CN104278053B - A kind of method for improving drought tolerance in plants ability - Google Patents
A kind of method for improving drought tolerance in plants ability Download PDFInfo
- Publication number
- CN104278053B CN104278053B CN201310281850.9A CN201310281850A CN104278053B CN 104278053 B CN104278053 B CN 104278053B CN 201310281850 A CN201310281850 A CN 201310281850A CN 104278053 B CN104278053 B CN 104278053B
- Authority
- CN
- China
- Prior art keywords
- dos1
- plant
- polypeptides
- drought
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to a kind of method for improving drought tolerance in plants ability.A kind of TRAF like family genes are disclosed, it can reduce the transpiration rate of plant in water-stressed conditions, so as to improve drought resistance on the premise of plant normal growth development is not influenceed.The gene of the present invention can be excellently used for the improvement of plant variety, improve resistance of the plant for adverse circumstance.The present invention is that drought-enduring new crop varieties are cultivated with transgenosis equimolecular breeding technique, there is provided very valuable genetic resources.
Description
Technical field
The invention belongs to plant genetic engineering field, more particularly, it relates to a kind of drought tolerance in plants ability that improves
Method.
Background technology
In recent years, arid caused by water shortage causes a large amount of underproduction of grain in global range or even had no harvest, and agricultural product are deficient to be caused
It is one of unstable inducement in area to make substantial appreciation of prices.Existing crops, which are transformed, using modern genetic engineering means improves it to arid
Tolerance be the future of agriculture must be by selecting.The adversity gene with potential use value is found, explores it in agricultural production
On possibility purposes, the active demand for being modern agriculture is also the mission of molecular biology of plants man.
With the fast development of molecular biology of plants, the genome of a large amount of species is sequenced, so as to be reverse genetic
Road has been paved in development, but because gene is numerous, specifies the simply tip of the iceberg of function.Therefore, this area needs to reflect
Fixed and separation confrontation drought environment gene, and its degeneration-resistant border mechanism is furtherd investigate, more importantly effectively it is applied to
Production practices, to provide more preferable drought resisting novel gene in breeding.
The content of the invention
It is an object of the invention to provide a kind of method for improving drought tolerance in plants ability.
In the first aspect of the present invention, there is provided the purposes of a kind of DOS1 polypeptides or its encoding gene, it is resistance to for improving plant
Non-irrigated ability.
In a preference, the DOS1 polypeptides are additionally operable to：
Improve survival rate of the plant under drought condition；
Reduce the rate-of-loss of coolant of plant (such as plant leaf blade)；
Reduce the stomatal aperture of plant；Or
Reduce the transpiration rate of plant in water-stressed conditions.
In another preference, the DOS1 polypeptides are：
(a) such as SEQ ID NO:The albumen of amino acid sequence shown in 2；Or
(b) by SEQ ID NO:Amino acid sequence shown in 2 is by one or more (such as 1-20；Preferably 1-10；More
Good ground 1-5) amino acid residue substitution, missing or addition and formed, and with improve drought tolerance in plants ability function by
(a) albumen derived from.
In another preference, described DOS1 polypeptides derive from crucifer.
In another preference, described DOS1 polypeptides derive from arabidopsis (Arabidopsis thaliana).
In another preference, described plant includes：Grass (including Oryza, Aegilops, Agropyron, swallow
Wheat straw category, Avena, Coix, Echinochloa, Elymuss, Genus Agropyron, non-irrigated standing grain category, Eremopyrum, Hordeum, Lolium,
Panicum, Secale, sorghum, Triticum), crucifer (including Arabidopsis thaliana category, Brassica genus, Rhaphanus, shepherd's purse category, Lepidium apetalum
Category, woaded blue Shu , indian rorippa herb category, Erysimum).
In another aspect of this invention, there is provided a kind of method for improving drought tolerance in plants ability, methods described include：Improve and plant
The expression of DOS1 polypeptides or activity in thing.
In a preference, described method includes：The encoding gene of DOS1 polypeptides is transferred in plant.
In another preference, described method includes step：
(i) Agrobacterium for carrying expression vector is provided, described expression vector contains the encoding gene of DOS1 polypeptides；
(ii) plant cell, tissue or organ are contacted with the Agrobacterium in step (i), so that the DOS1 polypeptides
Encoding gene is transferred to plant.
In another preference, methods described also includes：
(iii) plant cell, tissue, organ for the encoding gene for being transferred to DOS1 polypeptides are selected；And
(iv) by the plant cell in step (iii), tissue, neomorph and genetically modified plants are selected.
In another aspect of this invention, there is provided a kind of genetically modified crops, prepared using described method, and relatively non-table
Up to the wild type crop of transgenosis, its drought-resistant ability is improved.
In another aspect of this invention, there is provided the purposes of a kind of DOS1 polypeptides or its encoding gene, as plant identification
The molecular marked compound of drought-resistance ability.
The other side of the present invention is apparent to those skilled in the art due to this disclosure
's.
Brief description of the drawings
Fig. 1, arabidopsis DOS1 genes identification.
A.DOS1 is compared with the amino acid sequence of arabidopsis SINAT families；
B. DOS1 albumen and itself interaction between other SINA family proteins in yeast；
C. the BIFC of DOS1 self-interactions is analyzed in tobacco cell.
Fig. 2, AtDOS1 expression pattern analysis.
Expression of the a-b.DOS1 genes in each organ of arabidopsis.St, stem (stem)；Fl, flower (flower)；CL,
Stem leaf (cauline leaf)；RL, lotus throne leaf (rosette leaf)；R, root (root)；Co, cotyledon (cotyledon)；
YL, tender leaf (young leaf)；ML, climax leaves (mature leaf)；ES, early stage aging leaf (yellow leaf area is less than 25%)；LS,
Late period aging leaf (yellow leaf area is more than 50%).The GUS dyeing of c-k.proDOS1-GUS transgenic arabidopsis.
C. the seed of 1 day is sprouted；
D.3 the seedling in day；
E.5 the seedling in day；
F.14 the seedling in day；
G.21 the lotus throne leaf on day plant；
H. guard cell；
I-k. flower and Fruit pod；
L. GUS expression gradually strengthens with the increase at blade age in lotus throne leaf.
Fig. 3：DOS1 tissue expression pattern under ABA processing and drought condition.
A. quantitative PCR analysis result, abscissa represent water process, ABA processing, the time (hour) of Osmotic treatment；
B.GUS staining analysis results.
