CN104073512A - Method for regulating endogenous ethylene content of plant - Google Patents

Abstract

The invention relates to a method for regulating the endogenous ethylene content of plant and discloses the negative regulation of arabidopsis thaliana synthesis by CKI8 (also called CK1.8). Therefore, CKI8 can be used for regulating the ethylene content in specific crop so as to realize improvement of the plant variety.

Description

A kind of method of regulating plant endogenous ethylene content

Technical field

The invention belongs to plant genetic engineering field, specifically, relate to a kind of method of regulating plant endogenous ethylene content.

Background technology

Ethene is a kind of plant hormone existing with gaseous phase.Come from eighties of last century, the vital role that ethene is brought into play in plant materials as a kind of signaling molecule is familiar with by people gradually, is therefore listed in one of plant six large hormones.Ethene has all played important regulating and controlling effect in aging, fruit maturation, cell elongation, adverse circumstance and the cause of disease reaction of seed germination, blade and flower.

The lower Arabidopsis thaliana Seedlings of dark growth there will be the triple response of composing type under the ethene of higher concentration (>0.1 μ L/L) is processed, comprise suppress hypocotyl and root elongation, promote the too bending of hypocotylar expansion and seedling top.Under normal conditions, ethene in vegetable cell need to maintain a lower concentration and keep its normal growth, in the time there is environmental change or meet with infringement, plant needs synthesizing ethylene rapidly to deal with these variations, to ensure the growth of self, some regulatory mechanisms in research ethene building-up process contribute to understand better regulation and control and the answering of plant ethene in growth and development process, thereby realize the g and D of artificial regulatory plant.Zhang Shuqun etc. are (referring to Liu and Zhang, 2004; Han et al, 2010 reports) extremely pay close attention to the phosphorylated regulation of MAPK for ACS, MAPK is a proteinoid kinases very important in eukaryote, all there is vital function at growth and development of plants with degeneration-resistant reaction, Arabidopis thaliana MPK3/6 and their isozyme SIPK, WIPK in tobacco have all participated in the degeneration-resistant reaction of plant, and having affected in plant materials has ethene synthetic, wherein MPK3/6 is is just regulating and controlling its activity by class ACS such as phosphorylation ACS2/6, and and then to have affected the ethene in disease resistance response synthetic.In addition ethene synthesizes in fruit maturation and can discharge in a large number, promotes its maturation, and the coming off of blade.Ethene is at the leaf senile of plant, and disease resistance response, also plays a very important role in water resistant waterlogging.In plant senescence process, ethylene content can rise, thereby accelerates this process.Botrytis cinerea (Botrytis cinerea) can inducing plant ethene synthetic, thereby participate in this disease resistance response process.In addition, in paddy rice, ethene plays positive regulating and controlling effect in water resistant is flooded.

The synthetic of plant ethene is a very conservative and relatively simple process, can be by its precursor S-adenosylmethionine at acc synthase (ACC synthases, ACSs) under catalysis, synthetic ACC, further be oxidized to ethylene gas (Ethylene) by acc oxidase (ACO), as a kind of gas hormone, can be conveniently used in the Preservation of Agricultural Products such as the accelerating ripening of fruit; In addition due to ethene for paddy rice play a very important role in anti-watering-out process, the ethylene content in regulating plant body has very important function.

The precursor of ethene is methionine(Met) (Methionine), methionine(Met) reacts with ATP and generates SAMe (AdoMet), after ACS catalysis, generate again 1-amino-cyclopropane-1-carboxylic acid (1-aminocyclopropane-1-carboxylic acid, ACC); ACC generates ethene (Ethylene), CO with oxygen reaction under the catalysis of acc oxidase (ACC oxidase, ACO) ₂and HCN.Methionine(Met) is a kind of indispensable amino acid in organism, find in the process of synthesizing ethylene by isotope-labeled method, carbon atom on the 3rd, 4 of methionine(Met) finally forms ethene, and remaining methylthio group is by the Young constantly recycling that circulates.Methionine(Met) reacts with ATP, generates AdoMet, the intermediate that a kind of ethene is synthetic by the catalysis of AdoMet synthase.AdoMet generates ACC through ACS catalysis again, and this process is a rate-limiting step in Synthesis pathway process.

The building-up process of ethene is except being regulated and controled in the time that growth and development of plants and response environment change, and it can also be associated with some other signal path simultaneously, forms a complicated regulated and control network, as the mutual work of ethene and optical signal; Growth hormone can promote the expression of all ACS albumen except ACS1, and GA and ethene regulate and control Arabidopis thaliana etiolated seedling top crotch growth etc. jointly.Wanting to untie completely ethene regulation process synthetic and signal path also needs more research and explores.

Therefore, this area is in the urgent need to providing a kind of means of effectively and delicately regulating plant endogenous ethylene content.

Summary of the invention

The object of the present invention is to provide a kind of method of regulating plant endogenous ethylene content.

In a first aspect of the present invention, the method that a kind of regulation and control (comprising: raise or lower) interior ethylene content of plant materials or regulating plant growth proterties are provided, described method comprises: the expression of CKI8 gene (being called again CK1.8) in regulating plant body.

In a preference, described CKI8 genes encoding:

(a) polypeptide of aminoacid sequence shown in SEQ ID NO:2; Or

(b) by one or more the process of aminoacid sequence shown in SEQ ID NO:2 (as individual in 1-20; Preferably 1-10; More preferably 1-5; More preferably 1-3) replacement, disappearance or the interpolation of amino-acid residue form, and have (a) polypeptide function by (a) derivative polypeptide;

(c) have 70% with aminoacid sequence shown in SEQ ID NO:2 (preferably 80%; More preferably 90%; More preferably 95%; More preferably 98%; More preferably 99%) above homogeny, and have (a) polypeptide function by (a) derivative polypeptide.

In another preference, described CKI8 gene is:

(1) polynucleotide of nucleotide sequence shown in SEQ ID NO:1;

(2) nucleotides sequence is listed in the polynucleotide that can lower with the albumen of the polynucleotide sequence hybridization of (1) restriction and coding ethylene content in plant materials under stringent condition;

(3) polynucleotide sequence that nucleotide sequence and (1) limit has more than 80% (preferably more than 85%; More preferably more than 90%; More preferably more than 95%; More preferably more than 99%) albumen of homogeny and coding can lower the polynucleotide of ethylene content in plant materials; Or

(4) polynucleotide of the polynucleotide sequence complete complementary of nucleotide sequence and the arbitrary restriction in (1)-(3).

In another preference, in described regulating plant body, ethylene content is reduce the interior ethylene content of plant materials or make plant hypocotyl increase, attenuate, and comprising: the expression of raising CKI8 gene in plant materials.

In another preference, in described rise plant materials, the method for the expression of CKI8 gene comprises: by CKI8 gene transferred plant, obtain the transgenic plant that ethylene content reduces.

In another preference, described method in CKI8 gene transferred plant is comprised: the Agrobacterium of carrying expression vector (S1) is provided, and described expression vector contains CKI8 gene; (S2) cell or tissue of plant or organ are contacted with the Agrobacterium in step (S1), thereby make described polynucleotide proceed to plant.In another preference, described method also comprises: (S3) select the vegetable cell, tissue, the organ that have proceeded to described polynucleotide; (S4) by the vegetable cell in step (S3), tissue, organ or seed regeneration plant.

In another preference, in described regulating plant body, ethylene content is to increase in plant materials ethylene content or make plant hypocotyl shorten, increase thick, top crotch excessively to magnify, and comprising: the expression of lowering CKI8 gene in plant materials.

