CN104278053A - Plant drought resistance ability improving method - Google Patents
Plant drought resistance ability improving method Download PDFInfo
- Publication number
- CN104278053A CN104278053A CN201310281850.9A CN201310281850A CN104278053A CN 104278053 A CN104278053 A CN 104278053A CN 201310281850 A CN201310281850 A CN 201310281850A CN 104278053 A CN104278053 A CN 104278053A
- Authority
- CN
- China
- Prior art keywords
- dos1
- plant
- polypeptide
- drought
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a plant drought resistance ability improving method, and discloses a TRAF (TNF receptor associated factor)-like family gene, which can reduce the transpiration rate of plants in the water shortage situation so as to improve drought resistance in the premise of not affecting the normal growth and development of the plants. The TRAF (TNF receptor associated factor)-like family gene can be perfectly applied in improvement of plant varieties and improvement of plant resistance to adversity. The method uses transgenosis and other molecular breeding technologies to breed new drought tolerant varieties of crops, and provides very valuable gene resources.
Description
Technical field
The invention belongs to plant genetic engineering field, more particularly, the present invention relates to a kind of method improving drought tolerance in plants ability.
Background technology
In recent years, the arid that lack of water causes causes a large amount of underproduction of grain in global range even to be had no harvest, and agricultural-food scarcity causes substantial appreciation of prices to be one of regional unstable inducement.Utilize modern genetic engineering means transform existing farm crop improve its to the tolerance of arid be the future of agriculture must by selecting.Find and there is the adversity gene of potential use value, explore its possible purposes in agriculture production, the mission of to be the active demand of modern agriculture be also molecular biology of plants man.
Along with the fast development of molecular biology of plants, the genome of a large amount of species is checked order, thus has paved road for carrying out of reverse genetics, but due to gene numerous, specify the just tip of the iceberg of function.Therefore, this area needs qualification and the gene being separated antagonism drought environment, and furthers investigate its degeneration-resistant border mechanism, more importantly effectively it is applied to production practice, for breeding providing better drought resisting novel gene.
Summary of the invention
The object of the present invention is to provide a kind of method improving drought tolerance in plants ability.
In a first aspect of the present invention, provide the purposes of a kind of DOS1 polypeptide or its encoding gene, for improving drought tolerance in plants ability.
In a preference, described DOS1 polypeptide also for:
Improve the survival rate of plant under drought condition;
Reduce the rate-of-loss of coolant of plant (as plant leaf);
Reduce the stomatal aperture of plant; Or
Reduce plant transpiration rate in water-stressed conditions.
In another preference, described DOS1 polypeptide is:
(a) albumen of aminoacid sequence as shown in SEQ ID NO:2; Or
(b) by aminoacid sequence shown in SEQ ID NO:2 through one or more (as 1-20; Preferably 1-10; More preferably 1-5) replacement of amino-acid residue, disappearance or interpolation form, and have the albumen derivative by (a) improving drought tolerance in plants ability function.
In another preference, described DOS1 polypeptide derives from cress.
In another preference, described DOS1 polypeptide derives from Arabidopis thaliana (Arabidopsis thaliana).
In another preference, described plant comprises: grass (comprises Oryza, Aegilops, Agropyron, oatgrass, Avena, Coix, Echinochloa, Elymus, Genus Agropyron, drought standing grain belongs to, Eremopyrum, Hordeum, lolium, Panicum, Secale, sorghum, Triticum), (comprise mouse ear mustard to belong to, Brassica genus, Rhaphanus, shepherd's purse belongs to cress, separate row Vegetable spp, woaded blue Shu ， Han Lepidium, Erysimum).
In another aspect of this invention, provide a kind of method improving drought tolerance in plants ability, described method comprises: the expression or the activity that improve DOS1 polypeptide in plant.
In a preference, described method comprises: proceeded in plant by the encoding gene of DOS1 polypeptide.
In another preference, described method comprises step:
I () provides the Agrobacterium of carrying expression vector, described expression vector contains the encoding gene of DOS1 polypeptide;
(ii) vegetable cell, tissue or organ are contacted with the Agrobacterium in step (i), thus make the encoding gene of described DOS1 polypeptide proceed to plant.
In another preference, described method also comprises:
(iii) vegetable cell, tissue, the organ of the encoding gene having proceeded to DOS1 polypeptide is selected; And
(iv) by the vegetable cell in step (iii), tissue, neomorph select transgenic plant.
In another aspect of this invention, provide a kind of genetically modified crops, the method preparation described in utilization, and its drought-resistant ability of wild-type crop of non-express transgenic is improved relatively.
In another aspect of this invention, provide the purposes of a kind of DOS1 polypeptide or its encoding gene, as the molecular marked compound of the drought-resistance ability of plant identification.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
The qualification of Fig. 1, Arabidopis thaliana DOS1 gene.
A.DOS1 compares with the aminoacid sequence of Arabidopis thaliana SINAT family;
B. DOS1 albumen and the interaction between self and other SINA family proteins in yeast;
C. in tobacco cell, the BIFC of DOS1 self-interaction analyzes.
The expression pattern analysis of Fig. 2, AtDOS1.
The expression level of a-b.DOS1 gene in each organ of Arabidopis thaliana.St, stem (stem); Fl, flower (flower); CL, stem leaf (cauline leaf); RL, lotus throne leaf (rosette leaf); R, root (root); Co, cotyledon (cotyledon); YL, tender leaf (young leaf); ML, climax leaves (mature leaf); ES, early stage old and feeble leaf (yellow leaf area is less than 25%); LS, aging leaf in late period (yellow leaf area is greater than 50%).The GUS dyeing of c-k.proDOS1-GUS transgenic arabidopsis.