Fig. 4, DOS1 Subcellular Localization.
A-b. the stable expression in the cotyledon (a) of transgenic arabidopsis and hypocotyl (b)；
C. the transient expression in tobacco leaf epidermal cells；
D. the transient expression in protoplasts of Arabidopsis thaliana broken by ultrasonic.
Fig. 5, the identification of arabidopsis dos1 mutant and Drought sensitivity analysis.
The analysis of T-DNA insertion points in a.dos1-1 and dos1-2 mutant.
B-d. the DOS1 gene expressions in arabidopsis wild type (Col-0), mutant and gDOS1 covering dos1-1 mutant
RT-PCR analyses (b), drought tolerance analysis (c) and percentage of water loss measure (d).
Fig. 6, DOS1 overexpression enhancing drought resistance and the stomatal aperture to ABA reactions.
A. in wild type and 4 independent transgenic lines DOS1 genes RT-PCR analyses.
B. growth phenotype of the different vegetable materials under drought condition.
C. the survival rate statistics after different vegetable material Osmotic treatments.
D. different vegetable material leaves water loss rate measure.
E-f. in different vegetable materials ABA induce stomatal aperture comparison (e) and measurement (f).
The expression pattern of DOS1 genes changes in Fig. 7, ABA deletion mutant or ABA sign mutation bodies.Col-0：Arabidopsis
Wild type；Aba1, aba2：ABA deletion mutants；Abi1-1C, abi2-1：ABA sign mutation bodies.
Fig. 8, AREBs and ABF3 protein activation DOS1 transcription.
A. in various ABA sign mutations bodies DOS1 mRNA level in-site.
B. the expression for the DOS1 that ABA is induced is blocked in areb1areb2abf3 tri- lacks mutant.
c-d.DOS1::LUC transient expression detection.
Fig. 9, heterologous overexpression AtDOS1 genes improve paddy drought resistance in rice.
A. the PCR identifications of transgenic paddy rice.M, DNA marker；P, plasmid positive control；N, negative control；WT, wild type water
Rice；1-16, different transgenic lines.
B. the GUS dyeing of transgenic line.
C. the expression of AtDOS1 genes is analyzed in transgenic paddy rice.
The drought resisting difference of transgenic paddy rice and wild type under D.PEG (20% processing 15 days) artificial drought conditions.D4、
D12, D13 are corresponding three transgenic lines in C.
Embodiment
The present inventor finds one kind and (improves drought tolerance in plants for regulation Genes For Plant Tolerance adverse circumstance ability by extensive research
Ability) the excessive stimulated gene 1 (Dehydration Over Stimulated1, DOS1) of useful gene-- dehydration, it is
TRAF-like family genes, it can reduce plant in water-stressed conditions on the premise of plant normal growth development is not influenceed
Transpiration rate, so as to improve drought resistance.The gene of the present invention can be excellently used for the improvement of plant variety, improve plant pair
In the resistance of adverse circumstance.The present invention is that drought-enduring new crop varieties are cultivated with transgenosis equimolecular breeding technique, there is provided
Very valuable genetic resources.
In the present invention, for being had no particular limits suitable for the plant (or crop) of the present invention, as long as it is appropriate for
The conversion operation of gene, such as various crops, flower plant or forestry plants.Described plant such as can be (unlimited
In)：Dicotyledon, monocotyledon or gymnosperm.More specifically, described plant includes but is not limited to：It is wheat, big
Wheat, rye, rice, corn, jowar, beet, apple, pears, Lee, peach, apricot, cherry, strawberry, rasp berry, blackberry, blueberry, beans, French beans, pea
Beans, soybean, rape, mustard, opium poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut, cucurbit, cucumber, west
Melon, cotton, flax, hemp, jute, citrus, lemon, grape fruit, spinach, piemarker lettuce, asparagus, cabbage, Chinese cabbage, pakchoi,
Carrot, onion, potato, tomato, green pepper, avocado, cassia bark, camphor, tobacco leaf, nut, coffee, eggplant, sugarcane, tealeaves, Hu
Green pepper, vine, oyster numb grass, banana, natural rubber tree and ornamental plant etc..
As a kind of preferred embodiment, described " plant " includes but is not limited to：Grass (including Oryza, goatweed
Category, Agropyron, oatgrass, Avena, Coix, Echinochloa, Elymuss, Genus Agropyron, non-irrigated standing grain category, Eremopyrum, barley
Category, Lolium, Panicum, Secale, sorghum, Triticum), crucifer (including Arabidopsis thaliana category, Brassica genus, radish
Category, shepherd's purse category, separate row Vegetable spp, woaded blue Shu , indian rorippa herb category, Erysimum).
The DOS1 polypeptides (albumen) of the present invention can be recombinant polypeptide, natural polypeptides, synthesis polypeptide, preferably recombinate more
Peptide.The polypeptide of the present invention can be native purified product, or the product of chemical synthesis, or thin from plant using recombinant technique
Produced in born of the same parents.
Present invention additionally comprises the fragment of DOS1 albumen, derivative and analog.As used herein, term " fragment ", " derivative
Thing " and " analog " refer to the polypeptide for the DOS1 albumen identical biological functions or activity for being kept substantially the present invention.This hair
Bright polypeptide fragment, derivative or the like can be that (i) has one or more conservative or non-conservative amino acid residues (preferably
Conservative amino acid) substituted polypeptide, and such substituted amino acid residue can be may not be by heredity
Cipher coding, or (ii) polypeptide with substituted radical in one or more amino acid residues, or the amino that (iii) is additional
The polypeptide that acid sequence is fused to this peptide sequence and formed.Belonged to according to this paper definition these fragments, derivative and analog
Scope known to those skilled in the art.
In the present invention, term " DOS1 albumen " refers to the SEQ ID NO for improving drought tolerance in plants ability:2 sequences it is more
Peptide.The term also includes having improving drought tolerance in plants ability, SEQ ID NO:The variant form of 2 sequences.These variant forms
Including (but being not limited to)：Several (it is usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10,
Also more preferably such as 1-8 or 1-5) missing, insertion and/or the substitution of amino acid, and in C-terminal and/or N-terminal addition or lack
Lose one or several (being usually within 20, within preferably 10, more preferably within 5) amino acid.For example, at this
In field, when being substituted with similar nature or similar amino acid, it will not generally change the function of protein.Again for example, in C
End and/or N-terminal addition or reduction one or several amino acid will not generally also change the function of protein.The term also wraps
Include the active fragment and reactive derivative of DOS1 albumen.
