctc 3720

ctcagttgtc cttgttgtaa tcagacctgc tggtctccat tcggtaaaga ttagcaatga 3780

aataattcag ttaggaatta gctagctcag gagcaaacta tctcttcctt gagttaagga 3840

aaaaatgtta atgtgttcat ggtgatgaca atctccatca ttttgaggta caagatatat 3900

cagtggtcaa ttgctttgaa tgaaggaaat cgcctttaag gagagtagct attcaacttt 3960

gttttataaa tgtttagatt tgcataatat agtaaaactc atgctcgcat gttattaaag 4020

catatccaag aaaaatagta acctatatat gacatgttga gttgagtgaa ctagtcttgg 4080

atgtacatca tctcattttc attttattgc aaggctattg ttttctaaaa tcatacatct 4140

aagtttgacg tgcctggtag tgttttactg aattcctgat gatatttgtg actgcatgat 4200

gttcattctg ttttgttgat ttactatttt tttgaagatg atgtggtatc ttgttttgtt 4260

gcaagtgctt tatgtgtaat tatatctggg ctcgatgtaa aactggttgc ataatggtta 4320

taaatcttgt ccatgtaaaa ctgtttcccc tcaaaaacac aagtataatg ttcttaaaga 4380

atgtgattga atatgcttct tctagttcta tgtcttctgg tctgctattt tagtacattt 4440

tctgcagact aatattctgc ccttttttta gggaaaatat tctgccattt tgggttggct 4500

tacctacaga ttcccggaaa ggctaattcg cgcgtacgcg ttggcggcgc gcacgctggc 4560

ccactaaggc ccatgcacgc acgagc 4586

<210>2

<211>1326

<212>DNA

<213> Rice (Oryza sativa)

<400>2

atggagaaga aaaccaaaaa gaagaaccct agcaagaggg ggagaaaaag aggaggaaga 60

ggggagggaa gggagaagaa agtggaggag atcagcagca gcagcagcag ccgcggccgc 120

ggccgccgga ggatggcgcc ggtgaagaag tccaagaaag ggaagcgcaa gtccaaggac 180

tccggcaagc tcaagatcgt caagtatggc ggcggcgccc ctcccctccc ccccgagctc 240

cgcggcctcg acaccgagtg gtggtacacc ttcctccaca agcactccga gctaggtctg 300

agcgcgccgt cagatgaggg ggaggcgttc aggtatttct tcaggacgtc gaggaggacg 360

ttcgactaca tctgctcgat tgtgagggag gatttgatct ctaggccgcc gtcagggctg 420

atcaacatcg aggggaggct gctcagtgtg gagaagcagg tggcgattgc catgaggagg 480

ctggcgtcgg gcgattcgca ggtgtcggtg ggggcggctt ttggtgtcgg gcagtccacc 540

gtctcgcagg tgacttggag gttcatcgag tcgatggaag agcgggctcg gcatcatctg 600

gtgtggcccg ggcaggagag gatggagcag atcaaggcga ggttcgaggc cgagtccggt 660

ctgccgaatt gttgcggcgc catcgatgcg acccacatta tcatgacgct tcctgctgtc 720

gagtcgtctg aggattggtg cgacccggcg aagaattaca gcatgttcct gcaggggatt 780

gttgatgatg agatgaggtt tattgatatt gtcactggtt ggcctggcag catgatgttt 840

tcgcggttgc tgaagtgctc tgggtttttc aagcactgcg atgctgggac tcgcttggat 900

ggccctgtca tggtttcagc agagaatgga gaaatcaggg agtacattgt tggtaacaat 960

tgttatcctt tactcccatg gcttatgact ccctatgaag gggagagtct gtctgctcca 1020

atggccagct ttaatgctag gcagaaggct gcaagaacgc ttggaccaag agcactgtca 1080

cggctgaagg gctcctggag gatcttaaac aaagtcatgt ggaggcctga taagaacaag 1140

ttgccgagca taattcttgt ctgctgtttg cttcacaata taatcataga ctgtgaagac 1200

gaactgcttc cagatgtaca acttccagat caccatgata ctggttatag tgaagagaag 1260

tgcgagcaag tggatcctaa tggcaagata atgagagatg tcattacagg atatcttcaa 1320

atctaa 1326

<210>3

<211>441

<212>PRT

<213> Rice (Oryza sativa)