In another preference, in described downward plant materials, the method for the expression of CKI8 gene comprises: the lower adjustment of lowering CKI8 genetic transcription, protein expression or protein-active is proceeded in plant.

In another preference, described lower adjustment is the disturbing molecule that specificity is disturbed CKI8 genetic expression; Preferably, described disturbing molecule is that CKI8 gene or its transcript are dsRNA, antisense nucleic acid, siRNA, the Microrna of inhibition or reticent target, maybe can express or form the construction of described dsRNA, antisense nucleic acid, siRNA, Microrna.

In another preference, described lower adjustment is the CKI8 of inactivation form; Preferably, the CKI8 of described inactivation form be the albumen of coding with respect to the albumen of wild-type CKI8 coding, the 128th is sported the CKI8 gene mutation body of N by D, or the 38th CKI8 gene mutation body that is sported R by K.

In another preference, described plant comprises: plant of Solanaceae (comprising tomato platymiscium, as tomato), and cress (comprises mouse ear mustard, as Arabidopis thaliana) or grass (comprising oryza plant, as paddy rice).

In another aspect of this invention, provide a kind of purposes of CKI8 gene, for ethylene content in regulating plant body or regulating plant growth proterties; Or for the preparation of the material of ethylene content in regulating plant body or regulating plant growth proterties; Or for the maturation of delay plant fruit.In a preference.Described CKI8 gene is for reducing ethylene content in plant materials or make plant hypocotyl increase, attenuate.

In another aspect of this invention, provide a kind of purposes of material of the CKI8 of reduction genetic expression, for increasing ethylene content in plant materials or make plant hypocotyl shorten, increase thick, top crotch excessively magnifies.In a preference, the material of described reduction CKI8 genetic expression comprises: the CKI8 of inactivation form; Preferably, the CKI8 of described inactivation form be the albumen of coding with respect to the albumen of wild-type CKI8 coding, the 128th is sported the CKI8 gene mutation body of N by D, or the 38th CKI8 gene mutation body that is sported R by K.

In another aspect of this invention, providing a kind of increases the interior ethylene content of plant materials or makes plant hypocotyl shorten, increase slightly, the material that top crotch excessively magnifies, and it is CKI8 gene mutation body; The albumen of its coding is with respect to the albumen of wild-type CKI8 coding, and the 128th sports N by D, or the 38th sports R by K.

Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.

Brief description of the drawings

The phenotype of Fig. 1, the synthetic excessive mutant cki8-1 of Arabidopis thaliana ethene and wild-type material, ethylene content is measured.Left figure shows, the dark lower growth etiolated seedling phenotype of 90 hours, and WT hypocotyl is elongated, top crotch normal close-up, and cki8-1 hypocotyl is shorter, top crotch is excessively closed to rear simultaneously, is rendered as the ethene triple response of composing type.Right figure shows, the ethylene content that GC/MS measures different plants shows, the ethene amount that WT produces in the time of dark lower growth is lower, and lower than detectability, and cki8-1 ethene amount obviously raises, and is about 1/3 of eto1.

The on position of T-DNA and checking in Fig. 2, cki8-1.Upper figure is CKI8 gene model figure, shows that in cki8-1, T-DNA is inserted in the 2nd intron.Figure below is that PCR test cki8-1 is the mutant that T-DNA is inserted in CKI8 gene inside.

The expression of CKI8 gene in Fig. 3, cki8-1.Sxemiquantitative PCR shows, in cki8-1, T-DNA inserts and causes CKI8 genetic expression disappearance.

Fig. 4, p2 × 35S::CKI8-pHB carrier schematic diagram.Add after BamHI and SpeI restriction enzyme site at CKI8cDNA total length two ends by PCR, be connected into pHB carrier, make justice and express.

Fig. 5, function complementation experiment T ₂the phenotype of transgenic arabidopsis plant.The dark lower growth etiolated seedling phenotype of 90 hours is the composing type ethene triple response phenotype that p35S::CKI8 or pCKL8::CKI8 all can complementary cki8-1 no matter show.

The hypocotyl length statistics of Fig. 6, cki8-1 and complementary transgenic arabidopsis plant.The dark lower growth etiolated seedling hypocotyl length of 90 hours statistics is the composing type ethene triple response phenotype that p35S::CKI8 or pCKL8::CKI8 all can complementary cki8-1 no matter show.

Fig. 7, pCAMBIA1302-p35S::CKI8 carrier collection of illustrative plates.

Fig. 8, pCAMBIA1302-pCKL8::CKI8 carrier collection of illustrative plates.

Fig. 9, CKI8 cross the phenotype of express transgenic Arabidopis thaliana plant.By p2 × 35S::CKI8-pHB (Fig. 4) is proceeded to WT background, build overexpression mutant, show that its phenotype and acs5-1 are (purchased from Arabidopsis Biological Resource Center, ABRC, CS16567, referring to Tsuchisaka et al., Genetics, 2009 reports), acs9-1 is (purchased from Arabidopsis Biological Resource Center, ABRC, SALK_129805C is referring to Tsuchisaka et al., Genetics, 2009), acs5-1 × acs9-1 is (purchased from Arabidopsis Biological Resource Center, ABRC, CS16593, referring to Tsuchisaka et al., Genetics, 2009 report) etc. ACS deletion mutant body similar, secretly descend the phenotype of etiolated seedling and WT difference not remarkable.This may be lower relevant with WT background ethylene content, i.e. the excessive impact of etiolated seedling is larger, disappearance DeGrain.

The CKI8 that Figure 10, kinase activity are lost ^k38Rwith CKI8 ^d128Ncrossing respectively expression can not complementary mutation type surface.The CKI8 of inactivation form carries out transgenosis and crosses expression ［ CKI8 ^k38Rovx (cki8-1), CKI8 ^d128Novx (cki8-1) ］.

The CKI8 that Figure 11, kinase activity are lost ^d128Ncross and express the phenotype that can improve ethylene content.

The detection of ACS5 protein level under Figure 12 WT and cki8-1 background

Figure 12, the inventor are by obtaining the consistent strain of ACS5-cMyc expression amount, and the protein level of making the synthetic rear ACS5-cMyc of detection of CHX (cycloheximide) processing arrestin changes.Result shows, under WT background, ACS5-cMyc is degraded rapidly; And under cki8-1 background, the degraded of ACS5-cMyc is delayed greatly.Illustrate that CKI8 is a negative regulatory factor of ACS5.

Figure 13, fruit differential promoters driven CK1.8 cross expression can delay Tomato Ripening delay.

(1) pE8-CK1.8-pHB (L1, L2, L4, L9), pE8-CK1.8 ^k38R-pHB (L2, L6, L7, L8) and pE8-CK1.8 ^d128Nthe PCR the result of-pHB (L3, L9, L12, L21) transgenic Fructus Lycopersici esculenti.

(2), after artificial pollination, CK1.8 special mistake in fruit expressed delay fruit maturation (to redden completely as ripeness standard) statistics (n=20).

(3) CK1.8 special mistake in fruit expressed promotion delay of maturation representative schematic diagram, after every 5 heaven-made artificial pollinations, and WT (LA1781), pE8-CK1.8-pHB (L1, L4, L9), pE8-CK1.8 ^d128Nthe mature condition of-pHB (L3, L9, L12), scale=1cm.