The variant form of polypeptide includes：Homologous sequence, conservative variant, allelic variant, natural mutation, induction are prominent
Albumen coded by variant, the DNA that can hybridize under the conditions of high or low stringency with DOS1 protein Ds NA.The present invention also provides
Other polypeptides, fusion protein such as comprising DOS1 albumen or its fragment.
The present invention also provides the analog of DOS1 albumen or polypeptide.The difference of these analogs and natural DOS1 albumen can be with
It is difference on amino acid sequence or does not influence the difference on the modified forms of sequence, or haves both at the same time.These are more
Peptide includes natural or induction genetic variant.Induction variant can be obtained by various technologies, such as by radiating or exposing
Random mutagenesis is produced in mutagens, can also pass through the technology of site-directed mutagenesis or other known molecular biology.Analog is also
Including the analog with the residue (such as D- amino acid) different from natural L-amino acids, and with non-naturally occurring or conjunction
Into amino acid (such as β, gamma-amino acid) analog.It should be understood that the polypeptide of the present invention is not limited to the above-mentioned representativeness enumerated
Polypeptide.
Modification (not changing primary structure generally) form includes：The chemically derived form such as acetyl of inner or in vitro polypeptide
Change or carboxylated.Modification also includes glycosylation.Modified forms also include have phosphorylated amino acid residue (such as phosphotyrosine,
Phosphoserine, phosphothreonine) sequence.Also include being modified so as to improve its anti-proteolysis performance or optimize molten
Solve the polypeptide of performance.
In the present invention, " DOS1 albumen conservative variations polypeptide " refers to and SEQ ID NO:2 amino acid sequence is compared, and is had
At most 20, preferably at most 10, more preferably at most 5, most preferably at most 3 amino acid are by property is similar or similar ammonia
Base acid is replaced and forms polypeptide.These conservative variation's polypeptides carry out amino acid substitution preferably based on table 1 and produced.
Table 1
| Amino acid residue | Representational substitution | Preferable substitution |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Present invention also offers the polynucleotide sequence for encoding DOS1 albumen of the present invention or its conservative variation's polypeptide.
The polynucleotides of the present invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or people
The DNA of work synthesis.DNA can be single-stranded or double-strand.DNA can be coding strand or noncoding strand.Encoding mature polypeptide
Coding region sequence can be with SEQ ID NO:Coding region sequence shown in 1 is identical or the variant of degeneracy.Such as this paper institutes
With " variant of degeneracy " refers to that coding has SEQ ID NO in the present invention:The albumen of 2 sequences, but with SEQ ID NO:1
The differentiated nucleotide sequence of shown coding region sequence.
Encode SEQ ID NO:The polynucleotides of 2 mature polypeptide include：The coded sequence of encoding mature polypeptide；It is ripe
The coded sequence of polypeptide and various additional coding sequences；The coded sequence (and optional additional coding sequence) of mature polypeptide and
Non-coding sequence.
Term " polynucleotides of coded polypeptide " can be included encoding the polynucleotides of this polypeptide or also include
The polynucleotides of additional code and/or non-coding sequence.
The invention further relates to the variant of above-mentioned polynucleotides, and it is encoded has the more of identical amino acid sequence with the present invention
The fragment of peptide or polypeptide, analogs and derivatives.The variant of this polynucleotides can be the allelic variant that naturally occurs or
The variant that non-natural occurs.These nucleotide variants include substitution variants, Deletion variants and insert variation.Such as this
Known to field, allelic variant is the alternative forms of a polynucleotides, it be probably one or more nucleotides substitution,
Missing or insertion, but not from substantially change its coding polypeptide function.
The invention further relates to having at least 50% between above-mentioned sequence hybridization and two sequences, preferably at least 70%,
More preferably at least polynucleotides of the 80% phase same sex.The present invention is more particularly directed under strict conditions with polynucleotides of the present invention
Interfertile polynucleotides.In the present invention, " stringent condition " refers to：(1) it is miscellaneous under compared with low ionic strength and higher temperature
Hand over and elute, such as 0.2 × SSC, 0.1%SDS, 60 DEG C；Or (2) when hybridizing added with denaturant, such as 50% (v/v) formamide, 0.1%
Calf serum/0.1%Ficoll, the phase same sex of 42 DEG C of grades or (3) only between two sequences is at least more than 80%, preferably at least
More than 90%, just hybridize when more preferably more than 95%.Also, the polypeptide of interfertile polynucleotide encoding and SEQ ID NO:
Mature polypeptide shown in 2 has identical biological function and activity.
The DOS1 protein nucleotides full length sequence or its fragment of the present invention can generally use PCR TRAPs, recombination method or people
The method of work synthesis obtains., can be especially open according to relevant nucleotide sequence disclosed in this invention for PCR TRAPs
Reading frame sequence designs primer, and with commercially available cDNA storehouses or as prepared by conventional method well known by persons skilled in the art
CDNA storehouses expand as template and obtain relevant sequence.When sequence is longer, it is often necessary to carry out twice or multiple PCR is expanded, so
Each fragment amplified is stitched together by proper order again afterwards.In addition, it can also be synthesized with artificial synthesized method
Sequence is closed, when especially fragment length is shorter.Generally, by first synthesizing multiple small fragments, sequence can be obtained by being then attached again
The very long fragment of row.
In the present invention, DOS1 protein polynucleotides can be plugged into recombinant expression carrier." recombination expression carries term
Body " refer to bacterial plasmid well known in the art, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other
Carrier.In a word, as long as can be replicated in host and stably, any plasmid and carrier can be used.One weight of expression vector
It is characterized in usually containing replication orgin, promoter, marker gene and translation control element.
Method well-known to those having ordinary skill in the art can be used to build protein coding DNA sequence containing DOS1 and suitable turn
The expression vector of record/translation control signal.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination skill
Art etc..Described DNA sequence dna can be effectively connected in the appropriate promoter in expression vector, to instruct mRNA to synthesize.Expression carries
Body also includes the ribosome bind site and transcription terminator of translation initiation.
In addition, expression vector preferably includes one or more selected markers, it is used to select conversion to provide
The phenotypic character of host cell, such as the dihyrofolate reductase of eukaryotic culture, neomycin resistance and green fluorescence egg
(GFP) in vain, or kanamycins or amicillin resistance for Escherichia coli.