<400>3

Met Glu Lys Lys Thr Lys Lys Lys Asn Pro Ser Lys Arg Gly Arg Lys

1 5 10 15

Arg Gly Gly Arg Gly Glu Gly Arg Glu Lys Lys Val Glu Glu Ile Ser

20 25 30

Ser Ser Ser Ser Ser Arg Gly Arg Gly Arg Arg Arg Met Ala Pro Val

35 40 45

Lys Lys Ser Lys Lys Gly Lys Arg Lys Ser Lys Asp Ser Gly Lys Leu

50 55 60

Lys Ile Val Lys Tyr Gly Gly Gly Ala Pro Pro Leu Pro Pro Glu Leu

65 70 75 80

Arg Gly Leu Asp Thr Glu Trp Trp Tyr Thr Phe Leu His Lys His Ser

85 90 95

Glu Leu Gly Leu Ser Ala Pro Ser Asp Glu Gly Glu Ala Phe Arg Tyr

100 105 110

Phe Phe Arg Thr Ser Arg Arg Thr Phe Asp Tyr Ile Cys Ser Ile Val

115 120 125

Arg Glu Asp Leu Ile Ser Arg Pro Pro Ser Gly Leu Ile Asn Ile Glu

130 135 140

Gly Arg Leu Leu Ser Val Glu Lys Gln Val Ala Ile Ala Met Arg Arg

145 150 155 160

Leu Ala Ser Gly Asp Ser Gln Val Ser Val Gly Ala Ala Phe Gly Val

165 170 175

Gly Gln Ser Thr Val Ser Gln Val Thr Trp Arg Phe Ile Glu Ser Met

180 185 190

Glu Glu Arg Ala Arg His His Leu Val Trp Pro Gly Gln Glu Arg Met

195 200 205

Glu Gln Ile Lys Ala Arg Phe Glu Ala Glu Ser Gly Leu Pro Asn Cys

210 215 220

Cys Gly Ala Ile Asp Ala Thr His Ile Ile Met Thr Leu Pro Ala Val

225 230 235 240

Glu Ser Ser Glu Asp Trp Cys Asp Pro Ala Lys Asn Tyr Ser Met Phe

245 250 255

Leu Gln Gly Ile Val Asp Asp Glu Met Arg Phe Ile Asp Ile Val Thr

260 265 270

Gly Trp Pro Gly Ser Met Met Phe Ser Arg Leu Leu Lys Cys Ser Gly

275 280 285

Phe Phe Lys His Cys Asp Ala Gly Thr Arg Leu Asp Gly Pro Val Met

290 295 300

Val Ser Ala Glu Asn Gly Glu Ile Arg Glu Tyr Ile Val Gly Asn Asn

305 310 315 320

Cys Tyr Pro Leu Leu Pro Trp Leu Met Thr Pro Tyr Glu Gly Glu Ser

325 330 335

Leu Ser Ala Pro Met Ala Ser Phe Asn Ala Arg Gln Lys Ala Ala Arg

340 345 350

Thr Leu Gly Pro Arg Ala Leu Ser Arg Leu Lys Gly Ser Trp Arg Ile

355 360 365

Leu Asn Lys Val Met Trp Arg Pro Asp Lys Asn Lys Leu Pro Ser Ile

370 375 380

Ile Leu Val Cys Cys Leu Leu His Asn Ile Ile Ile Asp Cys Glu Asp

385 390 395 400

Glu Leu Leu Pro Asp Val Gln Leu Pro Asp His His Asp Thr Gly Tyr

405 410 415

Ser Glu Glu Lys Cys Glu Gln Val Asp Pro Asn Gly Lys Ile Met Arg

420 425 430

Asp Val Ile Thr Gly Tyr Leu Gln Ile

435 440

Claims (10)

1. Any one of the following applications of the plant-type related protein or the substance for regulating the activity or the content of the plant-type related protein:

D1) regulating and controlling plant types of plants;

D2) preparing a plant type regulating product;

D3) regulating and controlling the included angle of plant leaves;

D4) preparing a product for regulating and controlling the included angle of plant leaves;

D5) cultivating plants with reduced leaf angle;

D6) plant breeding;

the plant type related protein is A1), A2) or A3) as follows:

A1) the amino acid sequence is the protein of sequence 3;

A2) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3 in the sequence table and has the same function;

A3) a fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of A1) or A2).