Embodiment

The inventor, through deep research, finds that CKI8 (being called again CK1.8) negative regulation Arabidopis thaliana ethene is synthetic.Therefore, CKI8 can be used for regulating and controlling ethylene content in specific farm crop, thereby realizes plant species improvement.Cross expression CKI8 and can in plant, postpone fruit maturation.

As used herein, described " plant " includes but not limited to: cress, grass, plant of Solanaceae, Malvaceae plant etc.Such as, described " plant " includes but not limited to: Cruciferae mouse ear mustard is as Arabidopis thaliana, Cruciferae Brassica plants is as rape, Gramineae oryza plant is as paddy rice, Gramineae Triticum plant is as wheat, Gramineae Zea plant is as corn, and Solanaceae tomato platymiscium is as tomato, and Malvaceae cotton is as cotton etc.

As used herein, " ethene triple response " refer to ethene to the growth of plant have suppress stem elongation growth, promote that the increasing of stem or root is thick and make the three aspects: effect of stem transverse growth (even if stem loses negative geotropism growth), this is the typical biological effect of ethene.Triple response is the classics reaction of ethene, as an index, and ethylene content or strength of signal in can antimer.In Arabidopis thaliana, top crotch is excessively exaggerated, hypocotyl shortens to be known as and can reflect ethylene content or strength of signal in Arabidopis thaliana.The tissue of nearly all higher plant can produce microscale ethylene.Arid, waterlogging, extreme temperature, chemistry injury and physical abuse can increase by the interior ethene of stimulating plant body.Ethene can suppress the synthetic and transport of growth hormone.Therefore, change the ethylene content in plant materials, can the resistant function of regulating plant to multiple adverse circumstances such as arid, waterlogging, high temperature, low temperature, abnormal salt concn.

As used herein, " the CKI8 albumen of separation " or " the CKI8 polypeptide of separation " refers to that CKI8 albumen does not basically contain natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can be purified CKI8 albumen with the purified technology of protein of standard.Substantially pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.Described CKI8 polypeptide belongs to I type casein kinase.

In the present invention, " polypeptide (also referred to as CKI8 polypeptide (albumen)) of CKI8 genes encoding " refers to have the polypeptide of the SEQ ID NO:2 sequence of ethylene content activity in regulation and control (downward) plant materials, also comprises and having and variant form CKI8 albumen identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8,1-5) amino acid whose disappearance, insertion and/or replacement, and at C-terminal and/or N-terminal interpolation or disappearance one or several (being generally in 20, is preferably in 10, is more preferably in 5) amino acid.For example, in the art, while replacement with the close or similar amino acid of performance, conventionally can not change the function of protein.Again such as, the function of adding or several amino acid and conventionally also can not change protein at C-terminal and/or N-terminal.This term also comprises active fragments and the reactive derivative of CKI8 albumen.

The present invention also comprises fragment, derivative and the analogue of CKI8 albumen.As used herein, term " fragment ", " derivative " refer to and substantially keep biological function or the active polypeptide that CKI8 albumen of the present invention is identical with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferably conservative amino acid residue), and the amino-acid residue of such replacement can not be also to be encoded by genetic code, or (ii) in one or more amino-acid residues, there is the polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as extending the compound of polypeptide transformation period, for example polyoxyethylene glycol) merge the polypeptide that forms, or (iv) additional aminoacid sequence be fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or fusion rotein).Belong to the known scope of those skilled in the art according to these fragments of definition, derivative and analogue herein.

The bioactive fragment of any CKI8 albumen can be applied in the present invention.Here, the implication of the bioactive fragment of CKI8 albumen refers to as a peptide species, and it still can keep all or part of function of the CKI8 albumen of total length.Under normal circumstances, described bioactive fragment at least keeps the activity of 50% total length CKI8 albumen.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of total length CKI8 albumen.

The variant form of polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, albumen that can be coded with the DNA of CKI8 protein D NA hybridization under high or low stringency condition and polypeptide or the albumen that utilizes the antiserum(antisera) of anti-CKI8 albumen to obtain.The present invention also provides other polypeptide, as the fusion rotein that comprises CKI8 albumen or its fragment.

Any and described CKI8 albumen homology high (such as with the homology of the sequence shown in SEQ ID NO:2 be 70% or higher; Preferably, homology is 80% or higher; Preferred, homology is 90% or higher, as homology 95%, 98% or 99%) and the albumen with CKI8 albumen identical function be also included within the present invention.

In the present invention, " CKI8 albumen conservative property variation polypeptide " refers to, compared with the aminoacid sequence with SEQ ID NO:3, have 20 at the most, preferably at the most 10, more preferably at the most 5,3 amino acid are replaced by the similar or close amino acid of character and form polypeptide at the most best.These conservative property variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.

Table 1

Amino-acid residue	Representational replacement	Preferred replacement
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The invention still further relates to the polynucleotide sequence of code book invention CKI8 albumen or its conservative property variation polypeptide.Described polynucleotide can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " refers to that coding has the protein of SEQ ID NO:2 in the present invention, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence (with optional additional code sequence) and the non-coding sequence of mature polypeptide.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise coding said polypeptide, can be also the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or the fragment of polypeptide, analogue and derivative with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing in fact the function of polypeptide of its coding.

The invention still further relates under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " refers to: (1) at the hybridization compared with under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, and 0.1%SDS, 60 DEG C; Or (2) hybridization time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) only at the homogeny between two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:2.

The present invention also comprises with nucleotide sequence of the present invention having more than 70%, more preferably more than 80%, and more preferably more than 90%, the most preferably nucleic acid of 95% above homogeny, described nucleic acid also has the identical regulating and controlling effect of sequence shown in SEQ ID NO:1." homogeny " refers to the per-cent identical according to position, the similar level (being sequence homology, similarity or identity) between two or more pieces nucleic acid.

Should understand, although CKI8 gene of the present invention is preferably available from cress, but available from (as having more than 70% with Arabidopis thaliana CKI8 gene height homology of other plant, as 80%, 85%, 90%, 95%, even 98% sequence homogeny) the scope also considered in the present invention of other gene within.The Method and kit for of aligned sequences homogeny is also that this area is known, for example BLAST.

CKI8 pyrenoids thuja acid full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic conventionally.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.In the time that sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment amplifying for each time is stitched together by proper order.

The present invention also relates to the carrier that comprises described polynucleotide, and the host cell producing through genetically engineered with described carrier or CKI8 albumen coded sequence.

In the present invention, CKI8 albumen polynucleotide sequence can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is conventionally to contain replication orgin, promotor, marker gene and translation controlling elements.

Comprise above-mentioned suitable DNA sequence dna and the suitable carrier of promotor or control sequence, can be for transforming suitable host cell, with can marking protein.Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell is as yeast; Vegetable cell etc.

When described polynucleotide are expressed in higher eucaryotic cells, be enhanced if will make to transcribe insert enhancer sequence in carrier time.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene conventionally.

Persons skilled in the art are all known the suitable carrier of How to choose, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.Conversion of plant can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as spraying, Ye Panfa, Rice Young Embryo conversion method etc.Can use ordinary method regeneration plant for the vegetable cell, tissue or the organ that transform, thereby obtain the plant that Starch biosynthesis proterties changes.

The gene of negative regulation ethene resultant of the present invention has important using value in theoretical investigation and agronomy improvement.This sequence can be applied to specific farm crop ethene character improvement, change its state that grows, as fruit mature period, leaf senile time etc.; Or can be applicable to improve the degeneration-resistant border ability of plant, obtain the plant of the proterties such as more drought-enduring, cold-resistant, heat-resisting or salt tolerant.