C. the seed of 1 day is sprouted;
D.3 the seedling in sky;
E.5 the seedling in sky;
F.14 the seedling in sky;
G.21 the lotus throne leaf on sky plant;
H. guard cell;
I-k. flower and fruit pod;
L. in lotus throne leaf, the expression of GUS strengthens gradually with the increase at blade age.
The tissue expression pattern of DOS1 under Fig. 3: ABA process and drought condition.
A. quantitative PCR analysis result, X-coordinate represents the time (hour) of water treatment, ABA process, Osmotic treatment;
B.GUS staining analysis result.
The Subcellular Localization of Fig. 4, DOS1.
A-b. the stably express in the cotyledon (a) and hypocotyl (b) of transgenic arabidopsis;
C. the transient expression in tobacco leaf epidermal cells;
D. the transient expression in protoplasts of Arabidopsis thaliana broken by ultrasonic.
The qualification of Fig. 5, Arabidopis thaliana dos1 mutant and Drought sensitivity analysis.
The analysis of T-DNA insertion point in a.dos1-1 and dos1-2 mutant.
B-d. Arabidopis thaliana wild-type (Col-0), mutant and the gDOS1 DOS1 genetic expression RT-PCR covered in dos1-1 mutant analyzes (b), drought tolerance analysis (c) and percentage of water loss and measures (d).
The process LAN of Fig. 6, DOS1 strengthens drought resistance and the stomatal aperture to ABA reaction.
A. wild-type and 4 independently in transgenic line the RT-PCR of DOS1 gene analyze.
B. the growth phenotype of different vegetable material under drought condition.
C. the survival rate statistics after different vegetable material Osmotic treatment.
D. different vegetable material leaves water loss rate measures.
E-f. in different vegetable material ABA induction stomatal aperture comparison (e) and measure (f).
In Fig. 7, ABA deletion mutant or ABA sign mutation body, the expression pattern of DOS1 gene changes.Col-0: Arabidopis thaliana wild-type; Aba1, aba2:ABA deletion mutant; Abi1-1C, abi2-1:ABA sign mutation body.
Fig. 8, AREBs and ABF3 protein activation DOS1 transcribes.
A. the mRNA level in-site of DOS1 in various ABA sign mutation body.
B. the expression lacking the DOS1 of ABA induction in mutant at areb1areb2abf3 tri-is blocked.
The transient expression of c-d.DOS1::LUC detects.
Fig. 9, in paddy rice allos process LAN AtDOS1 gene improve paddy drought resistance.
A. the PCR qualification of transgenic paddy rice.M, DNA marker; P, plasmid positive control; N, negative contrast; WT, wild rice; 1-16, different transgenic lines.
B. the GUS dyeing of transgenic line.
C. the expression level analysis of AtDOS1 gene in transgenic paddy rice.
Transgenic paddy rice under D.PEG (20% process 15 days) artificial drought conditions and the drought resisting difference of wild-type.D4, D12, D13 are corresponding three transgenic lines in C.
Embodiment
The present inventor is through studying widely, find a kind of for regulating plant degeneration-resistant border ability (improving the ability of drought tolerance in plants) useful gene--dewater excessive stimulated gene 1 (Dehydration Over Stimulated1, DOS1), it is TRAF-like family gene, it can under the prerequisite not affecting plant normal growth growth, reduce plant transpiration rate in water-stressed conditions, thus improve drought resistance.Gene of the present invention can be applied to the improvement of plant variety admirably, improves the resistibility of plant for adverse circumstance.The present invention uses transgenosis equimolecular breeding technique to cultivate drought-enduring new crop varieties, provides very valuable genetic resources.
In the present invention, have no particular limits for being applicable to plant of the present invention (or crop), as long as it is applicable to the conversion operation of carrying out gene, as various farm crop, flower plant or forestry plant etc.Described plant can be such as (being not limited to): dicotyledons, monocotyledons or gymnosperm.More specifically, described plant includes, but is not limited to: wheat, barley, rye, paddy rice, corn, jowar, beet, apple, pears, Lee, peach, apricot, cherry, strawberry, rasp berry, blackberry, blueberry, beans, French beans, pea, soybean, rape, mustard, opium poppy, olea, Sunflower Receptacle, coconut, castor oil plant, cocoa beans, peanut, cucurbit, cucumber, watermelon, cotton, flax, hemp, jute, citrus, lemon, natsudaidai, spinach, piemarker lettuce, asparagus, cabbage, Chinese cabbage, Plantula Brassicae chinensis, Radix Dauci Sativae, onion, potato, tomato, green pepper, avocado, cassia bark, camphor, tobacco leaf, nut, coffee, eggplant, sugarcane, tealeaves, pepper, grapevine, oyster fiber crops grass, banana, natural rubber tree and ornamental plant etc.
As a kind of optimal way, described " plant " includes but not limited to: grass (comprises Oryza, Aegilops, Agropyron, oatgrass, Avena, Coix, Echinochloa, Elymus, Genus Agropyron, drought standing grain belongs to, Eremopyrum, Hordeum, lolium, Panicum, Secale, sorghum, Triticum), (comprise mouse ear mustard to belong to, Brassica genus, Rhaphanus, shepherd's purse belongs to cress, separate row Vegetable spp, woaded blue Shu ， Han Lepidium, Erysimum).
DOS1 polypeptide (albumen) of the present invention can be recombinant polypeptide, natural polypeptides, improvement on synthesis, preferably recombinant polypeptide.Polypeptide of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technology to produce from vegetable cell.