When the polynucleotides of the present invention are expressed in higher eucaryotic cells, if will when inserting enhancer sequence in the carrier
Transcription can be strengthened.Enhancer is DNA cis-acting factors, generally about has 10 to 300 base-pairs, acts on and open
Mover is to strengthen the transcription of gene.
Persons skilled in the art are aware that how to select appropriate carrier, promoter, enhancer and host cell.
It can be carried out with recombinant DNA conversion host cell with routine techniques well known to those skilled in the art, convert plant
The methods of Agrobacterium-mediated Transformation or via Particle Bombardment Transformation can be used, such as leaf disk method, Rice Young Embryo conversion method etc..For the plant of conversion
Cell, tissue or organ can regenerate plant with conventional method, the plant to be changed so as to acquired character.
The transformant of acquisition can use conventional method culture, express the albumen of the present invention.According to host cell used, training
Culture medium used may be selected from various conventional mediums in supporting.Cultivated under conditions of suitable for host cell growth.Work as place
After chief cell grows into appropriate cell density, the startup of selection is induced with suitable method (such as temperature transition or chemical induction)
Son, cell is further cultured for a period of time.
Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in the cell or on cell membrane.Such as
Fruit needs, can utilize its physics, chemical and other characteristic be separated by various separation methods and the albumen of purification of Recombinant.This
A little methods are well-known to those skilled in the art.The example of these methods includes but is not limited to：The renaturation process of routine, use
Protein precipitant handles (salting-out method), centrifugation, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel filtration), suction
The combination of attached chromatography, ion-exchange chromatography, high performance liquid chroma- tography (HPLC) and other various liquid chromatography technologies and these methods.
The invention further relates to a kind of method of Crop Improvement, this method includes improving the expression of DOS1 genes in the plant
Or protein active.So that the plant has more excellent degeneration-resistant border (particular against arid) ability.
The method for increasing DOS1 gene expressions is well known in the art.For example, DOS1 encoding genes can be carried by being transferred to
Expression construct make plant be overexpressed DOS1；Or it can be driven by using strong promoter so as to strengthen the expression of DOS1 genes；Or
Person strengthens the DOS1 genes by enhancer (such as rice waxy genes First Intron, Actin genes First Intron)
Expression.Include but is not limited to suitable for the strong promoter of the inventive method：35S promoter, rice, the Ubi promoters of corn
Deng.
As a kind of preferred embodiment of the present invention, the method for obtaining the plant of the high expression of DOS1 is as follows：
(1) Agrobacterium for carrying expression vector is provided, described expression vector contains the DNA encoding sequence of DOS1 albumen；
(2) plant cell or tissue or organ are contacted with the Agrobacterium in step (1), so that DOS1 protein Ds NA
Coded sequence is transferred to plant cell, and is incorporated on the chromosome of plant cell；
(3) plant cell or tissue for being transferred to the DOS1 protein DNA coding sequences are selected；With
(4) by the plant cell in step (3) or regeneration into plant.
Wherein, any appropriate conventional meanses, including reagent, temperature, pressure condition etc. can be used to implement the method.
Present invention additionally comprises DOS1 albumen or the activator of its encoding gene.Because DOS1 activator can adjust DOS1's
Activity or expression, therefore, described DOS1 activator also can be by improving the degeneration-resistant border ability of plant to DOS1 influence
(particular against arid), so as to reach the purpose of character improvement.
Described DOS1 activator refers to any activity for improving DOS1, the stability for maintaining DOS1, promotes DOS1
Expression, the material for extending DOS1 effective acting times or promoting DOS1 transcription and translation, these materials are used equally for this hair
It is bright, as degeneration-resistant border (particularly arid) useful material of ability for improving plant.
In addition, the DOS1 albumen or its encoding gene of the present invention are alternatively arranged as a kind of tracking of genetic transformation progeny of plants
Mark, or can be as the mark for judging drought tolerance in plants ability.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as J. Pehanorm Brookers etc. are write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or
According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and number are calculated by weight.
Unless otherwise defined, anticipated known to all specialties used in text and scientific words and one skilled in the art
Justice is identical.In addition, any method similar or impartial to described content and material all can be applied in the present invention.Described in text
Preferable implementation only present a demonstration and be used with material.
1. experiment material
Experiment vegetable material used includes：
(1) arabidopsis (Arabidopsis thaliana)：Columbia (Col-0) and Ler is environmental (being purchased from ABRC).
(2) mutant abi1-1C (Umezawa T et al., Journal of Plant Research, Volume124, Issue4,
pp437-453；2009), abi2-1 (Ler) (Leung et al., The Plant Cell, 9,759-771；1997), abi3-
8 (Nambara, E., Suzuki, M. etc. (2002), Genetics161,1247-1255；Tamuraet al., 2006), abi4-
1 (Finkelstein RR etc. (1998)；Plant Cell10(6):1043-1054), abi5-7 (Nambara et al.,
2002;Tamura et al., 2006), aba1, aba2-1 (GONZALEZ-GUZMAN et al., Plant Cell, 14,
Mutant that 1833-46,2002), areb1areb2abf3 tri- is mutated (Takuya Yoshida, The Plant Journal,
Vol61Issue4, pp.1041-1052,2010).
(3) arabidopsis growth conditions is 23 ± 1 DEG C, and 14h illumination/10h is dark.
(4) tobacco：The growth conditions of Ben's tobacco is 23 ± 1 DEG C, and 14h illumination/10h is dark；The life of SR-1 tobacco breds
Elongate member is 25 DEG C, and 16h illumination/8h is dark.
(5) rice ZH11：Growth conditions is 28 ± 1 DEG C, and 16h illumination/8h is dark.
Experiment bacterial strain uses therefor includes：
(1) coli strain：DH5α；DE3；BL21Codon Plus；
(2) agrobacterium strains GV3101 (being used for transformation of Arabidopsis thaliana) (Clough and Bent, 1998)；EHA105 (is used for
Rice conversion) (referring to Hood, E.E. etc., Transgenic Res., 1993,2,208-218)；
(3) yeast strain AH109 (Clontech, Shanghai).