Gene of the present invention can be by organizing specific promoters driven, specific expressed.Described specific promoter can be external source (allos).Nucleotide sequence to described specific promoter has no particular limits (nucleotide sequence as structural in one), and for example some has the specific promotor of vitals in agricultural or plant improvement.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of the host cell transforming, as Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein (GFP) etc.

The carrier that comprises above-mentioned suitable promotor and goal gene, can be for transforming suitable host cell, with can marking protein.

Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell is as yeast; Vegetable cell etc.Persons skilled in the art are all known carrier and the host cell that How to choose is suitable.

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host is prokaryotic organism during as intestinal bacteria, the competent cell that can absorb DNA can, in exponential growth after date results, be used CaCl ₂method processing, step used is well-known in this area.Another kind method is to use MgCl ₂.If needed, transform and also can be undertaken by the method for electroporation.When host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method is as microinjection, electroporation, liposome packaging etc.Conversion of plant also can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf dish method, rataria conversion method, bud infusion method etc.Can use ordinary method regeneration plant for the vegetable cell, tissue or the organ that transform, thereby obtain genetically modified plant.

As a kind of mode, the method of preparing transgenic plant is: the expression vector that carries promoter sequence and goal gene (being operably connected) is proceeded to Agrobacterium, and Agrobacterium will be incorporated on the karyomit(e) of plant containing the carrier segments of promotor and goal gene again.The transgene receptor plant relating to is for example paddy rice, wheat, barley and corn.

The invention provides described CKI8 albumen or the purposes of its encoding gene, for the ethylene content of regulating plant.As a kind of optimal way, described CKI8 albumen can be used for: the content of ethene in reduction or rising specified plant tissue.

Because process synthetic in ethene body is relatively simple, can be directly by the metabolic enzyme content of engineered means regulation and control different plant species, tissue, organ; Can pass through activator or the inhibitor of synthetic, surface applies this type of chemical agent and changes endogenous ethylene content.

The invention still further relates to the agonist of CKI8 or antagonist and uses thereof.Due to the agonist of CKI8 or the expression of the adjustable CKI8 of antagonist and/or regulate the activity etc. of CKI8, therefore, the agonist of described CKI8 or antagonist also can be by the impact of CKI8 being carried out to regulating plant ethylene content, thereby reach the object of improvement plant.

The material of transcribing and translating of the activity of any CKI8 of raising albumen, the stability that improves CKI8 albumen, the expression that promotes CKI8 albumen, prolongation CKI8 albumen effective acting time or promotion CKI8 all can be used for the present invention, for reducing ethylene content in plant materials.The material of transcribing and translating of the activity of any CKI8 of reduction albumen, the stability that reduces CKI8 albumen, the expression that suppresses CKI8 albumen, minimizing CKI8 albumen effective acting time or reduction CKI8 all can be used for the present invention, as lower adjustment, antagonist or the inhibitor (that is: lowering the material of CKI8 protein expression) of CKI8, as the antibody of anti-described CKI8 albumen, disturb the disturbing molecule (as formed the disturbing molecule of microRNA) of the encoding gene expression of described CKI8 albumen.Described lower adjustment, antagonist or inhibitor can be used for the expression by lowering CKI8, raises ethylene content in plant.Obtaining after cicada target sequence, it is well known in the art that the method for the disturbing molecule of specific gene expression is disturbed in preparation.

The invention still further relates to a kind of method that improves plant, the method comprises the expression that regulates CKI8 albumen in described plant.

On the one hand, the present invention also provides a kind of method of regulating plant ethylene content, and described method comprises: reduce the expression (comprise CKI8 albumen is not expressed or low expression) of CKI8 albumen in described plant.

After the purposes of the CKI8 albumen described in cicada, can adopt several different methods well known in the art to regulate the expression of described CKI8 albumen.Such as can the ceneme (such as expression vector or virus etc.) that carry CKI8 gene being delivered on target spot by the known approach of those skilled in the art, and make it the CKI8 albumen of expression activity.

In addition, also can adopt several different methods well known in the art reduce the expression of CKI8 albumen or make it loss of expression, such as the ceneme of carrying antisense CKI8 gene (such as expression vector or virus etc.) is delivered on target spot, make cell or plant tissue not express or reduce and express CKI8 albumen.

As one embodiment of the present invention, the gene of coding CKI8 albumen is cloned in suitable carrier by conventional method, the described recombinant vectors with foreign gene is imported in the vegetable cell that can express described CKI8 albumen, make described vegetable cell express CKI8 albumen.Can, by by described vegetable cell regeneration plant, obtain the plant of overexpression CKI8 albumen.

Preferably, provide a kind of method of preparing transgenic plant, having comprised:

(1) encoding gene of the CKI8 albumen of external source is proceeded to vegetable cell, tissue, organ or tissue, obtain vegetable cell, tissue, organ or the seed of the encoding gene that is transformed into CKI8 albumen; With

(2) vegetable cell, tissue, organ or the seed regeneration plant plant of the encoding gene that has proceeded to external source CKI8 albumen step (1) being obtained.

As the preferred example of one, described method comprises step:

(s1) provide the Agrobacterium of carrying expression vector, the encoding gene that described expression vector contains CKI8 albumen;

(s2) vegetable cell, tissue, organ are contacted with the Agrobacterium in step (s1), thereby make the encoding gene of CKI8 albumen proceed to vegetable cell, and be incorporated on the karyomit(e) of vegetable cell;

(s3) select vegetable cell, tissue, organ or the seed of the encoding gene that proceeds to CKI8 albumen; And

(s4) by the vegetable cell in step (s3), tissue, organ or seed regeneration plant.

Other method that increases CKI8 gene or the expression of its homologous gene is that this area is known.For example, thus can be by driving and strengthen CKI8 gene or its homogenic expression with strong promoter.Or strengthen the expression of this CKI8 gene by enhanser (as paddy rice waxy gene First Intron, Actin gene First Intron etc.).The strong promoter that is applicable to the inventive method includes but not limited to: 35s promotor, the Ubi promotor of paddy rice, corn etc.

Preferably, also provide a kind of method that reduces the expression of CKI8 albumen in plant, described method comprises:

(1) disturbing molecule that disturbs CKI8 genetic expression is proceeded to vegetable cell, tissue, organ or seed, obtain the vegetable cell, tissue, organ or the seed that are transformed into described disturbing molecule;

(2) vegetable cell that has proceeded to described disturbing molecule, tissue, organ or the seed regeneration plant that step (1) are obtained.

As the preferred example of one, described method comprises step:

(i) provide the Agrobacterium of carrying the carrier that can disturb genetic expression, described carrier is selected from lower group:

(a) contain the encoding gene of CKI8 albumen or the carrier of gene fragment (antisense molecule) that start in the other direction;

(b) carrier of the disturbing molecule of the composition that contains the encoding gene expression (or transcribing) that can form specificity interference CKI8 albumen in plant materials;

(ii) cell of plant, tissue or organ are contacted with the Agrobacterium in step (i), thereby make described carrier proceed to vegetable cell, tissue or organ.

Preferably, described method also comprises:

(iii) select the vegetable cell, tissue or the organ that have proceeded to described carrier; With

(iv) vegetable cell, tissue or neomorph in step (iii) are become to plant.