The present invention also comprises the fragment of DOS1 albumen, derivative and analogue.As used herein, term " fragment ", " derivative " and " analogue " refer to the polypeptide substantially keeping biological function that DOS1 albumen of the present invention is identical or activity.Polypeptide fragment of the present invention, derivative or analogue can be the polypeptide that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the polypeptide of substituted radical in one or more amino-acid residue, or (iii) additional aminoacid sequence is fused to this peptide sequence and the polypeptide formed.The known scope of those skilled in the art is belonged to according to these fragments of definition herein, derivative and analogue.
In the present invention, term " DOS1 albumen " refers to the polypeptide with the SEQ ID NO:2 sequence improving drought tolerance in plants ability.This term also comprise have improve drought tolerance in plants ability, the variant form of SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8 or 1-5) amino acid whose disappearance, insertion and/or replacement, and add or disappearance one or several (being generally within 20, is preferably within 10, within being more preferably 5) amino acid at C-terminal and/or N-terminal.Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed.Again such as, add or reduce at C-terminal and/or N-terminal the function that or several amino acid also can not change protein usually.This term also comprises active fragments and the reactive derivative of DOS1 albumen.
The variant form of polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants, the albumen coded by DNA that can hybridize with DOS1 protein D NA under high or low stringency condition.Present invention also offers other polypeptide, as comprised the fusion rotein of DOS1 albumen or its fragment.
The present invention also provides the analogue of DOS1 albumen or polypeptide.The difference of these analogues and natural DOS1 albumen can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These polypeptide comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also by site-directed mutagenesis or the biological technology of other known moleculars.Analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide exemplified.
(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the polypeptide of solubility property.
In the present invention, " DOS1 albumen conservative variation polypeptide " refers to compared with the aminoacid sequence of SEQ ID NO:2, has 20 at the most, preferably at the most 10, more preferably at the most 5, best at the most 3 amino acid replace by the similar or close amino acid of character and form polypeptide.These conservative variation's polypeptide preferably carry out amino acid replacement according to table 1 and produce.
Table 1
| Amino-acid residue | Representational replacement | Preferred replacement |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Present invention also offers the polynucleotide sequence of code book invention DOS1 albumen or its conservative variation's polypeptide.
Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence shown in SEQ ID NO:1.As used herein, " varient of degeneracy " refers to that coding has the albumen of SEQ ID NO:2 sequence in the present invention, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional coding sequence; The encoding sequence (with optional additional coding sequence) of mature polypeptide and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising encoding such peptides, also can be the polynucleotide also comprising additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, the sum analogous to general Dedekind sum of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise and replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of polypeptide changing in fact its coding.
The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under strict conditions.In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C of grades or (3) homogeny only between two sequences are at least more than 80%, better more than at least 90%, just hybridize when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NO:2.
DOS1 protein nucleotides full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
In the present invention, DOS1 protein polynucleotide can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral or other carriers.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually containing replication orgin, promotor, marker gene and translation controlling elements.
Method well-known to those having ordinary skill in the art can be used for building containing DOS1 protein coding DNA sequence and the suitable expression vector of transcribing/translating control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.
In addition, expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as Tetrahydrofolate dehydrogenase, neomycin resistance and green fluorescent protein (GFP) that eukaryotic cell is cultivated, or for colibacillary kantlex or amicillin resistance.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell, conversion of plant also can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf disk method, Rice Young Embryo conversion method etc.Can ordinary method regeneration plant be used for the vegetable cell transformed, tissue or organ, thus the plant that acquired character changes.
The transformant obtained can be cultivated by ordinary method, expresses albumen of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.
Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method abstraction and purification with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The invention still further relates to a kind of method of Crop Improvement, the method comprises the expression or protein-active that improve DOS1 gene in described plant.Thus make described plant have more excellent degeneration-resistant border (particularly to drought-resistant) ability.
The method increasing DOS1 genetic expression is that this area is known.Such as, plant process LAN DOS1 is made by proceeding to the expression constructs of carrying DOS1 encoding gene; Or by driving with strong promoter thus strengthening the expression of DOS1 gene; Or the expression of this DOS1 gene is strengthened by enhanser (as paddy rice waxy gene First Intron, Actin gene First Intron etc.).The strong promoter being applicable to the inventive method includes but not limited to: the Ubi promotor etc. of 35S promoter, paddy rice, corn.
As a kind of optimal way of the present invention, the method obtaining the plant of DOS1 high expression level is as follows:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains the DNA encoding sequence of DOS1 albumen;
(2) vegetable cell or tissue or organ are contacted with the Agrobacterium in step (1), thus make this DOS1 protein DNA coding sequences proceed to vegetable cell, and be incorporated on the karyomit(e) of vegetable cell;
(3) vegetable cell proceeding to described DOS1 protein DNA coding sequences or tissue is selected; With
(4) vegetable cell in step (3) or tissue regeneration are become plant.
Wherein, any suitable conventional means can be adopted, comprise reagent, temperature, pressure condition etc. and implement this method.
The present invention also comprises the agonist of DOS1 albumen or its encoding gene.The activity of the adjustable DOS1 of the agonist due to DOS1 or expression, therefore, the agonist of described DOS1 also by improving the degeneration-resistant border ability (particularly to drought-resistant) of plant to the impact of DOS1, thus reaches the object of character improvement.
The agonist of described DOS1 refers to that the activity of any DOS1 of raising, the stability maintaining DOS1, promotion DOS1 express, extend DOS1 effective acting time or promote the material of transcribing and translating of DOS1, these materials all can be used for the present invention, as the material that degeneration-resistant border (particularly arid) ability for raising plant is useful.
In addition, the tracking mark that also can be used as a kind of gene transformation progeny of plants of DOS1 albumen of the present invention or its encoding gene, or can be used as the mark judging drought tolerance in plants ability.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.
Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
1. experiment material
Test vegetable material used to comprise:
(1) Arabidopis thaliana (Arabidopsis thaliana): Columbia (Col-0) and the Ler ecotype (purchased from ABRC).(2) mutant abi1-1C (Umezawa T et al., Journal of Plant Research, Volume124, Issue4, pp437-453; 2009), abi2-1 (Ler) (Leung et al., The Plant Cell, 9,759-771; 1997), abi3-8 (Nambara, E., Suzuki, M. etc. (2002), Genetics161,1247-1255; Tamuraet al., 2006), abi4-1 (Finkelstein RR etc. (1998); Plant Cell10 (6): 1043 – 1054), abi5-7 (Nambara et al., 2002; Tamura et al., 2006), aba1, aba2-1 (GONZALEZ-GUZMAN et al., Plant Cell, 14,1833-46,2002), mutant (Takuya Yoshida, The Plant Journal, Vol61Issue4 that areb1areb2abf3 tri-suddenlys change, pp.1041-1052,2010).
(3) Arabidopis thaliana growth conditions is 23 ± 1 DEG C, and 14h illumination/10h is dark.
(4) tobacco: the growth conditions of Ben Shi tobacco is 23 ± 1 DEG C, 14h illumination/10h is dark; The growth conditions of SR-1 tobacco bred is 25 DEG C, and 16h illumination/8h is dark.
(5) paddy rice ZH11: growth conditions is 28 ± 1 DEG C, 16h illumination/8h is dark.
Experiment bacterial strain uses therefor comprises:
(1) coli strain: DH5 α; DE3; BL21Codon Plus;
(2) agrobacterium strains GV3101 (for transformation of Arabidopsis thaliana) (Clough and Bent, 1998); EHA105 (for rice conversion) (see Hood, E.E. etc., Transgenic Res., 1993,2,208 – 218);
(3) yeast strain AH109 (Clontech, Shanghai).
2. experimental technique
(1) PromoterDOS1::GUS plant expression vector construction and GUS dyeing
With the upstream gene group DNA sequence dna (primer: PrDOS1-F:5 ' GGATAGAGACATAAACGAAGCTCGG3 ' (SEQ ID NO:3) and PrDOS1-R:5 ' TTCGCAGGAATTAATGAATTCACAA3 ' (SEQ ID NO:4)) of the method amplification AtDOS1 of PCR, supreme gene 3 ' the UTR place of about 1kb, is connected into pBluescript KS (EcoR V cuts) picking reverse cloning afterwards.Order-checking is verified, pCAMBIA1300 is linked (see http://www.bios.net/daisy/cambia/585.html#dsy585_gus_intron after EcoRI and BamH I double digestion, carry GUS enzyme cDNA) EcoRI/BamHI multiple clone site in, obtain pCAMBIA1301-AtDOS.Proceed to Agrobacterium GV3101 and infect Arabidopis thaliana.After the transgenic seedlings obtained sprouts 1 week, positive for whole strain seedling is dipped in GUS staining fluid, and (compound method is: dissolve 10.33g NaHPO successively in 500ml distilled water
412H
2o, 3.3g NaH
2pO
42H
2o, 0.0823g K
3[Fe (CN)
6], 0.1056g K
4[Fe (CN)
6] and 250ul Triton X-100), vacuumize 5 minutes, after 37 DEG C of incubated overnight by material in 75% ethanol, 37 DEG C of decolourings, change 3-5 ethanol to take pictures under the microscope after thoroughly decolouring.
(2) AtDOS1 Overexpression vector builds and Agrobacterium-mediated Transformation
Extract the whole strain RNA of Arabidopis thaliana, become after cDNA through reverse transcription, with DOS1-F:5 ' CATATGGAACCTCGAATCAATGAC3 ' (SEQ ID NO:3) and DOS1-R:5 ' TCATATCGAAACAGGCTGTTCTCTC3 ' (SEQ ID NO:4) for primer, PCR obtains the complete fragment of gene of AtDOS1.Be connected in pBluescript KS (EcoR V cuts) intermediate carrier with Ligation high test kit by it, order-checking is verified.Choose forward clone, utilize BamHI and SalI two restriction enzyme sites AtDOS1 gene fragment to be cut from pBluescript KS carrier, and be connected in plant expression vector pCAMBIA1301.It is for subsequent use that the pCAMBIA1301-AtDOS1 built proceeds to Agrobacterium GV3101.Agrobacterium-mediated Transformation uses rifle head titration column cap method: choose the Arabidopis thaliana seedling of just having bloomed, every transfection in 3-5 days once, and continuous transfection 3 to 5 times (Clough and Bent, 1998).
(3) structure of Yeast expression carrier and conversion
Cut from intermediate carrier NdeI and SalI by AtDOS1 gene, link on pGAD and pGBK and obtain AD-DOS1 and BK-DOS1 two carriers, each carrier extracts the use of a small amount of plasmid in order to next step yeast conversion experiment.AD-DOS1 and BK-DOS1 obtained respectively is got 5ul and enter yeast AH109 according to the standard step corotation of Clontech, respectively at 4 kinds of different auxotroph SD substratum (purchased from Clonetech, Shanghai) upper growth takes pictures after 48 hours, four kinds of auxotroph SD substratum are respectively :-Leu,-Trp ,-Leu-Trp-His-Ade and-Leu-Trp-His-Ade+X-α Gal.Turn pGAD and pGBK of an empty carrier in contrast simultaneously.