2. Use of a biological material related to the plant-type associated protein of claim 1, wherein the biological material is selected from the group consisting of:

D1) regulating and controlling plant types of plants;

D2) preparing a plant type regulating product;

D3) regulating and controlling the included angle of plant leaves;

D4) preparing a product for regulating and controlling the included angle of plant leaves;

D5) cultivating plants with reduced leaf angle;

D6) plant breeding;

the biomaterial is any one of the following B1) to B22):

B1) a nucleic acid molecule encoding the plant-type-associated protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector comprising the nucleic acid molecule of B1);

B4) a recombinant vector comprising the expression cassette of B2);

B5) a recombinant microorganism comprising the nucleic acid molecule of B1);

B6) a recombinant microorganism comprising the expression cassette of B2);

B7) a recombinant microorganism containing the recombinant vector of B3);

B8) a recombinant microorganism containing the recombinant vector of B4);

B9) a transgenic plant cell line comprising the nucleic acid molecule of B1);

B10) a transgenic plant cell line comprising the expression cassette of B2);

B11) a transgenic plant cell line comprising the recombinant vector of B3);

B12) a transgenic plant cell line comprising the recombinant vector of B4);

B13) transgenic plant tissue comprising the nucleic acid molecule of B1);

B14) transgenic plant tissue comprising the expression cassette of B2);

B15) transgenic plant tissue containing the recombinant vector of B3);

B16) transgenic plant tissue containing the recombinant vector of B4);

B17) a transgenic plant organ containing the nucleic acid molecule of B1);

B18) a transgenic plant organ containing the expression cassette of B2);

B19) a transgenic plant organ containing the recombinant vector of B3);

B20) a transgenic plant organ containing the recombinant vector of B4);

B21) a nucleic acid molecule for reducing the expression level of the plant type-associated protein according to claim 1;

B22) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule according to B21).

3. Use according to claim 2, characterized in that: B1) the nucleic acid molecule is any one of the following b1) -b 5):

b1) the coding sequence is cDNA molecule or DNA molecule of sequence 2 in the sequence table;

b2) a cDNA molecule or a DNA molecule shown in a sequence 2 in a sequence table;

b3) DNA molecule shown in sequence 1 in the sequence table;

b4) a cDNA molecule or a genomic DNA molecule which has 75 percent or more identity with the nucleotide sequence defined by b1) or b2) or b3) and codes the plant type related protein of claim 1;

b5) a cDNA molecule or a genomic DNA molecule which hybridizes with the nucleotide sequence defined by b1) or b2) or b3) or b4) under strict conditions and codes for the plant-type associated protein as claimed in claim 1;

B21) the nucleic acid molecule is shown as the 1041-171 site of the sequence 2 in the sequence table.

4. The product with the function of regulating and controlling the plant type of the plant is characterized in that: the product contains the plant type-associated protein of claim 1 or the biological material of claim 2 or 3.

5. Use according to any one of claims 1 to 3, or a product according to claim 4, wherein: the plant is m1) or m2) or m 3):

m1) a monocotyledonous or dicotyledonous plant;

m2) a gramineous plant;

m3) rice.

6. A method of reducing leaf angle in a plant comprising: increasing the activity and/or content of the plant type-related protein in the plant of the receptor, or promoting the expression of the gene encoding the plant type-related protein in the plant of the receptor, so as to obtain the target plant with reduced leaf angle compared with the plant of the receptor.

7. A method of growing plants with reduced leaf angle comprising: increasing the activity and/or content of the plant type-related protein in the plant of the receptor, or promoting the expression of the gene encoding the plant type-related protein in the plant of the receptor, so as to obtain the target plant with reduced leaf angle compared with the plant of the receptor.

8. The method according to claim 6 or 7, characterized in that: the plant of interest is a transgenic plant having an increased expression level of the plant-type-related protein as compared to the recipient plant, which is obtained by introducing the gene encoding the plant-type-related protein according to claim 1 into the recipient plant.

9. The method of claim 8, wherein: the gene encoding the plant-type-associated protein according to claim 1 is the nucleic acid molecule according to B1) of claim 3.

10. The method according to any one of claims 6-9, wherein: the recipient plant is m1) or m2) or m 3):

m1) a monocotyledonous or dicotyledonous plant;

m2) a gramineous plant;

m3) rice.

Images