2. experimental method
(1)PromoterDOS1::GUS plant expression vector constructions and GUS dyeing
AtDOS1 upstream gene group DNA sequence dna (primer is expanded with PCR method：PrDOS1-F：5’
GGATAGAGACATAAACGAAGCTCGG3’(SEQ ID NO:And PrDOS1-R 3)：5’
TTCGCAGGAATTAATGAATTCACAA3’(SEQ ID NO:4)), at the supreme UTR of gene 3 ' of about 1kb, it is connected into
PBluescript KS (EcoR V is cut) picking reverse clonings afterwards.Sequencing is verified, after EcoRI and BamH I double digestions
PCAMBIA1300 is connected to (referring to http://www.bios.net/daisy/cambia/585.html#dsy585_gus_
Intron, carry GUS enzyme cDNA) EcoRI/BamHI multiple cloning sites in, obtain pCAMBIA1301-AtDOS.It is transferred to agriculture bar
Bacterium GV3101 simultaneously infects arabidopsis.After obtained transgenic seedlings are sprouted 1 week, whole strain positive seedling is dipped in GUS dyeing liquors and (matched somebody with somebody
Method processed is：10.33g NaHPO are dissolved in 500ml distilled water successively4·12H2O、3.3g NaH2PO4·2H2O、0.0823g
K3[Fe(CN)6]、0.1056g K4[Fe(CN)6] and 250ul Triton X-100), vacuumize 5 minutes, 37 DEG C of incubated overnights
Material 37 DEG C of decolourings, is changed into 3-5 ethanol to take pictures after thoroughly decolouring and under the microscope in 75% ethanol afterwards.
(2) AtDOS1 Overexpression vectors structure and Agrobacterium-mediated Transformation
The whole strain RNA of arabidopsis is extracted, after reverse transcription turns into cDNA, with DOS1-F：5’
CATATGGAACCTCGAATCAATGAC3’(SEQ ID NO:And DOS1-R 3)：5’TCATATCGAAACAGGCTGTTCTCTC3’
(SEQ ID NO:4) it is primer, PCR obtains the AtDOS1 complete fragment of gene.It is connected into Ligation high kits
Into pBluescript KS (EcoR V is cut) intermediate carrier, sequencing is verified.Choose positive clone, using BamHI and
Two restriction enzyme sites of SalI cut AtDOS1 genetic fragments from pBluescript KS carriers, and are connected into plant expression vector
In pCAMBIA1301.It is standby that the pCAMBIA1301-AtDOS1 built is transferred to Agrobacterium GV3101.Agrobacterium-mediated Transformation uses rifle
Head titration column cap method：The arabidopsis seedling just bloomed is chosen, every transfection in 3-5 days once, continuously transfects 3 to 5 (Clough and
Bent, 1998).
(3) structure of Yeast expression carrier and conversion
AtDOS1 genes are cut from intermediate carrier with NdeI and SalI, is connected on pGAD and pGBK and obtains AD-DOS1
With two carriers of BK-DOS1, each carrier extracts a small amount of plasmid in case the experiment of next step yeast conversion is used.The AD- that will be obtained
DOS1 and BK-DOS1 respectively takes 5ul to enter yeast AH109 according to Clontech standard step corotation, respectively in 4 kinds of different nutrition
Taken pictures after being grown 48 hours on deficiency SD culture mediums (being purchased from Clonetech, Shanghai), four kinds of auxotroph SD culture mediums point
It is not：- Leu ,-Trp ,-Leu-Trp-His-Ade and-Leu-Trp-His-Ade+X- α Gal.Turn empty carrier simultaneously
PGAD and pGBK is as control.
(4) in tobacco cell bimolecular fluorescence interaction (BiFC)
By coded sequence (the GenBank accession number of firefly fluorescin LUC (Luciferase) aminoterminal
AJ277960.1 sequence 1-387 amino acids) and c-terminus coded sequence (GenBank accession number AJ277960.1's
Sequence 388-555 amino acids) respectively with AtDOS1DNA (SEQ ID NO:1) fusion obtains LUCN- AtDOS1 and LUCC-
It is transferred to after AtDOS1 in Agrobacterium GV3101 and converts Ben's tobacco (Nicotiana tabacum cv.), leaf is taken after 48 hours
The presence or absence of fluorescence is first observed in Confocal in the piece back side.The LUC that will be built simultaneouslyN- AtDOS1 and LUCC- AtDOS1 respectively and
Corresponding empty carrier LUCCAnd LUCNFor co-injection tobacco as negative control, method is shown in Gou et al. (2011).
(5) AtDOS1 albumen positions
PMON520-eYFP carriers are purchased from Clonetech.
PA7-YFP carriers are purchased from Clonetech.
(construction method is structure pMON530-eYFP-DOS1 carriers：DOS1 is cut and is connected into BamHI and SalI
On pMON520-eYFP carrier Bs glII and XhoI), and injection Ben's tobacco back side blade after Agrobacterium GV3101 is transferred to, 2 to 3
Clip back side blade is in the micro- Microscopic observation assignment of genes gene mapping situations of Confocal after it.
Meanwhile also build PA7-DOS1-YFP carriers (construction method is：The DOS1 for having removed terminator codon is passed through
Be connected into after BamHI and SpeI digestions on the PA7-YFP carriers of same digestion) taken out greatly with QIAGENE kits after converted by PEG
Protoplasts of Arabidopsis thaliana broken by ultrasonic cell, Subcellular Localization situation is first observed in Zess Confocal microscopes.
(6) arabidopsis Osmotic treatment and percentage of water loss measure
Sprout the Arabidopsis thaliana Seedlings of 5 days be transferred in soil cultivated 3 weeks under normal growing conditions after start to stop watering, and
Continue culture 3 weeks, observe the phenotype under drought condition.In order to carry out the measure of percentage of water loss, will be cultivated 4 weeks under same growth conditions
Wild type, mutant and DOS1 be overexpressed each 10 blades of strain and cut, weighed up respectively according to designed interval time fresh
Weight, the fresh weight at each time point and the fresh weight of start time point are than as percentage of water loss.Experiment carries out 3 biology and repeated.
(7) measurement of stomatal aperture
Peel leaf epidermis from the culture arabidopsis lotus throne leaf of 4 weeks, and immerse solution (10mM KCl, 10mM Mes-Tis,
50 μM of CaCl2, pH6.15) under light (100 μm of ol/m2/s) place 3 hours.Then, 0 (control) or 50 μ are added in the solution
M abscisic acids (ABA) are handled 2 hours, and stomata is observed under microscope (Nikon, 40X) and measures the length and width of stomata perforate
Degree.Each sample measures 30-50 stomata respectively, and carries out 3 biology and repeat, and then carries out biometric
(Student’s T test)。
(8) RT-PCR and Real-Time PCR are analyzed
Using Trizol reagent (TAKARA, Japan) extract plant RNA and using ReverTra Ace (TOYOBO,
Japan) reverse transcription is into cDNA.RT-PCR the primers are：
RT-DOS1F：5’AACCGTACAATTGTCCACACTCAGG3’(SEQ ID NO:5), and
RT-DOS1R：5’TTCAGCTCCTTGTCGGTGGTGTT3’(SEQ ID NO:6).
At actin2F：5’GGAAGGATCTGTACGGTAAC3’(SEQ ID NO:7), and
At actin2R：5’GGACCTGCCTCATCATACT3’(SEQ ID NO:8).
OsUbi1-F：5’GACGGACGCACCCTGGCTGACTAC3’(SEQ ID NO:9), and
OsUbi1-R：5’TGCTGCCAATTACCATATACCACGAC3’(SEQ ID NO:10).
Reaction process is：95℃1min；95 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 15s, 30 circulations；72 DEG C, 5min.Real-
Time PCR operate according to SYBR Green Realtime PCR Master Mix (TOYOBO) specification.
(9) genetic transformation of rice
A) induction of Mature Embryos of Rice callus：Rice varieties ZH11 seed shells, and soaks 1min with 70% ethanol,
After 20% (v/v) liquor natrii hypochloritis soaks 20min (period constantly rocks), fully washed 3-5 times with sterilized water.Aseptic filter paper
It is seeded in after blotting on NB calli induction medias, callus particle is inoculated in new NB by 26-28 DEG C of light culture after 4 weeks
Light culture 4 days is standby on calli induction media；
B) conversion the previous day (contains the Agrobacterium inoculation containing pCAMBIA1301-AtDOS1 plasmids in LB culture mediums
Kan50ug/ml, Rif25ug/ml) in, 28 DEG C of 200rpm concussion and cultivates (overnight) to OD660 are 0.6-0.8；
C) callus is transferred in a sterile triangular flask, pours into cultured Agrobacterium bacterium solution and (allow bacterium solution to submerge
Callus)；
D) room temperature places 20min, during which gently rocks several times；
E) go bacterium solution and callus be transferred on aseptic filter paper to draw unnecessary bacterium solution, then go to NB and co-culture on base,
Co-cultured 2-3 days under 20-25 DEG C of dark condition；
F) callus after co-cultivation is transferred in sterile triangular flask, first with sterile water washing 2-3 times, then with containing
The sterile water washing 20min of 500ml/L carbenicillins；
G) after blotting excessive moisture on aseptic filter paper, it is (special containing 200mg/L that callus is transferred to NB screening and culturing mediums
The screening of transformed cells is carried out on Mei Ting and 50mg/L hygromycin (being purchased from Shanghai past biotech firm), 3 weeks are a cycle,
Screen 2-3 cycle；
H) kanamycin-resistant callus tissue after screening is transferred to after cultivating 1 week on pre- differential medium, then goes to NB differential mediums【Contain
6-benzyl aminopurine (BAP) 2mg/L and methyl α-naphthyl acetate (NAA) 0.5mg/L】Upper culture, condition are 26 DEG C, and 16h illumination/8h is dark；
I) the resistance regeneration plant differentiated is transferred to strengthening seedling and rooting on root media (containing 1/2MS+NAA0.5mg/L)；
J) after about 3 weeks, the regeneration resistant plant taken root is transplanted into greenhouse.
(10) PEG simulating droughts processing rice
Wild type after sprouting 1 week and Transgenic Rice Seedlings are planted into same Culture basin (different transgenosis respectively
Strain is planted in different Culture basins), normally pour Aquaponic 2 weeks, then use 200ml20%PEG aqueous solution continuous pourings daily
12-15 days, during which observe phenotype and take pictures in time.
(2) DOS1 gDNA complemented mutant bodies dos1
DOS1 full-length genomes DNA fragmentation is plus 629bp initiation codons upstream and 247bp termination codon cloned downstreams in
Between clone pBlueScript SK-, be connected into pCAMBIA1300 (referring to http with EcoRI and SalI digestions://
www.bios.net/daisy/cambia/585.html).Transgenic method is shown in Clough, S.J., and Bent, A.F.
(1998).Plant J.16,735–743。
3rd, embodiment
Embodiment 1, the separation of AtDOS1 genes and protein-interacting
With SINAT5 albumen (GenBank accession number AAM11573) in TAIR10 databases (http://
Www.arabidopsis.org/) in carry out sequence alignment, find a TRAF-like albumen, be named as AtDOS1 (Fig. 1 a,
DOS1 is abbreviated as in figure).
Chip analysis shows that AtDOS1 albumen is induced by arid and ABA, prompts the albumen to participate in abiotic stress anti-
Should.SINA domains are one of mediating proteins interaction very conservative domains, due to AtDOS1 lacked SINA families its
The RING domains of the necessary mediation substrate protein ubiquitination degraded of his member, but AtDOS1 c-terminus have one it is conservative
SINA-like domains, the homologous or heterologous dimerization of possible mediating proteins.
The double miscellaneous results of yeast prove that AtDOS1 can be with self-interaction (Fig. 1 b).By entering in tobacco cell
Row BiFC analyses are further verified (Fig. 1 c).
The tissue expression pattern of embodiment 2, AtDOS1
Real-time experimental results show (Fig. 2 a-b) that AtDOS1 is high in the root and lotus throne leaf of arabidopsis to express, and
Its hetero-organization such as stem and spend middle expression quantity relatively low.
PromoterDOS1::GUS staining analysis also demonstrates the above results.GUS dyeing simultaneously also shows the gene in gas
Specifically expressing in hole, prompting the drought resistance of the gene and plant has substantial connection.Real-time PCR and GUS coloration result are all
It has been shown that, AtDOS1 high expression in development later stage old leaf, prompt AtDOS1 drought resistance function (may scheme from the later stage of development
2c-l)。
Embodiment 3, AtDOS1 are induced by ABA and drought stress
Chip data shows that AtDOS1 expression quantity significantly raises after by arid and ABA inductions, and the present inventor is to this
Gene has been carried out gradient sampling in 0,3,6,12,24 hour by induction situation, and has carried out expression quantity using Real-time PCR
The detection of change.Experimental data is shown, compared with compareing (water process), AtDOS1 is with the extension up-regulation times of Osmotic treatment time
Number substantially increases, and about 80 times are risen compared with before processing after 24 hours Osmotic treatments.And after being handled 6 hours with 100 μm of ABA, should
The expression of gene reaches untreated preceding more than 40 times (Fig. 3).
Embodiment 4, AtDOS1 albumen are primarily targeted for nucleus and cytoplasm
PMON530-eYFP-DOS1 carriers are built, arabidopsis is transferred to and establishes transfer-gen plant.Transgenic arabidopsis is detected to plant
YFP-AtDOS1 fluorescence distribution, finds specifically expressing (Fig. 4 a-b) in guard cell's (stomata) in strain.
Build pMON530-eYFP-DOS1 carriers, in Tobacco Epidermis transient expression YFP-AtDOS1 and intend south
Transient expression AtDOS1-YFP is shown in mustard protoplasm somatocyte, and AtDOS1 albumen is primarily targeted in nucleus and cytoplasm
(Fig. 4 c-d).Structure PA7-DOS1-YFP carriers pass through PEG arabidopsis thaliana transformation protoplasm somatocytes.
Embodiment 5, arabidopsis dos1 mutant are to arid sensitive
In order to study the biological function for understanding DOS1, the present inventor separated 2 Arabidopsis Mutants (dos1-1 and
Dos1-2), RT-PCR results are shown, DOS1 expression deletion (Fig. 5 a-b) in the two mutant.
The growing state of mutant is observed, and compared with wild type.Under normal growing conditions, the life of this 2 mutant
Long development does not have significant difference with wild type；Under the conditions of various Stress treatments, 2 mutant sprout stage and seedling in seed
There is no notable difference in the phenotype of stage and wild type, but shown as in the seedling stage of Osmotic treatment, 2 mutant than open country yet
The sensitive phenotype of raw type, it is wild type phenotype that with DOS1 gDNA complementations mutant dos1 phenotypes can be made to recover (Fig. 5 c-d).
Embodiment 6, overexpression DOS1 can improve the drought resistance of transgenic arabidopsis
The AtDOS1 genes (being included in pCAMBIA1301-AtDOS1) that 35S starts are transferred to arabidopsis, are obtained 20
Multiple transgenic lines, wherein 10 strains receive T1 for seed, selection wherein 4 strains (4,6,7 and 8) progress RT-PCR inspections
Survey, show all to be overexpressed DOS1 (Fig. 6 a) in this 4 strains.Arabidopsis wild type, the mutant of 4 weeks will be grown in soil
(dos1-1, dos1-2) and DOS1 are overexpressed (35S::DOS1 transgenic line control water) 3 weeks, them are observed to arid
Tolerance, the results showed that, major part wild type loses water meter type during control water 3 weeks, and mutant is more serious than wild type dehydration, and mistake
The dehydration situation for expressing DOS1 transgenic line is better than wild type (Fig. 6 b).
After measured, the survival rate of expression DOS1 transgenic line is turned over apparently higher than wild type, and mutant is than wild
Type survival rate is lower (Fig. 6 c).
Leaves water loss rate determination result shows that wild type and mutant will be considerably slower than by being overexpressed the rate-of-loss of coolant of strain
(Fig. 6 d).
These results indicate that the drought resistances of genetically modified plants can be improved by being overexpressed DOS1, and stomatal aperture measurement result
It has been shown that, the stomatal aperture that strain is overexpressed after ABA processing are less than wild type, and the stomatal aperture of mutant be greater than it is wild
Type (Fig. 6 e-f).The reduction of stomatal aperture effectively reduces the transpiration rate of plant in water-stressed conditions.
Embodiment 7, drought-induced DOS1 expression belong to ABA dependent forms
DOS1 expression is by ABA and drought-induced, therefore the present inventor speculates that DOS1 participates in the drought resistence way of ABA mediations
Footpath.Therefore, the present inventor analyzes ABA deletion mutants (aba1 and aba2-1) and ABA after ABA (100uM) or drought stress
The expression of DOS1 genes, Real-time PCR results are shown in sign mutation body (abi1-1C and abi2-1), the arid side of body
The expression for compeling the DOS1 of induction is all blocked in all mutant, and the DOS1 of ABA inductions expression is then only dashed forward in ABA signals
It is blocked in variant abi1-1C and abi2-1, this shows that the DOS1 of arid and ABA inductions expression needs ABI1 and ABI2 to mediate
ABA signals transduction (Fig. 7).
The present inventor further have detected the expression of the DOS1 that ABA is induced in other abi mutant.In abi4-1 and
ABA is remarkably decreased to DOS1 induced expression in two mutant of abi5-7, and is not changed then in abi3-8, and this shows ABI4
With ABI5 positive regulators DOS1 expression (Fig. 8 a).The present inventors have additionally discovered that in the mutant that areb1areb2abf3 tri- is mutated
The DOS1 of ABA inductions expression is greatly affected (Fig. 8 b).AREB1, AREB2 and ABF3 are ABRE- in drought stress reaction
Play three main transcription factors (Yoshida etc., 2010) of coordinated regulation in the ABA signal pathways of dependence, and
AtDOS1 promoter region is the inventors discovered that ABRE motif (ABA reaction original paper), in order to understand fully whether DOS1 is straight
Receive the regulation and control of these transcription factors, (DOS1 is opened the present inventor in DOS1 promoter by fluorescin LUC genes direct construction
Mover (from upstream from start codon 629bp) is connected into pGreenII0800-LUC (Hellens et by BamHI and SalI
Al., carry out transient expression under 2005) and in protoplasts of Arabidopsis thaliana broken by ultrasonic, at the same by AREB1, AREB2 of 35S promoter driving,
As effector, (the total length CDS that PCR is obtained is cloned into pBlue ScriptSK- to ABF3 and ABI5, connects by BamHI and SalI
Enter pGreenII62-SK) (effectors) (Fig. 8 c), (Hellens et al.2005) and by the use of ABI5 as negative control, as a result
Show that AREB1, AREB2 and ABF3 can induce LUC expression (Fig. 8 d).
Embodiment 8, overexpression AtDOS1 can improve the drought resistance of transgenic paddy rice in rice
The 35S AtDOS1 driven gene constructed are converted on pCAMBIA1301 carriers (pCAMBIA1301-AtDOS1)
Rice ZH11, individual transgenic line (Fig. 9 A) more than 10 is obtained, identifies AtDOS1 genes through PCR, GUS dyeing and RT-PCR and exist
Integration and overexpression (Fig. 9 B-C) in transgenic paddy rice.By sprout 2 weeks after three strains of transgenic paddy rice (D4, D12 and
D13 T1) is planted in same Culture basin for seedling and wild type, and under the conditions of phjytotron (28 DEG C, 16h illumination/8 hour
It is dark) continue culture 1 week, then tested with PEG processing (the PEG aqueous solution 200ml/ basins for pouring 20% daily) simulating drought.