(4) in tobacco cell, bimolecular fluorescence is done (BiFC) mutually
The encoding sequence (the sequence 388-555 amino acids of GenBank accession number AJ277960.1) of the N-terminal encoding sequence (the sequence 1-387 amino acids of GenBank accession number AJ277960.1) of Lampyridea fluorescin LUC (Luciferase) and carboxyl terminal is obtained LUC with AtDOS1DNA (SEQ ID NO:1) fusion respectively
n-AtDOS1 and LUC
cto proceed to after-AtDOS1 in Agrobacterium GV3101 and to transform Ben Shi tobacco (Nicotiana tabacum cv.), after 48 hours, getting vacuum side of blade first observes fluorescence presence or absence at Confocal.The LUC simultaneously will built
n-AtDOS1 and LUC
c-AtDOS1 respectively with the empty carrier LUC of correspondence
cand LUC
ninject tobacco altogether as negative contrast, method is shown in Gou et al. (2011).
(5) AtDOS1 protein localization
PMON520-eYFP carrier is purchased from Clonetech.
PA7-YFP carrier is purchased from Clonetech.
Build pMON530-eYFP-DOS1 carrier (construction process is: cut by DOS1 BamHI and SalI and be connected on pMON520-eYFP carrier B glII and XhoI), and after proceeding to Agrobacterium GV3101, inject Ben Shi tobacco back side blade, after 2 to 3 days, clip back side blade is in Confocal basis of microscopic observation assignment of genes gene mapping situation.
Simultaneously, also build PA7-DOS1-YFP carrier (construction process is: be connected into after being cut by BamHI and SpeI enzyme by the DOS1 removing terminator codon on PA7-YFP carrier that same enzyme cuts) take out greatly with QIAGENE test kit after by PEG arabidopsis thaliana transformation protoplasm somatocyte, first observe Subcellular Localization situation at Zess Confocal microscope.
(6) Arabidopis thaliana Osmotic treatment and percentage of water loss measure
The Arabidopsis thaliana Seedlings sprouted 5 days starts stopping after transferring to and cultivating 3 weeks under normal growing conditions in soil and waters, and continues cultivation 3 weeks, observes the phenotype under drought condition.In order to carry out the mensuration of percentage of water loss, wild-type, mutant and each 10 blades of DOS1 process LAN strain cultivated under same growth conditions 4 weeks are cut, weigh up fresh weight respectively according to the interval time designed, the fresh weight of each time point is percentage of water loss with the fresh weight ratio of start time point.Experiment is carried out 3 biology and is repeated.
(7) measurement of stomatal aperture
Peel leaf epidermis from the cultivation Arabidopis thaliana lotus throne leaf of 4 weeks, and under immersing the middle light of solution (10mM KCl, 10mM Mes-Tis, 50 μMs of CaCl2, pH6.15), (100 μm of ol/m2/s) places 3 hours.Then, add 0 (contrast) in the solution or 50 μMs of dormins (ABA) process 2 hours, under microscope (Nikon, 40X), observe pore and measure length and the width of pore perforate.30-50 pore measured respectively by each sample, and carry out 3 biology and repeat, and then carries out biometric (Student ' s T test).
(8) RT-PCR and Real-Time pcr analysis
Utilize Trizol reagent (TAKARA, Japan) to extract plant RNA and utilize ReverTra Ace (TOYOBO, Japan) reverse transcription to become cDNA.RT-PCR the primer is:
RT-DOS1F:5 ' AACCGTACAATTGTCCACACTCAGG3 ' (SEQ ID NO:5), and
RT-DOS1R：5’TTCAGCTCCTTGTCGGTGGTGTT3’(SEQ?ID?NO:6)。
At actin2F:5 ' GGAAGGATCTGTACGGTAAC3 ' (SEQ ID NO:7), and
At?actin2R：5’GGACCTGCCTCATCATACT3’(SEQ?ID?NO:8)。
OsUbi1-F:5 ' GACGGACGCACCCTGGCTGACTAC3 ' (SEQ ID NO:9), and
OsUbi1-R：5’TGCTGCCAATTACCATATACCACGAC3’(SEQ?ID?NO:10)。
Reaction process is: 95 DEG C of 1min; 95 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 15s, 30 circulations; 72 DEG C, 5min.Real-Time PCR operates according to SYBR Green Realtime PCR Master Mix (TOYOBO) specification sheets.
(9) genetic transformation of paddy rice
A) induction of Mature Embryos of Rice callus: the seed of rice varieties ZH11 shells, with 70% alcohol immersion 1min, after 20% (v/v) chlorine bleach liquor soaks 20min (period constantly rocks), fully wash 3-5 time with sterilized water.Be seeded on NB calli induction media after aseptic filter paper blots, 26-28 DEG C of light culture be after 4 weeks, callus particle to be inoculated on new NB calli induction media light culture 4 days for subsequent use;
B) transform the day before yesterday by the Agrobacterium inoculation containing pCAMBIA1301-AtDOS1 plasmid in LB substratum (containing Kan50ug/ml, Rif25ug/ml), (spending the night) is cultivated in 28 DEG C of 200rpm concussions is 0.6-0.8 to OD660;
C) callus is transferred in an aseptic triangular flask, pour cultured Agrobacterium bacterium liquid (allowing bacterium immersion not have callus) into;
D) room temperature places 20min, and period rocks several times gently;
E) remove bacterium liquid and callus is transferred on aseptic filter paper to draw unnecessary bacterium liquid, then forward on NB Dual culture base, Dual culture 2-3 days under 20-25 DEG C of dark condition;
F) callus after Dual culture is transferred in aseptic triangular flask, first with sterilized water washing 2-3 time, then wash 20min with the sterilized water containing 500ml/L Pyocianil;
G) after blotting excessive moisture on aseptic filter paper, callus is transferred to NB screening culture medium (containing screening 200mg/L Ticarcillin/Clavulanate Acid and 50mg/L Totomycin (all purchased from Shanghai past biotech firm) carrying out transformant, within 3 weeks, be one-period, screen 2-3 cycle;
H) after the kanamycin-resistant callus tissue after screening being proceeded to pre-division culture medium cultivates 1 week, go to the upper cultivation of NB division culture medium [containing 6-benzyl aminopurine (BAP) 2mg/L and naphthylacetic acid (NAA) 0.5mg/L] again, condition is 26 DEG C, and 16h illumination/8h is dark;
I) the resistance regeneration plant differentiated proceeds to the upper strengthening seedling and rooting of root media (containing 1/2MS+NAA0.5mg/L);
J), after about 3 weeks, the regeneration resistant plant of taking root is transplanted in greenhouse.