The present invention also provides a kind of to be increased the interior ethylene content of plant materials or makes plant hypocotyl shorten, increase thick material, and it is CKI8 gene mutation body; The albumen of its coding is with respect to the albumen of wild-type CKI8 coding, and the 128th sports N by D.By method for transformation described above, this CKI8 gene mutation body can be transferred in plant materials, increase the interior ethylene content of plant materials or make plant hypocotyl shorten, increase thick object thereby reach.

Other method that suppresses CKI8 gene or the expression of its homologous gene is that this area is known.

The present invention also comprises the plant that utilizes aforementioned any method to obtain, and described plant comprises: proceeded to CKI8 gene or its homogenic transgenic plant; Or the plant that CKI8 expressing quantity (comprise low expression or do not express) reduces etc.

Can adopt any suitable conventional means, comprise that reagent, temperature, pressure condition etc. implement described method.

Ethene is a kind of very important plant hormone, has influence on all many-sides such as the growing of crop, fruit maturation, resistance.The clone of CKI8 gene and application, can be applied to the synthetic control measures of crop ethene, as regulating fruit maturation with fresh-keeping, improve a kind of technology of output.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, writes molecular cloning experiment guide, the third edition, Science Press, the condition described in 2002, or the condition of advising according to manufacturer conventionally as J. Pehanorm Brooker etc. according to normal condition.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

The qualification of embodiment 1, cki8-1 mutant

1, Arabidopis thaliana material

Arabidopis thaliana (Arabidopsis thaliana.) mutant cki8-1 (casein kinase I8), original wild material is Arabidopsisecotype " Columbia-0 ".

2, PCR determines that cki8-1 is a deletion mutant of CKI8 gene

2.1, use simplified method (TPS method) to extract arabidopsis thaliana genomic dna

1) Arabidopsis leaf of getting 1cm is put into the centrifuge tube of 2ml, adds the TPS extract of 200 μ l, and concussion is ground.The preparation of TPS extract: 100mM Tris-Cl (pH8.0), 10mM EDTA (pH8.0), 1M KCl.

2) blade of smashing to pieces is put into 75 DEG C of water-baths 20 minutes.

3) centrifugal 5 minutes of 15000rpm.

4) get 120 μ l supernatant liquors in pull in 96 holes, add isopyknic Virahol, centrifugal 10 minutes of 3500rpm.

5) abandon supernatant and retain precipitation, add the ethanol of 120 μ l70%, 3500rpm is centrifugal.

6) abandon supernatant, will precipitate and be dried, add 30 μ l ddH ₂o.

2.2, the PCR of mutant Arabidopis thaliana qualification

, carry out PCR and determine whether mutant has T-DNA to insert as template with mutant Arabidopis thaliana DNA.The adjacent sequence in side providing according to SALK mutant library is inferred T-DNA insertion point, at the both sides designs primer P1 of insertion point (5 ' '-CTTTGCGTCCAAGACCCATC-3 ' ' (SEQ ID NO:3)) and P2 (5 ' '-AGATGTTGTTGGTCAATGGGTG-3 ' ' (SEQ ID NO:4)), at T-DNA left margin section design primer LBa1 (5 ' '-TGGTTCACGTAGTGGGCCATCG-3 ' ' (SEQ ID NO:5)), with P1 and P2, P2 and LB3 two, to primer pcr amplification respectively, further confirm insertion point and qualification pure lines.Taking the DNA of wild-type plant, during as template, genomic pair of primers P1/P2 can amplify the band of the 1001bp of expection, and T-DNA primer LBa1 and P2 combination can not amplify band; Taking the DNA of mutant plant during as template, T-DNA primer LBa1 and P2 combination can amplify the band of 1001bp, in the mutant isozygotying, because the T-DNA fragment of inserting is too large, P1/P2 can not amplify band, 3 individual plants (Fig. 2) as shown in cki8-1.

Find through observing, the mutant cki8-1 that the inventor obtains shows as composing type ethene triple response in the time of dark lower growth: hypocotyl shorten (approximately short by 40% compared with wild-type WT), chap, top crotch overbending, and as Fig. 1.Late growing stage and the WT of cki8-1 do not have marked difference.This with the synthetic excessive mutant of the ethene of having reported (eto1, eto2, eto3 (referring to Chae et al., The Plant Cell, 2003; Yoshida et al., BMC Plant Biology, 2005)) and Ethylene Signal to strengthen mutant ctr1 quite similar referring to Kieber et al., Cell, 1993 reports), as Fig. 9.

3, the analysis of genetic expression

3.1, Arabidopis thaliana RNA extracts

Get Arabidopis thaliana organization material (about 100mg) fully grinds in liquid nitrogen.Be transferred in 1.5ml centrifuge tube, add 1mL Trizol (Invitrogen, Cat.15596-018), mix, room temperature is placed 5min.The centrifugal 10min of 12,000rpm, abandons precipitation.In supernatant, add 600 μ L trichloromethanes, mix, the centrifugal 10min of 12,000rpm.Get supernatant, add equal-volume Virahol-20 precipitated rna DEG C half an hour.The centrifugal 10min of 12,000rpm, by 70% washing with alcohol precipitation twice, vacuum-drying, is dissolved in 20-50 μ L H ₂o (RNase free).By Rnase free H for RNA ₂o does suitable dilution, measures the UV absorption value of wavelength between 200-300nm.RNA concentration=40 μ g/mL × A ₂₆₀× extension rate.A ₂₆₀/ A ₂₈₀should be between 1.8 to 2.0.

3.2RT-PCR analyze

Total RNA of Arabidopsis thaliana Seedlings, stem, Hua Heye, respectively gets 1 μ g and carries out reverse transcription, packing after dilution ,-70 DEG C of preservations.The method that reverse transcription provides according to Dalian Bao Bio-Engineering Company is carried out (RNA PCR Kit (AMV) Ver.2.1).Reverse transcription reaction condition is: 30 DEG C, and 10min; 42 DEG C, 30min; 99 DEG C, 5min; 4 DEG C, 5min.With Arabidopis thaliana ACTIN7 gene primer (Actin7-15 "-CCGGTATTGTGCTCGATTCTG-3 "; Actin7-25 "-TTCCCGTTCTGCGGTAGTGG-3 ") carry out the result of PCR response assays reverse transcription template, determine the consumption of different cDNA templates, with gene specific primer (CKI8-15 "-CTGTGAAGCTTGAACCTGCGAG-3 " (SEQ ID NO:6); CKI8-25 "-CCGTCTTTAGATTGAACCTCCG-3 " (SEQ ID NO:7)), taking the cDNA of the total RNA reverse transcription of seedling, stem, flower and leaf texture as template, detect respectively the expression of CKI8 gene in seedling, stem, flower and leaf by the method for RT-PCR.With respect to wild-type plant, in the leaf of cki8-1 mutant, the transcriptional level of CKI8 drops to below detectability, as Fig. 3.

The preparation of the justice of embodiment 2, CKI8 gene and antisense transgene plant and proterties

1, the structure of the just carrier of CKI8 gene

Taking the cDNA of Arabidopis thaliana leaf as template, adopt following primer pair carry out pcr amplification (CKI8-35 "-CG gGATCCaTGGATCGTGTGGTTGGTGG-3 " (SEQ ID NO:8); CKI8-45 "-GG aCTAGTcTTCCTCTTTCCATTCCCTAT-3 " (SEQ ID NO:9)): with the cDNA described in pfu polymeric enzymatic amplification, PCR reaction conditions is: 94 DEG C, and 3min, 1 circulation; 94 DEG C, 30sec, 58 DEG C, 40sec, 72 DEG C, 150sec, 28 circulations; 72 DEG C, 10min, 1 circulation.Amplified production is through sequence verification, and its sequence is as shown in SEQ ID NO:1, and the gene order that is At5g43320 with Genbank accession number is identical, shows that clone products is CKI8 gene.BamHI and SpeI enzyme are connected into after cutting through same enzyme and cut in pHB binary vector after treatment (available from Shanghai Communications University), are configured to CKI8 justice binary vector p2 × 35S-CKI8-pHB that 2 × 35S promoter drives, as Fig. 4.