Experimental result shows that AtDOS1 is overexpressed weaker D4 drought resistance and wild type is distinguished less, and AtDOS1 mistakes
The stronger transgenic line D12 and D13 of expression growth conditions after PEG processing are significantly better than wild type, show preferably anti-
Drought (Fig. 9 D).
All it is incorporated as referring in this application in all documents that the present invention refers to, it is independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can
To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (6)
- A kind of 1. purposes of DOS1 polypeptides or its encoding gene, for improving drought tolerance in plants ability；The DOS1 polypeptides are：Such as SEQ ID NO:The albumen of amino acid sequence shown in 2；Described plant is grass or crucifer.
- 2. purposes as claimed in claim 1, it is characterised in that the DOS1 polypeptides are additionally operable to：Improve survival rate of the plant under drought condition；Reduce the rate-of-loss of coolant of plant；Reduce the stomatal aperture of plant；OrReduce the transpiration rate of plant in water-stressed conditions.
- 3. a kind of method for improving drought tolerance in plants ability, methods described include：Improve the expression of DOS1 polypeptides or activity in plant； The DOS1 polypeptides are：Such as SEQ ID NO:The albumen of amino acid sequence shown in 2；Described plant is grass or cross Flower section plant.
- 4. method as claimed in claim 3, it is characterised in that described method includes：The encoding gene of DOS1 polypeptides is turned Enter in plant.
- 5. method as claimed in claim 4, it is characterised in that described method includes step：(i) Agrobacterium for carrying expression vector is provided, described expression vector contains the encoding gene of DOS1 polypeptides；(ii) plant cell, tissue or organ are contacted with the Agrobacterium in step (i), so that the coding of the DOS1 polypeptides Gene transferred plant.
- 6. the purposes of a kind of DOS1 polypeptides or its encoding gene, the molecular marked compound of the drought-resistance ability as plant identification；It is described DOS1 polypeptides are：Such as SEQ ID NO:The albumen of amino acid sequence shown in 2；Described plant is grass or Cruciferae Plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310281850.9A CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310281850.9A CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104278053A CN104278053A (en) | 2015-01-14 |
| CN104278053B true CN104278053B (en) | 2017-11-10 |
Family
ID=52253396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310281850.9A Expired - Fee Related CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104278053B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148355B (en) * | 2016-06-30 | 2019-08-06 | 中国人民解放军第二军医大学 | Application of the woaded blue IiAP2/ERF049 gene in regulation Lignanoids compounds synthesis |
| CN110663540A (en) * | 2019-09-27 | 2020-01-10 | 金华市农业科学研究院 | Breeding method of high-yield tea seed variety |
| CN114073224B (en) * | 2021-09-30 | 2022-09-23 | 中国热带农业科学院海口实验站 | Avocado water culture method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445553A (en) * | 2009-01-09 | 2009-06-03 | 湖南农业大学 | Paddy drought resistance gene OsSINAT5 and encoding protein and application thereof |
-
2013
- 2013-07-05 CN CN201310281850.9A patent/CN104278053B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445553A (en) * | 2009-01-09 | 2009-06-03 | 湖南农业大学 | Paddy drought resistance gene OsSINAT5 and encoding protein and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| GenBank Accession Number: AAK43990.1;Yamada,K.等;《Genbank》;20020918;1-2页 * |
| The tumor necrosis factor receptor-associated factor (TRAF)-like family protein SEVEN IN ABSENTIA 2 (SINA2) promotes drought tolerance in an ABA-dependent manner in Arabidopsis;Yan Bao等;《New Phytologist》;20131218;第202卷;174-187页 * |
| Transcription Factor RAP2.2 and Its Interacting Partner SINAT2: Stable Elements in the Carotenogenesis of Arabidopsis Leaves;Ralf Welsch等;《Plant Physiology》;20071130;第145卷;1073-1085页 * |
| 拟南芥DOS1/CE01及CE02在胁迫反应中的功能研究;夏金婵;《中国优秀硕士学位论文全文数据库基础科学辑》;20050915(第5期);摘要，正文第31-34页3.2.2部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104278053A (en) | 2015-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN110643618B (en) | Jatropha curcas MYB transcription factor JCMYB16 gene and application thereof in improving drought resistance of plants | |
| CN106868021B (en) | Gene OsNAC1 for controlling rice seed size and application thereof | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN110628808B (en) | Arabidopsis AtTCP5 gene and application thereof in regulating plant height | |
| CN102459615B (en) | Drought tolerant plants | |
| CN112080515B (en) | UP gene and application thereof in plant improvement | |
| CN103387609B (en) | A kind ofly improve gene of Genes For Plant Tolerance adverse circumstance ability and uses thereof | |
| CN105524152B (en) | Rice high-temperature resistant gene and application thereof in crop high-temperature resistant breeding | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN106148390A (en) | CHY zinc finger protein transcriptional activation cofactor and application thereof | |
| CN104561084A (en) | Transcription factor SPL9-2 for promoting advanced heading of Chinese cabbage and application of transcription factor SPL9-2 | |
| CN101809155A (en) | Transgenic plants with increased stress tolerance and yield | |
| CN104278053B (en) | A kind of method for improving drought tolerance in plants ability | |
| CN101935342B (en) | Moth orchid development B gene-PhAP3 coded sequence and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN106591324B (en) | Millet SiASR4 gene and application | |
| JP2003047466A (en) | New rice gene controlling salt stress resistance | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN109112135A (en) | Application of the OsREP4 gene in control paddy drought resistance | |
| JP2012507263A (en) | Glutamate decarboxylase (GAD) transgenic plants exhibiting altered plant structure | |
| CN101781363B (en) | Protein regulating development of plants and encoding gene and application thereof | |
| CN114990137B (en) | Arabidopsis thaliana calbindin gene AtCAREF and application thereof | |
| CN108004248B (en) | Application of cucumber calcium binding protein gene CsCaM in improvement of plant heat resistance | |
| CN114703199B (en) | Plant drought resistance related gene TaCML46 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200609 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171110 Termination date: 20200705 |