(10) PEG simulating drought process paddy rice
The wild-type of sprouting after 1 week and Transgenic Rice Seedlings are planted in same Culture basin (different transgenic line is planted in different Culture basins) respectively, normally water Aquaponic 2 weeks, then every day is with 200ml20%PEG aqueous solution continuous pouring 12-15 days, and period observes phenotype and takes pictures in time.
(2) the gDNA complemented mutant body dos1 of DOS1
DOS1 full-length gene group DNA fragmentation adds that 629bp initiation codon upstream and 247bp termination codon cloned downstream are to middle clone pBlueScript SK-, cut with EcoRI and SalI enzyme and are connected into pCAMBIA1300 (see http://www.bios.net/daisy/cambia/585.html).Transgenic method is shown in Clough, S.J., and Bent, A.F. (1998) .Plant J.16,735 – 743.
3, embodiment
The separation of embodiment 1, AtDOS1 gene and protein-interacting
In TAIR10 database (http://www.arabidopsis.org/), sequence alignment is carried out with SINAT5 albumen (GenBank accession number AAM11573), find a TRAF-like albumen, called after AtDOS1 (Fig. 1 a, is abbreviated as DOS1 in figure).
Chip analysis display AtDOS1 albumen is induced by arid and ABA, points out this albumen may participate in abiotic stress reaction.SINA structural domain is the structural domain guarded very much that mediating proteins is done mutually, because AtDOS1 has lacked the RING structural domain of the necessary mediation substrate protein ubiquitination degraded of other members of SINA family, but the carboxyl terminal of AtDOS1 has a conservative SINA-like structural domain, the dimerization of possible mediating proteins homology or allos.
The two assorted result of yeast proves, AtDOS1 can with self-interaction (Fig. 1 b).Be verified further (Fig. 1 c) by carrying out BiFC analysis in tobacco cell.
The tissue expression pattern of embodiment 2, AtDOS1
Real-time experimental result display (Fig. 2 a-b), AtDOS1 is high expression level in the root and lotus throne leaf of Arabidopis thaliana, and its hetero-organization as stem and in spending expression amount relatively low.
PromoterDOS1::GUS staining analysis also demonstrates the above results.GUS dyeing simultaneously also shows this gene specifically expressing in pore, points out the drought resistance of this gene and plant to have substantial connection.Real-time PCR and GUS coloration result all show, and AtDOS1 is high expression level in the old leaf of development later stage, and prompting AtDOS1 may play drought resistance function (Fig. 2 c-l) in the later stage of growing.
Embodiment 3, AtDOS1 induce by ABA and drought stress
Chip data shows, after being subject to arid and ABA induction, the expression amount of AtDOS1 significantly raises, the present inventor has carried out 0,3,6,12,24 hour gradient by induction situation sampled this gene, and utilizes Real-time PCR to carry out the detection of expression amount change.Experimental data shows, and compared with contrast (water treatment), AtDOS1 obviously increases along with the prolongation rise multiple of Osmotic treatment time, rises about 80 times before comparatively processing after 24 hours Osmotic treatment.And with the ABA process of 100 μm after 6 hours, the expression level of this gene reach untreated before more than 40 times (Fig. 3).
Embodiment 4, AtDOS1 albumen are mainly positioned nucleus and tenuigenin
Build pMON530-eYFP-DOS1 carrier, proceed to Arabidopis thaliana and set up transfer-gen plant.Detect the fluorescence distribution of YFP-AtDOS1 in transgenic Arabidopsis plants, find specifically expressing (Fig. 4 a-b) in guard cell's (pore).
Build pMON530-eYFP-DOS1 carrier, in Tobacco Epidermis transient expression YFP-AtDOS1 and in protoplasts of Arabidopsis thaliana broken by ultrasonic cell transient expression AtDOS1-YFP all show, AtDOS1 albumen is mainly positioned (Fig. 4 c-d) in nucleus and tenuigenin.Build PA7-DOS1-YFP carrier by PEG arabidopsis thaliana transformation protoplasm somatocyte.
Embodiment 5, Arabidopis thaliana dos1 mutant are responsive to arid
In order to study the biological function knowing DOS1, the present inventor has been separated 2 Arabidopsis Mutants (dos1-1 and dos1-2), and RT-PCR result shows, the expression deletion (Fig. 5 a-b) of DOS1 in these two mutant.
Observe the growing state of mutant, and compare with wild-type.Under normal growing conditions, growing of these 2 mutant is not obviously distinguished with wild-type; Under various Stress treatment condition, 2 mutant do not have notable difference in the phenotype of seed germination stage and plantlet stage and wild-type yet, but in the seedling stage of Osmotic treatment, 2 mutant show as the phenotype than wild-type sensitive, and mutant dos1 phenotype can be made to recover (Fig. 5 c-d) with the gDNA complementation of DOS1 is wild type phenotype.