2, the structure of the inactivation form carrier of CKI8 gene

Taking the just carrier of CKI8 as template, utilize point mutation test kit (QuickChange II Site-Directed Mutagenesis Kit (Agilent Stratagene)), adopt following primer pair carry out pcr amplification (CKI8-55 "-GAAGAAGTTGCTGTGC gGCtTGAACCTGCGAGAG-3 " (SEQ ID NO:10); With CKI8-65 "-CTCTCGCAGGTTCAAG cCGcACAGCAACTTCTTC-3 " structure K38R (being that the 38th, CKI8 albumen sports R (SEQ ID NO:11) by K); And CKI8-75 "-GGATTTCTTCATCGT aACaTAAAGCCTGATAAC-3 " (SEQ ID NO:12); With CKI8-85 "-GTTATCAGGCTTTAT gTTaCGATGAAGAAATCC-3 " (SEQ ID NO:13) structure D128N (being that the 128th, CKI8 albumen sports N by D)): carry out pcr amplification by test kit requirement.Amplified production, through sequence verification, is respectively p2 × 35S-CKI8 ^k38R-pHB and p2 × 35S-CKI8 ^d128N-pHB.

3, the structure of the complementary carrier of CKI8 gene

Taking the cDNA of Arabidopis thaliana leaf as template, adopt following primer pair carry out pcr amplification (CKI8-35 "-CG gGATCCaTGGATCGTGTGGTTGGTGG-3 " (SEQ ID NO:14); CKI8-45 "-GG aCTAGTcTTCCTCTTTCCATTCCCTAT-3 " (SEQ ID NO:15)): with the cDNA described in pfu polymeric enzymatic amplification, PCR reaction conditions is: 94 DEG C, and 3min, 1 circulation; 94 DEG C, 30sec, 58 DEG C, 40sec, 72 DEG C, 150sec, 28 circulations; 72 DEG C, 10min, 1 circulation.Amplified production is through sequence verification, and its sequence is as shown in SEQ ID NO:1, and the gene order that is At5g43320 with Genbank accession number is identical, shows that clone products is CKI8 gene.BamHI and SpeI enzyme are connected into after cutting through same enzyme and cut in pCambia1302 binary vector after treatment (Cambia company), be configured to the CKI8 justice binary vector (p35S::CKI8-pCambia1302, Fig. 7) that 35S promoter drives.Taking arabidopsis thaliana genomic dna as template, with CKI8p-1 (ACGC gTCGACgAAATAAGAATTTTACCTGCA (SEQ ID NO:16)) carry out pcr amplification with CKI8p-2 (CGTTACCAAATCAAAAAGCTTC (SEQ ID NO:17)) for primer, obtain self promotor of CKI8, excise and in above-mentioned 35S carrier, there is 35S promoter (HindIII/EcoRI), be connected into, obtain the complementary carrier (pCKI8::CKI8-pCambia1302, Fig. 8) of self promoters driven

4, bacterial classification builds

With conventional CaCl ₂facture is (referring to " molecular biology experiment technology ", Hao Fuying etc. write, BJ University Press, Beijing, 1998) prepare agrobacterium tumefaciens GV3101 competence, by electric shock conversion method, the just carrier of CKI8 gene and antisense vector are proceeded to respectively in Agrobacterium, containing microbiotic as LB substratum (the Tryptones 10g/L of kantlex (Km), yeast extract 5g/L, NaCl10g/L, agar 15g/L, kantlex 50mg/L, with NaOH tune pH to 7.5) upper, at 28 DEG C, cultivate 2 days.

Picking list bacterium colony, containing in antibiotic YEP yeast culture base (peptone 10g/L, yeast extract 10g/L, NaCl5g/L, kantlex 50m g/L, pH7.0) 28 DEG C cultivate approximately 24 hours to logarithmic phase.Be inoculated in identical substratum by 1% amount, cultivate 24 hours at 28 DEG C.By nutrient solution centrifugal 10min under 4 DEG C, 3000rpm, get precipitation (thalline), with equal-volume transformation of Arabidopsis thaliana damping fluid (1/2MS2.2g/L, sucrose 50g/L, Syringylethanone 100mM, Silwet L-77400 μ L/L, pH5.8) suspend.

5, the conversion of Arabidopis thaliana

5.1, transformation of Arabidopsis thaliana

Gained carrier is transformed respectively to Col-0 or cki8-1 plant, and screen positive transfer-gen plant, method for transformation is with reference to the Floral Dipping method of Clough and Bent (1998).

5.2, the screening of transfer-gen plant and pure lines qualification

A) screening of transfer-gen plant

T1 is for seed uniform broadcasting (containing the Hyg of 20 μ g/mL) germination and growth on MS solid medium after surface sterilization.After two weeks, the transformation seedlings of picking normal growth moves into continued growth in soil.

B) qualification of transfer-gen plant pure lines

1) Hyg resistance culture base screens

Determine that Hyg resistance separates ratio, each strain is had to the transplantation of seedlings of resistance, T3 is for seed for individual plant results, then (previous generation plant Hyg resistance has the separation ratio of 3:1 by resistance culture base qualification pure lines, this generation plant Hyg resistance is 100%, and offspring plant keeps 100%Hyg resistance).

2) expression level of genes involved in RT-PCR method qualification transfer-gen plant

T1 extracts RNA and detects after drawing materials for plant individual plant part, to determine target gene overexpression or complementary expression level, choose genetic expression and change obvious plant and be further analyzed.

Arabidopis thaliana in the controlled environment chamber, in 22 DEG C, grow under the condition of 16 hours illumination/8 hour dark by every day.

Plant is identified and continuous observation, find the mutant plant (p35S::CKI8 (cki8-1) that just carrier transforms, pCKI8::CKI8 (cki8-1)) composing type ethene triple response, recover normal morphology, be that hypocotyl is obviously elongated compared with mutant, also overbending no longer of top crotch, with quite (Fig. 5) of WT, points out its endogenous ethylene content to return to normal level.

And carry out transgenosis ［ CKI8 for the CKI8 of inactivation form ^k38Rovx (cki8-1), CKI8 ^d128Novx (cki8-1) ］ research discovery, phenotype that can complementary cki8-1 mutant compared to wild-type CKI8, two kinds of genetically modified strains of inactivation form A KI8, all can not be complementary, show its kinase activity for CKI8 performance the function in ethene is synthetic be absolutely necessary (Figure 10).In the CKI8 transgenic line of two kinds of inactivation forms of prompting, endogenous ethylene content does not recover.

More ironically, the inventor is by CKI8 ^d128Nproceed under WT background, also can cause and the similar composing type ethene of cki8-1 triple response (Figure 11), this may be the form as a kind of dominant inhibition, has suppressed the protein function of endogenous CKI8, thereby provides theoretical basis for the inventor improves ethylene content.

Justice proceed to WT plant, with acs5-1, acs9-1, the mutant that the ethylene content of the reports such as acs5-1acs9-1 reduces is compared does not have significant proterties variation.