Embodiment 6, process LAN DOS1 can improve the drought resistance of transgenic arabidopsis
The AtDOS1 gene (being included in pCAMBIA1301-AtDOS1) that 35S starts is proceeded to Arabidopis thaliana, obtain more than 20 transgenic line altogether, wherein 10 strains receive T1 for seed, select wherein 4 strains (4,6,7 and 8) carry out RT-PCR detection, to show in these 4 strains all process LAN DOS1 (Fig. 6 a).The Arabidopis thaliana wild-type of 4 weeks, the transgenic line control water 3 weeks of mutant (dos1-1, dos1-2) and DOS1 process LAN (35S::DOS1) will be grown in soil, observe their tolerances to arid, result shows, during control water 3 weeks, most of wild-type loses water meter type, mutant is more serious than wild-type dehydration, and the dehydration situation of the transgenic line of process LAN DOS1 is better than wild-type (Fig. 6 b).
After measured, turn over the survival rate of the transgenic line of expressing DOS1 apparently higher than wild-type, and mutant lower than wild-type survival rate (Fig. 6 c).
Leaves water loss rate determination result shows, and the rate-of-loss of coolant of process LAN strain will be considerably slower than wild-type and mutant (Fig. 6 d).
These results show, process LAN DOS1 can improve the drought resistance of transgenic plant, and the display of stomatal aperture measuring result, after ABA process, the stomatal aperture of process LAN strain is less than wild-type, and the stomatal aperture of mutant is greater than wild-type (Fig. 6 e-f).The reduction of stomatal aperture effectively reduces plant transpiration rate in water-stressed conditions.
Embodiment 7, drought-induced DOS1 express and belong to ABA dependent form
The expression of DOS1 is by ABA and drought-induced, and therefore the present inventor infers that DOS1 participates in the drought resistence approach of ABA mediation.For this reason, the present inventor analyzes the expression of DOS1 gene in ABA deletion mutant (aba1 and aba2-1) and ABA sign mutation body (abi1-1C and abi2-1) after ABA (100uM) or drought stress, Real-time PCR result shows, the expression of the DOS1 of drought stress induction is all blocked in all mutant, the expression of the DOS1 of ABA induction is then only blocked in ABA sign mutation body abi1-1C and abi2-1, and this shows the transduction (Fig. 7) of the ABA signal that the expression of the DOS1 of arid and ABA induction needs ABI1 and ABI2 to mediate.
The present inventor have detected the expression of the DOS1 of ABA induction in other abi mutant further.In abi4-1 and abi5-7 two mutant, the abduction delivering of ABA to DOS1 significantly declines, and does not then change in abi3-8, and this shows just to regulate the expression of DOS1 by ABI4 and ABI5, and (Fig. 8 a).The present inventor also finds that the expression of the DOS1 of ABA induction in the mutant suddenlyd change at areb1areb2abf3 tri-is greatly affected (Fig. 8 b).AREB1, AREB2 and ABF3 plays the main transcription factor (Yoshida etc. of three of coordinated regulation effect in the ABA signal pathway that in drought stress reaction, ABRE-relies on, 2010), and found ABRE motif (the reaction original paper of ABA) promoter region the present inventor of AtDOS1, in order to understand fully that whether DOS1 is directly by the regulation and control of these transcription factors, by fluorescin LUC gene direct construction, in the promotor of DOS1, (DOS1 promotor (from upstream from start codon 629bp) is connected into pGreenII0800-LUC (Hellens et al. through BamHI and SalI to the present inventor, 2005) in protoplasts of Arabidopsis thaliana broken by ultrasonic, transient expression is carried out under, simultaneously by the AREB1 of 35S promoter driving, AREB2, (the total length CDS that PCR obtains is cloned into pBlue ScriptSK-to ABF3 and ABI5 action effect, pGreenII62-SK is connected into through BamHI and SalI) (effectors) (Fig. 8 c), (Hellens et al.2005) with ABI5 as negative contrast, result shows AREB1, AREB2 and ABF3 can induce the expression (Fig. 8 d) of LUC.
Embodiment 8, in paddy rice, process LAN AtDOS1 can improve the drought resistance of transgenic paddy rice
The AtDOS1 driven by 35S is gene constructed in the upper rice transformation ZH11 of pCAMBIA1301 carrier (pCAMBIA1301-AtDOS1), obtain more than 10 transgenic line (Fig. 9 A) altogether, identify the integration of AtDOS1 gene in transgenic paddy rice and process LAN (Fig. 9 B-C) through PCR, GUS dyeing and RT-PCR.The T1 of transgenic paddy rice three strains (D4, D12 and D13) of sprouting after 2 weeks is planted in same Culture basin for seedling and wild-type, under phytotron condition (28 DEG C, 16h illumination/8 h dark) continue cultivation 1 week, then with the experiment of the PEG process PEG aqueous solution 200ml/ basin of 20% (every day water) simulating drought.
Experimental result shows, the drought resistance of the D4 that AtDOS1 process LAN is more weak and wild-type are distinguished not quite, and stronger transgenic line D12 and D13 of AtDOS1 process LAN growth conditions after PEG process, significantly better than wild-type, shows better drought resistance (Fig. 9 D).
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (9)
1. a purposes for DOS1 polypeptide or its encoding gene, for improving drought tolerance in plants ability.
2. purposes as claimed in claim 1, is characterized in that, described DOS1 polypeptide also for:
Improve the survival rate of plant under drought condition;
Reduce the rate-of-loss of coolant of plant;
Reduce the stomatal aperture of plant; Or
Reduce plant transpiration rate in water-stressed conditions.