The mensuration of embodiment 3, plant ethylene content

Get WT, cki8-1 and eto1 are (available from Shanghai plant physiology ecological Studies institute of the Chinese Academy of Sciences, referring to Chaeet al, The Plant Cell, 2003) Arabidopis thaliana seed, through drift ice sterilizing, and sterilized water is cleaned, be placed on the wet filter paper of aseptic plate, be placed on 4 DEG C of refrigerator deepfreezes 4 days.Then plate is placed in to 22 DEG C of phytotrons, sees light 3 hours, then make dark processing 2 days.In 2mL ampoule, add 0.5mL MS solid medium, the inclined-plane that congeals into, gets and sprouts good WT, cki8-1 and eto1 seed, and every 20 is a sample, each 5 samples, secretly cultivate 2 days.Get air in ampoule, GC/MS measures ethylene content, statistical study.

Process is to WT, and the ethylene content of cki8-1 and eto1 is measured, and when the inventor finds WT normal growth, ethylene content is very low, and lower than detectability, and the ethene resultant quantity of cki8-1 and eto1 all significantly improves.Wherein cki8-1 is about 1/3 (Fig. 1) of eto1.This conforms to the inventor's supposition, i.e. the inventor's new discovery supressor CKI8 that ethene is synthetic, can be for the endogenous ethylene regulation and control of plant.

The protein level of embodiment 4, CKI8 and ACS5

The inventor is by detecting the protein level of ACS5 under WT and cki8-1 background, ACS5 is a very unsettled albumen, in normal body, under condition, keep balance synthetic and degraded, add the synthetic inhibitor C HX of albumen, after 1 hour, can be degraded in a large number, and under cki8-1 background, ACS5 proteolytic degradation is slack-off (as Figure 12) obviously.Visible CKI8 is a supressor of ACS5 accordingly.

The preparation of embodiment 5, transgenic Fructus Lycopersici esculenti

1, tomato material

Tomato (Solanum lycopersicum) is wild-type fruit normal mature material LA1781, available from Shanghai plant physiology ecological Studies institute of the Chinese Academy of Sciences.

2, experimental technique

2.1, the acquisition of fruit differential promotor E8 with and drive justice or the structure of dominant inhibition carrier

(1) use simplified method (TPS method) to extract tomato dna group DNA

The tomato leaf of getting about 100mg is put into the centrifuge tube of 2ml, adds the TPS extract of 200 μ l, and concussion is ground.The preparation of TPS extract: 100mM Tris-Cl (pH8.0), 10mM EDTA (pH8.0), 1M KCl.The blade of smashing to pieces is put into 75 DEG C of water-baths 20 minutes.Centrifugal 5 minutes of 15000rpm.Get 120 μ l supernatant liquors in pull in 96 holes, add isopyknic Virahol, centrifugal 10 minutes of 3500rpm.Abandon supernatant and retain precipitation, add the ethanol of 120 μ l70%, 3500rpm is centrifugal.Abandon supernatant, will precipitate and be dried, add 30 μ l ddH ₂o.

(2) PCR obtains the E8 promotor of fruit specific expression

The DNA extracting taking wild-type tomatoes is as template, carry out once (PCR condition and transformation of Arabidopsis thaliana are identical) of PCR expansion with primer E8-pro-F (XbaI) (GCTCTAGAAGGAATTTCACGAAATCGGCCCTT (SEQ ID NO:18)) with E8-pro-R (SpeI) (GGACTAGTAAAAATCTCAATATGAGGATGCCATATTT (SEQ ID NO:19)), obtain E8 promotor, this promotor has bibliographical information.

(3) build conversion carrier

By three carriers (p2 × 35S-CKI8-pHB, p2 × 35S-CKI8 ^k38R-pHB and p2 × 35S-CKI8 ^d128N-pHB) in 2 × 35S carry out enzyme with XbaI and two kinds of enzymes of SpeI and cut, then insert the E8 promotor of above-mentioned acquisition, obtain pE8-CKI8-pHB, pE8-CKI8 ^k38R-pHB and pE8-CKI8 ^d128N-pHB), transform Agrobacterium GV3101 (purchased from Invitrogen), for tomato conversion.

2.2, tomato conversion

(1) explant is prepared

By 70% alcohol disinfecting 1 minute for seed, with aseptic water washing 3 times.Then on super clean bench, process 5-10 minute with 10% clorox, use aseptic water washing 5-6 time.Seed is transferred to germination (26 DEG C, illumination in 16 hours) on 1/2MS substratum.The seed of 7-9 days is applicable to Agrobacterium and infects.Get cotyledon, cut away blade tip and leaf base with aseptic scissors, transfer on solid B substratum, low illumination condition (10umol/m2/s) preculture 24 hours.

(2) Agrobacterium is prepared

Within 4-5 days, draw in advance flat board (YM substratum), obtain and separate good mono-clonal, cultivate 2 days for 28 DEG C.Select mono-clonal and draw YM flat board, cultivate 2 days for 28 DEG C.Collect thalline, with MSO, 2% (1L formula: MS salt 4.3g; Myo-Inositol100mg; Thiamine HCl (1mg/mL) 0.4mL; MES10mM; Sucrose20g) suspension thalline is to OD=0.5-0.6.

(3) cultivate altogether

Agrobacterium bacterium liquid is poured into and filled in culture dish cotyledonous, and room temperature is placed 30 minutes, and frequently rocks to help contacting of Agrobacterium and cotyledon.Unnecessary bacterium liquid is removed with pipettor, under 25 DEG C of dark conditions, cultivate altogether 48 hours.

(4) regeneration plant

After within 48 hours, cultivating altogether, cotyledon is transferred to screening culture medium C upper, the upper surface of cotyledon upward.Within every 2 weeks, transfer on fresh C substratum later.

After two weeks, will cut into pieces with the callus of the former base of bud, and transfer to and on substratum D, carry out succeeding transfer culture.

The differentiation of bud, shifts once for every two weeks.Shift at shorter time if desired.

On substratum D, carry out after the selection in 2-3 week, will have 3 kinds of different regenerating tissues need to transfer on different substratum: a). compact green callus (have or without green bud, little Cong bud), transfer on the C substratum containing 1mg/LZeatin.B) budlet of .1cm left and right, transfers on D substratum.C). throw away black/brown callus (showing non-resistance callus) and lax or white callus (without differentiation capability).

In the time that cane grows to 2-4cm, bud is cut off from callus and transfer on root media E.On stem, do not retain any callus.2 weeks left and right, seedling should have good root system, if do not had, again cuts off stem stalk and transfers on fresh root media E.

The seedling of 5cm left and right can be transplanted to soil.

Transform substratum (1000mL)

*, first two weeks 2mg/L Zeatin reduced to 1mg/L from the 3rd week.

*, only containing using in 1mg/L Zeatin substratum.

Substratum containing glucose should take out as early as possible (70 DEG C of left and right) after sterilizing from Autoclave, to reduce degraded, the oxidation of Glucose.

Screening resistance Hygromycin B:10mg/mL.

YM substratum (1L: yeast extract, 400mg; Mannitol, 10g; NaCl, 100mg; MgSO ₄.7H ₂o, 200mg; KH ₂pO ₄, 500mg).

Obtain now and transformed respectively four carriers (unloaded negative contrast, pE8-CKI8-pHB, pE8-CKI8 of doing of PHB ^k38R-pHB and pE8-CKI8 ^d128N-pHB) antibiosis positive plant (each 5 strains), plant is identified and continuous observation.

By to pE8-CK1.8-pHB, pE8-CK1.8 ^k38R-pHB and pE8-CK1.8 ^d128Nthe maturation time of-pHB transgenic Fructus Lycopersici esculenti is investigated, inventor's discovery, and normal tomato starts flavescence in 35 days after artificial pollination, about approximately 37 days, starts to redden completely; And CK1.8 (transform pE8-CK1.8-pHB) special mistake in fruit expresses that to make tomato be rendered as orange-yellow always, just reddened gradually by about 48 days, fruit maturation is postponed greatly, and its inactivation form A K1.8 ^k38R(transform pE8-CK1.8 ^k38R-pHB) and CK1.8 ^d128N(transform pE8-CK1.8 ^d128N-pHB) all can not promote to postpone or promotion fruit maturation (Figure 13).

The ethene of promoter action according to to(for) Fruit Ripening of Tomato, the fruit maturation of pE8-CKI8-pHB transgenic Fructus Lycopersici esculenti becomes evening, can be applicable to fresh preservation.

Study and show in early days, ethene is synthetic in a large number in fruit ripening process.Research in tomato shows; in the process of fruit maturation; the expression amount of LeACS2 and LeACS4 raises; ethene resultant quantity (the The Tomato Genome Consortium.The tomato genome sequence provides insights into fleshy fruit evolution.Nature that rises accordingly; 2012, doi:10.1038/nature11119; Kamiyoshihara Y, Iwata M, Fukaya T, Tatsuki M, Mori is of LeACS2 H.2010.Turnover, a woundinducible1-aminocyclopropane-1-carboxylic acid synthase in tomato, is regulated by phosphorylation/dephosphorylation.Plant is – 50 etc. J.64:140).The down-regulated expression of ACS can obvious delayed fruit maturation.In addition also evidence suggests that LeACS2 is subject to the regulation and control of protein phosphorylation in vivo, consistent with theoretical basis of the present invention.This area is using the regulation and control of ethylene content as the fresh-keeping a kind of important means of tomato at present.

The preparation of embodiment 6, transgenic paddy rice

1, rice material

Paddy rice (Oryza sativa) spends 11 in wild-type material.

2, rice conversion

(1) cultivate altogether the preparation of explant (rataria)

Get japonica rice (in spend 11) immature seed, after 75% ethanol rinsing 1min, by rinsed with sterile water 3 times, afterwards with 0.1% mercuric chloride immersion 15min, then use rinsed with sterile water 3 times; Then get rataria and be inoculated in ND2 substratum (N6 macroelement, N6 trace element and N6 vitamin b6 usp, proline(Pro) 500mg/L, casein food grade 300mg/L, sucrose 30g/L, 2,4-D2mg/L, agar 8g/L, pH5.8) upper, under 25 DEG C, dark condition, cultivate three days.

(2) transform explant

Explant after cultivating is immersed to above-mentioned 2 gained thalline suspensions, leave standstill 20min, after blotting with aseptic filter paper, transfer to ND2-As substratum (ND2 substratum adds Syringylethanone (30 μ mol/L)) upper, under 25 DEG C, dark condition, cultivate altogether 3 days.

With sterilized water by the explant washing after cultivating 5 times to remove the Agrobacterium of surface adsorption, then soak 2 hours with the sterilized water containing Pyocianil 250mg/L and cephamycin 100mg/L.After blotting with aseptic filter paper, be transferred to ND2CH (ND2 substratum adds caseinhydrolysate 500mg/L, 2,4 dichlorophenoxyacetic acid 2mg/L) substratum, cultivate at 25 DEG C, screening kanamycin-resistant callus tissue, every two weeks subcultures are once.

(3) regeneration

The resistant calli that screening obtains is transferred to NN1B2H division culture medium (N6 macroelement, N6 trace element, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, Totomycin 50mg/L, agar 10g/L, pH5.8) upper, cultivate differentiation at 25 DEG C.Seedling out of differentiation is transferred to containing resistance as upper in the MS division culture medium of Totomycin (DUCHEFA BIOCHEMIE company), is cultured to about 10cm at 25 DEG C high, moves to phytotron and is cultured to maturation.

Paddy rice in the controlled environment chamber, cultivate 12 hours at 26 DEG C by every day; At 18 DEG C, cultivate 12 hours again.

Now obtain just carrier (identical with Arabidopis thaliana, to be p2 × 35S-CKI8-pHB, Fig. 4) the antibiosis positive plant of conversion, plant has been identified and continuous observation.

Because ethene plays important promoter action in the leaf senile of plant, p2 × 35S-CKI8-pHB rice transformation extends the growth time of paddy rice, thereby improves nutritious substances accumulation, improves output.

All documents of mentioning in the present invention are all quoted as a reference in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (12)

1. a method for ethylene content or regulating plant growth proterties in regulating plant body, is characterized in that, described method comprises: the expression of CKI8 gene in regulating plant body.

2. the method for claim 1, is characterized in that, in described regulating plant body, ethylene content is reduce the interior ethylene content of plant materials or make plant hypocotyl increase, attenuate, and comprising: the expression of raising CKI8 gene in plant materials.

3. method as claimed in claim 2, is characterized in that, described method comprises: by CKI8 gene transferred plant, obtain the transgenic plant that ethylene content reduces.

4. the method for claim 1, it is characterized in that, in described regulating plant body, ethylene content is to increase in plant materials ethylene content or make plant hypocotyl shorten, increase thick, top crotch excessively to magnify, and comprising: the expression of lowering CKI8 gene in plant materials.

5. method as claimed in claim 4, is characterized in that, comprising: the lower adjustment of lowering CKI8 genetic transcription, protein expression or protein-active is proceeded in plant.

6. method as claimed in claim 5, is characterized in that, described lower adjustment is the disturbing molecule that specificity is disturbed CKI8 genetic expression; Preferably, described disturbing molecule is that CKI8 gene or its transcript are dsRNA, antisense nucleic acid, siRNA, the Microrna of inhibition or reticent target, maybe can express or form the construction of described dsRNA, antisense nucleic acid, siRNA, Microrna.

7. method as claimed in claim 5, is characterized in that, described lower adjustment is the CKI8 of inactivation form; Preferably, the CKI8 of described inactivation form be the albumen of coding with respect to the albumen of wild-type CKI8 coding, the 128th is sported the CKI8 gene mutation body of N by D, or the 38th CKI8 gene mutation body that is sported R by K.

8. the method for claim 1, is characterized in that, described plant comprises: plant of Solanaceae, cress or grass.

9. a purposes for CKI8 gene, for ethylene content in regulating plant body or regulating plant growth proterties; Or

For the preparation of the material of ethylene content in regulating plant body or regulating plant growth proterties; Or

For the maturation of delay plant fruit.

10. purposes as claimed in claim 9, is characterized in that, described CKI8 gene is for reducing ethylene content in plant materials or make plant hypocotyl increase, attenuate.

11. 1 kinds are reduced the purposes of CKI8 genetic expression or active material, and for increasing ethylene content in plant materials or make plant hypocotyl shorten, increase thick, top crotch excessively magnifies.

12. 1 kinds increase the interior ethylene content of plant materials or make plant hypocotyl shorten, increase slightly, the material that top crotch excessively magnifies, and it is CKI8 gene mutation body; The albumen of its coding is with respect to the albumen of wild-type CKI8 coding, and the 128th sports N by D, or the 38th sports R by K.