3. purposes as claimed in claim 1, it is characterized in that, described DOS1 polypeptide is:
(a) albumen of aminoacid sequence as shown in SEQ ID NO:2; Or
B aminoacid sequence shown in SEQ ID NO:2 is formed through the replacement of one or more amino-acid residue, disappearance or interpolation by (), and have the albumen derivative by (a) improving drought tolerance in plants ability function.
4. purposes as claimed in claim 1, it is characterized in that, described plant comprises: grass, cress.
5. improve a method for drought tolerance in plants ability, described method comprises: the expression or the activity that improve DOS1 polypeptide in plant.
6. method as claimed in claim 5, it is characterized in that, described method comprises: proceeded in plant by the encoding gene of DOS1 polypeptide.
7. method as claimed in claim 6, it is characterized in that, described method comprises step:
I () provides the Agrobacterium of carrying expression vector, described expression vector contains the encoding gene of DOS1 polypeptide;
(ii) vegetable cell, tissue or organ are contacted with the Agrobacterium in step (i), thus make the encoding gene of described DOS1 polypeptide proceed to plant.
8. genetically modified crops, is characterized in that, utilize the method described in claim 5-7 to prepare, and its drought-resistant ability of wild-type crop of non-express transgenic is improved relatively.
9. a purposes for DOS1 polypeptide or its encoding gene, as the molecular marked compound of the drought-resistance ability of plant identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310281850.9A CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310281850.9A CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104278053A true CN104278053A (en) | 2015-01-14 |
| CN104278053B CN104278053B (en) | 2017-11-10 |
Family
ID=52253396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310281850.9A Expired - Fee Related CN104278053B (en) | 2013-07-05 | 2013-07-05 | A kind of method for improving drought tolerance in plants ability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104278053B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148355A (en) * | 2016-06-30 | 2016-11-23 | 中国人民解放军第二军医大学 | The application in regulation and control Lignanoids compounds synthesis of the Isatis indigotica Fort. IiAP2/ERF049 gene |
| CN110663540A (en) * | 2019-09-27 | 2020-01-10 | 金华市农业科学研究院 | Breeding method of high-yield tea seed variety |
| CN114073224A (en) * | 2021-09-30 | 2022-02-22 | 中国热带农业科学院海口实验站 | Avocado water culture method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445553B (en) * | 2009-01-09 | 2011-04-06 | 湖南农业大学 | Paddy drought resistance gene OsSINAT5 and encoding protein and application thereof |
-
2013
- 2013-07-05 CN CN201310281850.9A patent/CN104278053B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148355A (en) * | 2016-06-30 | 2016-11-23 | 中国人民解放军第二军医大学 | The application in regulation and control Lignanoids compounds synthesis of the Isatis indigotica Fort. IiAP2/ERF049 gene |
| CN106148355B (en) * | 2016-06-30 | 2019-08-06 | 中国人民解放军第二军医大学 | Application of the woaded blue IiAP2/ERF049 gene in regulation Lignanoids compounds synthesis |
| CN110663540A (en) * | 2019-09-27 | 2020-01-10 | 金华市农业科学研究院 | Breeding method of high-yield tea seed variety |
| CN114073224A (en) * | 2021-09-30 | 2022-02-22 | 中国热带农业科学院海口实验站 | Avocado water culture method |
| CN114073224B (en) * | 2021-09-30 | 2022-09-23 | 中国热带农业科学院海口实验站 | Avocado water culture method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104278053B (en) | 2017-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN110643618B (en) | Jatropha curcas MYB transcription factor JCMYB16 gene and application thereof in improving drought resistance of plants | |
| CN101362799A (en) | Gene for regulating and controlling plant height and application thereof | |
| CN106868021B (en) | Gene OsNAC1 for controlling rice seed size and application thereof | |
| CN112226455B (en) | Rice grain length and grain weight related protein, and coding gene and application thereof | |
| CN103966254B (en) | A kind of transcription factor that can be applicable to regulate plant trait | |
| KR101790010B1 (en) | Gene enhancing pre―harvest sprouting tolerance derived from Oryza sativa and uses thereof | |
| CN102911945A (en) | High temperature resistant gene of plants and application thereof | |
| CN103387609B (en) | A kind ofly improve gene of Genes For Plant Tolerance adverse circumstance ability and uses thereof | |
| CN102459615B (en) | Drought tolerant plants | |
| CN109134632A (en) | The albumen and its encoding gene of regulation plant root development and application | |
| CN113025627A (en) | Rice tillering control gene OsMYB27 and application thereof in breeding | |
| BRPI0809836B1 (en) | method and vector capable of manipulating aging or enhancing biomass in a plant; and transgenic plant cell, plant, plant seed or other plant part | |
| CN106148390A (en) | CHY zinc finger protein transcriptional activation cofactor and application thereof | |
| CN104561084A (en) | Transcription factor SPL9-2 for promoting advanced heading of Chinese cabbage and application of transcription factor SPL9-2 | |
| CN104278053B (en) | A kind of method for improving drought tolerance in plants ability | |
| JP2003047466A (en) | New rice gene controlling salt stress resistance | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN101781363B (en) | Protein regulating development of plants and encoding gene and application thereof | |
| CN106432449A (en) | Protein VPS23A related to drought tolerance of plants, encoding gene of protein VPS23A and application | |
| CN103305524B (en) | Ear type of crop regulatory gene and application thereof | |
| CN111116721A (en) | Plant stress resistance-related transcription factor PwNAC30, and coding gene and application thereof | |
| CN114560919B (en) | Plant drought tolerance related transcription factor VcMYB and coding gene and application thereof | |
| CN106893731B (en) | Soybean xyloglucan transferase hydrolase geneGmXTH1And applications | |
| CN101824078B (en) | Protein for controlling growth of plants as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200609 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171110 Termination date: 20200705 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |