CN101824078B - Protein for controlling growth of plants as well as coding gene and application thereof - Google Patents

Abstract

The invention discloses a protein which regulates and controls the growth and the development of plants and is relevant to the plant types of the plants as well as a coding gene and application thereof. The protein provided by the invention is a protein in (a) or (b) as follows: (a) a protein comprising an amino acid sequence shown as a sequence 3 in a sequence table; (b) a protein which is formed by substituting and/or deleting and/or adding the protein of the sequence 3 in the sequence table by one or several amino acid residues, is relevant to the development of the plants and is derived from the protein; and the development of the plants is embodied in the properties of the plant height of adult plants and/or the length of leaf stalks and/or the length of hypocotyls and/or the size of specific organs. The coding gene of the protein is overexpressed, which can obtain transgenic plants with the reduced plant height and/or the shortened leaf stalks and/or the shortened hypocotyls and/or diminished leaves; and suppressed expression is carried out on the coding gene of the protein, which can largen the plants. Therefore, AtIBH1 can be used as a latent molecular breeding tool, improves the plant types of the plants and enhances the yield of the plants.

Description

A kind of albumen and encoding sox and application of controlling plant growth

Technical field

The present invention relates to biological technical field, particularly a kind of plant development associated protein and encoding sox and application.

Background technology

Growth of plant and form are extended and the division decision by the elongation of cell.Wherein the elongation of vegetable cell receives external environmental factor and comprises that the various plants endogenous hormones of brassinosteroid hormone influences jointly.And the brassinosteroid hormone is exactly the elongation that promotes vegetable cell for the most tangible physiological effect of plant; Promote the elongation of the epicotyl, cucumber hypocotyl, monocotyledonous coleoptile, mesocotyl etc. of stem, pea and the mung bean of seedling like BRs, and the tender vegetative organ of children is particularly evident to the reaction of BRs.Along with the evaluation of a series of BR related mutants and the research of molecular genetics and biological chemistry means, the BR signal transduction pathway is more clearly in Arabidopis thaliana in recent years.BRs can be combined in the extracellular domain of BRI1, activates the kinases territory of BRI1, makes BRI1 combine with BAK1 and mutual phosphorylation; While and supressor BKI1 depolymerization, activatory BRI1 phosphorylation BSKs, BSKs is spread out of the BRs signal by receptor complex BRI1/BAK1; Activate BSU1, BSU1 makes the BIN2 inactivation through dephosphorylation, dephosphorylized BZR1 and BZR2 accumulation; Activate the expression of BR signal pathway downstream gene, thus the regulation and control growth and development of plant.Yet thereby how BR passes through the expression regulating cell elongation of BZR1 regulation and control downstream gene, is still waiting further research.Therefore clone the gene of BR signal pathway downstream regulation and control vegetable cell elongation, regulation and control vegetable cell elongation controlling plant will be grown and the important molecule instrument of plant type thereby will become.

Summary of the invention

The purpose of this invention is to provide a kind of plant development associated protein.

Albumen provided by the invention (AtIBH1), environmental from Arabidopis thaliana col, be (a) or protein (b) as follows:

(a) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 3;

(b) with the protein of sequence 3 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with development of plants by its deutero-protein; Said development of plants is embodied in on the proterties such as size of strain plant height and/or petiole length and/or hypocotyl length and/or certain organs.

In order to make the AtIBH1 in (a) be convenient to purifying, proteinic N-terminal or C-terminal that can the aminoacid sequence shown in the sequence 3 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1 label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tagII	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned (b) but in the AtIBH1 synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.The encoding sox of AtIBH1 in above-mentioned (b) can be through the codon with one or several amino-acid residue of disappearance in the dna sequence dna shown in the sequence in the sequence table 4; And/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Said proteic encoding sox also belongs to protection scope of the present invention.

Said proteic encoding sox (AtIBH1) can be following 1) or 2) or 3) or 4) or 5) dna molecular:

1) its encoding sequence is the dna molecular shown in the sequence 4 in the sequence table;

2) in the sequence table sequence 5 from ' dna molecular shown in the end 54-600 position;

3) dna molecular shown in the sequence 5 in the sequence table;

4) under stringent condition with 1) or 2) or 3) the dna sequence dna hybridization and the coding identical function protein DNA molecule that limit;

5) with 1) or 2) or 3) dna sequence dna that limits has 90% above homology, and the identical function protein DNA molecule of encoding.

Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, 65 ℃ of hybridization down, uses 2 * SSC then, and 0.1%SDS and 1 * SSC, 0.1%SDS respectively wash film once.

The recombinant expression vector, expression cassette, transgenic cell line or the reorganization bacterium that contain said gene all belong to protection scope of the present invention.

Available existing plant expression vector construction contains the recombinant expression vector of AtIBH1 gene.

Said plant expression vector comprises double base agrobacterium vector and the carrier etc. that can be used for the plant micropellet bombardment.Said plant expression vector also can comprise 3 ' end untranslated zone of foreign gene, promptly comprises the dna fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.Said polyadenylic acid signal can guide polyadenylic acid to join 3 ' end of mRNA precursor, and the non-translational region of inducing (Ti) plasmid gene (like kermes synthetic enzyme Nos gene), plant gene (like soybean storage protein gene) 3 ' end to transcribe like the Agrobacterium crown-gall nodule all has similar functions.

When using AtIBH1 to make up the recombinant plant expression vector; Before its transcription initiation Nucleotide, can add any enhancement type promotor or constitutive promoter; Like the ubiquitin promoter (Ubiquitin) of cauliflower mosaic virus (CAMV) 35S promoter, corn, they can use separately or be used in combination with other plant promoter; In addition; When using gene constructed plant expression vector of the present invention; Also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in plant, to express, have antibiotic marker thing (qingfengmeisu qiong affinity tag, kantlex affinity tag etc.) or the anti-chemical reagent marker gene (like anti-weedkiller gene) of resistance etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.

Said recombinant expression vector specifically can be said AtIBH1 gene is inserted the recombinant expression vector that the MCS of pSN1301 obtains.

Said plasmid pSN1301 obtains inserting the 35S-Noster sequence between the EcoRI of plasmid pCAMBIA1301 and HindIII restriction enzyme site; Said 35S-Noster sequence obtains with HindIII complete degestion plasmid pUC19-35S-Noster with restriction enzyme EcoRI is partially digested; Said plasmid pUC19-35S-Noster obtains inserting the 35S promoter fragment between the HindIII of plasmid pUC19-Noster and BamHI restriction enzyme site; Said 35S promoter fragment obtains with restriction enzyme HindIII and BamHI double digestion plasmid pBI221; Said plasmid pUC19-Noster obtains inserting Noster poly A terminator sequence between the SacI of plasmid pUC19 and EcoRI restriction enzyme site; Said Noster poly A terminator sequence obtains with restriction enzyme Sac I and EcoR I double digestion plasmid pBI221.

The present invention also protects a kind of method of cultivating transgenic plant.

This method is following 1) or 2) method:

1) said gene is imported in the purpose plant, obtain transgenic plant, said transgenic plant become transgenic plant short and/or that petiole shortens and/or hypocotyl shortens and/or blade diminishes for compare plant height with said purpose plant;

2) in the purpose plant, said gene is suppressed to express, obtain transgenic plant, the plant type size of said transgenic plant is greater than said purpose plant.This purpose plant is the plant that contains above-mentioned AtIEH1 gene.

Utilize any carrier that can guide foreign gene in plant, to express,, can obtain plant height and become short and/or petiole shortens and/or hypocotyl shortens and/or blade diminishes AtIBH1 gene transfered plant cell provided by the present invention.Carry that the AtIBH1 expression carrier can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated through using, and the plant transformed tissue cultivating is become plant.The host can be dicotyledons by plant transformed, like Arabidopis thaliana (Columbia Arabidopis thaliana).

Aforesaid method 1) in, said gene can specifically import in the said purpose plant through above-mentioned recombinant expression vector.

Aforesaid method 2) in, the inhibition expression imports AtIBH1-RNAi in the purpose plant and realizes;

Said AtIBH1-RNAi is that the fragment forward from shown in 5 ' the end 66-359 position with sequence in the sequence table 5 inserts between Spe I and the Sac I restriction enzyme site of pTCK309 and constitutes pTCK309-1; Hold the fragment shown in the 66-359 position oppositely to insert BamH I and the Kpn I restriction enzyme site of pTCK309-1 white 5 ' of sequence in the sequence table 5, constitute AtIBH1-RNAi;

The construction process of said pTCK309 is following: the fragment shown in the sequence in the sequence table 6 is inserted between the KpnI and SacI restriction enzyme site of pBluescriptII SK+, constituted pTCK302; From paddy rice (spend No. 10) genomic dna, amplify the paddy rice intron of 478bp with 5 '-GGTAAGTTACTACAAACCTTTTTG-3 ' and 5 '-TGAAAATCTCGAAACAGCCGTGTC-3 ' primer, be connected into pGEM-T ( Promega) carrier, constitute reorganization T carrier; With said reorganization T carrier is template; With primer 5 '-GCGTCGACAGATCTGCTAGCGGTAAGTTAC-3 ' and 5 '-CCATCGATCTGAAAATCTCGAAACAGCCGTG-3 ' pcr amplification; Amplified production is cut and is cloned in the said pTCK302 carrier with Sal I and Cla I enzyme, the carrier called after pTCK302-1 of formation; Cutting pTCK302-1 with KpnI and Sacl enzyme obtains constituting pTCK309 between KpnI and Sacl restriction enzyme site that small segment inserts said pSN1301.

The above-mentioned purpose plant is a dicotyledons, and this dicotyledons can be Arabidopis thaliana, and this Arabidopis thaliana specifically can be the Columbia Arabidopis thaliana.

The present invention has found a new albumin A tIBH1 and encoding sox AtIBH1 thereof.AtIBH1 can interact and the function antagonism with PRE1, and therefore two genes can use simultaneously and reach promotion or the inhibition of control to growth.With tissue-specific promoter can specific control certain organs (comprising nutrition and syngenesis organ) growth and size.The present invention has also obtained to contain the recombinant expression vector of this encoding sox AtIBH1, transforms the purpose plant with recombinant vectors, can obtain into the strain plant height and become transgenic plant short and/or that petiole shortens and/or hypocotyl shortens and/or certain organs diminishes.AtIBH1 is suppressed to express the back find that the whole plant of Arabidopis thaliana becomes big.Therefore AtIBH1 can be used as a kind of potential molecular breeding tool, changes the vegetable cell elongation, thereby improvement plant plant type improves phytomass.

Description of drawings

Fig. 1 is i1i1-D two mutants plant and the photo of Japan's fine (WT) seedling phase among the embodiment 1.

Fig. 2 is an i1i1-D two mutants plant and Japan's photo in fine (WT) tillering phase among the embodiment 1.

Fig. 3 for plant among the embodiment 1 boot leaf in the i1i1-D of the blooming stage in land for growing field crops and Japan fine (WT), under first leaf and under the second leaf leaf angle take off data statistics.

Fig. 4 is the photo of i1i1-D two mutants plant and Japan's fine (WT) seedling pulvinus position adaxial and its surface cellscan Electronic Speculum among the embodiment 1.

Fig. 5 is i1i1-D two mutants among the embodiment 1, Japan fine (WT), transgenic positive plant R2 and the phenotype of R5 and the expression amount of OsILI1; A: the phenotype of positive transfer-gen plant; B: real-time quantitative PCR detects the relative expression quantity of OsILI1 in transfer-gen plant.

Fig. 6 is a PRE1 and AtIBH1 interactional experimental result in yeast and in the plant materials among the embodiment 2, and wherein A is that yeast two-hybrid detects PRE1 and AtIBH1 in external interaction; B: the result of AtIBH1-myc and PRE1-YFP co-immunoprecipitation in the tobacco body.

Fig. 7 uses the 24-epiBL final concentration as the aqueous solution processing Arabidopis thaliana wild-type col of 100nM and det2 two mutants seedling after 2 hours for detecting for the method for real-time quantitative PCR, the relative expression quantity of AtIBH1.

Fig. 8 is the root for real-time quantitative PCR detection wild-type Arabidopis thaliana col, seedling, and the lotus throne leaf, stem leaf, the relative expression quantity of AtIBH1 in inflorescence and the fruit position, angle, R, S, RL, CL, F, Si represent root respectively, seedling, lotus throne leaf, stem leaf, inflorescence and angle fruit.

Fig. 9 combines with the AtIBH1 promotor is intravital for the chromatin co-immunoprecipitation detects transcription factor BZR1, A wherein, and BZR1 ChIP-chip Genome Browser software is at the analysis synoptic diagram of AtIBH1 promoter region; The hollow rectangle frame is represented promoter region; The Filled Rectangle frame is represented the coding region, and black line is represented non-coding region, and empty circles is represented E-box; On behalf of BRRE, solid circles combine the territory, and on behalf of ChIP-qPCR, a and b analyze section; B, BZR1 chromatin co-immunoprecipitation analytical results.The Y axle refers to the long-pending degree of richness after qPCR analyzes selected section and BZR1 co-precipitation, and CNX5 is a crt gene, and Bar is the standard error of averaging after three secondary pollutants repeat.

Figure 10 crosses the phenotype of expressing the Arabidopis thaliana plant for AtIBH1 among the embodiment 3.

Figure 11 expresses the hypocotyl of Arabidopis thaliana plant under light and the situation of root for AtIBH1 among the embodiment 3 crosses, and wherein A is the phenotype of hypocotyl and root, and B is the relative length of hypocotyl and root.

Figure 12 expresses the Arabidopis thaliana plant hypocotyl darkling and the situation of root for AtIBH1 among the embodiment 3 crosses, and wherein A is the phenotype of hypocotyl and root, and B is the relative length of hypocotyl and root.

Figure 13 is the situation analysis of the transgenic arabidopsis Col of AtIBHI-RNAi among the embodiment 3, and wherein A is a phenotype analytical; B is that the expression amount of AtIBH1 detects.

Embodiment

Below in conjunction with specific embodiment the present invention is described further, but the present invention is not limited to following examples.

Among the following embodiment,, be ordinary method like no specified otherwise.

Used test materials among the following embodiment like no specified otherwise, is to buy from routine biochemistry reagent shop and obtains.

The genetic resources that the present invention relies on is following: Japanese fine paddy rice and two mutants plant i1i1-D obtained from the Chinese Academy of Agricultural Sciences in May, 2004, and its primary source is unclear; The direct sources of Arabidopis thaliana Columbia is that in June, 2004, Ka Neiji research institute obtained from Washington, and primary source is unclear.

The fine paddy rice of Japan: Institute of Botany, Chinese Academy of Sciences; Hair is for army building, Yang Xiufen, Ceng Hongmei, Yuan Jingjing, Qiu Dewen. and the fine japonica rice group of rice varieties Japan is trained the screening of substratum and is changeed the acquisition of rice blast fungus albumen exciton gene plant. " Journal of Agricultural Biotechnology ", 2008 16 5 phases of volume, 824-830.

In spend No. 10: Institute of Botany, Chinese Academy of Sciences; Li Guofu, Ni Pichong, Li Meifang. high frequency rice protoplast plant regeneration. " Botany Gazette ",, 35 (3): 234-237. in 1993

Arabidopis thaliana Columbia: Institute of Botany, Chinese Academy of Sciences; Liu Jun, Cai Pingzhong, Malin, Zhang Zhi is male, Xiang Yuewu, king Min Xia, Zhang Zhiyong. the clone of cold associated transcription factor CBF2 gene and the structure of plant expression vector thereof. " southwestern agriculture journal ", 2009 22 2 phases of volume, 428-432.

Arabidopis thaliana bri1-5: Institute of Botany, Chinese Academy of Sciences; Xuelu Wang; Xiaoqing LI, JillMwisenhelder, Tony Hunter; Shigeo Yoshida; Tadao Asami, and Joanne Chory.Autoregulation and Homodimerization Are Involved in the Activation of thePlant Steroid Receptor BRI1. " Development Cell ", 2005 the 8th phase 855-865.

Agrobacterium GV3101: Institute of Botany, Chinese Academy of Sciences; Zheng Yinying, Cui Baiming, Chang Mingjin, Peng Ming. change Arabidopis thaliana ICE1 gene and strengthen the cold resistant research of tobacco. " northwest Botany Gazette " .2009 29 volumes 1 phase .75-79.

Gene expression amount detected result in following examples all is that the destination gene expression amount with the wild-type plant is 1, and destination gene expression amount of other plant and the destination gene expression amount of wild-type plant compare.

The discovery of embodiment 1, OsILI1

One, the acquisition of two mutants plant i1i1-D and morphologic observation

1, the acquisition of two mutants plant i1i1-D

Make up Japanese fine paddy rice T-DNA and insert mutant library, therefrom found a two mutants plant i1i1-D that the leaf angle obviously increases.

2, the morphologic observation of two mutants plant i1i1-D

I1i1-D carries out following morphologic observation to the two mutants plant.

(1) leaf angle

The most important phenotype of i1i1-D is at its each growth period, all shows as the leaf angle and obviously increases.In the seedling phase, two mutants is sprouted back growth about 5 days, after second leaf development is complete, just can be observed the second leaf leaf angle bending and has surpassed 90 degree (see figure 1)s.In tillering phase, each new life of two mutants is tillered and is shown as the leaf angle and obviously increase (see figure 2).

To plant boot leaf in the Japanese fine and i1i1-D of the blooming stage in land for growing field crops, under first leaf and under the second leaf leaf angle measure; Statistics show the wild-type boot leaf, under first leaf and under the second leaf leaf corner dimension mainly concentrate between 0-30 °, the leaf angle of two mutants then mainly is distributed in (see figure 3) between 90-150 °.

(2) seed length

Detect the length of 100 fine seeds of Japan and 100 i1i1-D seeds respectively.The mean length of i1i1-D seed is 5.3 ± 0.1, and the mean length of Japanese fine seed is 4.8 ± 0.2, and significant difference has statistical significance.This shows, compares with Japan is fine, and the i1i1-D seed is elongated.

(3) elongation of pulvinus position cell

Method with ESEM is observed the cellular form of the Japanese fine of seedling phase and i1i1-D two mutants pulvinus position adaxial and its surface, sees Fig. 4.The result shows that the cell of i1i1-D two mutants pulvinus position adaxial and its surface is more more obvious than the elongation of the Japanese fine same area cell of wild-type.

3, the morphologic observation of the filial generation of two mutants plant i1i1-D

After i1i1-D seminal propagation, the offspring continues to occur the phenotype that the leaf angle increases.These results show that the phenotype that i1i1-D leaf angle increases all is stable in each growth period, but and phenotype be genetic stability.

Two, the discovery of OsILI1

According to the T-DNA carrier sequences Design primer that inserts, carry out the Tail-PCR amplification, then the PCR product is reclaimed, deliver to company's order-checking, again sequencing result is carried out the BLASTn comparison in ncbi database.The result shows that T-DNA is inserted on No. 4 pairing sequences of karyomit(e) BAC clone OsJNBa0063C of paddy rice.

The dna fragmentation that T-DNA is inserted each 10kb of both sides with the method for Real-time PCR in Japan the expression among the fine and iii1-D analyze; The result shows that wherein section of DNA (DNA shown in the sequence 2) has raised nearly 20 times in the i1i1-D two mutants; Therefore infer it to be because the 35S promoter on the T-DNA is inserted near the DNA shown in the sequence 2; Cause the overexpression of the DNA shown in the sequence 2, thereby caused the phenotype of OsILI1 two mutants.

Three, the Function Identification of OsILI1

Sequence 2 is gone in the RNAi carrier from the 116th to the 297th nucleotide construction of 5 ' end, transform i1i1-D, reduce the expression amount of the DNA shown in the sequence 2 in the two mutants in the hope of the method for interfering with RNA.Obtained 11 strain systems altogether, most of transgenic positive plant has all recovered the wild-type phenotype.Selecting the several strains in the transgenic positive plant at random is further to identify; Two strains are the phenotype that R2 and R5 have obviously returned to wild-type; Through detecting, the expression amount in plant of the DNA shown in the sequence 2 obviously reduces (see figure 5) with respect to the i1i1-D two mutants.The result shows that the degree of DNA shown in the sequence 2 and transfer-gen plant recovery wild-type is closely related.

Above result shows: the phenotype of i1i1-D two mutants is because T-DNA is inserted near the DNA shown in the sequence 2, and the DNA overexpression shown in the last 35S promoter drive sequences 2 of T-DNA causes.Protein shown in the sequence 1 of the dna encoding sequence table shown in the sequence 2 of sequence table; According to phenotype with the protein called after OsILI1 shown in the sequence 1 (Oraza sativa increased leaf inclination-1), with the encoding sox called after OsILI1 of OsILI1.

The discovery of embodiment 2, AtIBH1

One, the discovery of AtIBH1

Through the OsILI1 protein sequence is analyzed and can be known, OsILI1 belongs to basic helix-loop-helix (bHLH) type of transcription factor family, but it does not have typical basic structural domain.This type of bHLH albumen is classified as D class bHLH albumen, and they can not directly combine DNA, mainly through forming heterodimer to regulate their function with typical bHLH transcription factor.As bait, utilize yeast-two hybrid technique screening and the interactional albumen of OsILI1 with the OsILI1 full-length proteins.After the encoding sequence of OsILI1 increased, be connected into the pBD-GAL4 carrier from the cDNA library, change the carrier that builds over to yeast AH109 then, be made into competent cell after, cotransformation paddy rice yeast two-hybrid in tri-leaf period library.The efficient in sieve storehouse is 3 * 10 ⁵Clone/g DNA, total sieve storehouse amount is 3 * 10 ⁶The clone, the clone's number that can on-His/-Trp/-Leu SD substratum, grow is 22, the clone's number that can on-His/-Trp/-Leu/-Ade SD substratum, grow at last is 10.These 10 clones are carried out sequencing analysis; Finding wherein has 5 to belong to the bHLH transcription factor; Clone 16 has wherein occurred in screening 3 times, this is cloned pairing protein sequence guard domain analysis, finds that it is a bHLH transcription factor that typically contains basicdomain; Therefore we choose this albumen and carry out next step research, at this with its called after AtIBH1 (OsILI1-binding bHLH protein 1).

In ncbi database, carry out the blastP comparison of protein sequence with the protein sequence of OsIBH1, find in Arabidopis thaliana with the highest albumen corresponding codes gene of OsIBH1 similarity to be At2g43060.Therefore with At2g43060 called after AtIBH1.The aminoacid sequence of AtIBH1 is shown in sequence in the sequence table 3; The encoding sequence of the encoding sox AtIBH1 of AtIBH1 is shown in sequence in the sequence table 4; Its complete sequence is shown in sequence in the sequence table 5; The complete encoding sequence (sequence 4 in the sequence table) of AtIBH1 increased to be building up in the pAD-GAL4 carrier after coming out from the cDNA library is built into pAD-AtIBH1, and with pBD-PRE1 cotransformation yeast competent cell, coating-Trp/-Leu SD is dull and stereotyped; Then the bacterium colony that grows is changed over to-cultivate on the His/-Trp/-Leu/-Ade SD substratum; The result shows that the yeast colony that contains pBD-PRE1 and pAD-AtIBH1 can growth well on-His/-Trp/-Leu/-Ade SD flat board, and contrast then can not be grown, and this explanation PRE1 and AtIBH1 exist interaction (Fig. 6 A) really in yeast.

After amplification is come out in the complete encoding sequence cDNA library of AtIBH1, be building up in the carrier that has the myc label of 35S promoter driving, obtain the AtIBH1-myc carrier.Then with AtIBH1-myc and PRE1-YFP ratio transient expression in tobacco with equivalent.After the tobacco behind the injection bacterium liquid is cultivated 48 hours; Choose the good tobacco leaf of growth conditions and under fluorescent microscope, observe the YFP fluorescent signal; And take a morsel to organize respectively and do western hybridization with anti-GFP and anti-myc antibody and detect the content of organizing endonexin; The co-immunoprecipitation that is used for next step of anti-GFP and anti-myc hybridization signal homogeneous (Co-Immunoprecipitation, Co-IP), singles the blade of AtIBH1-myc as negative contrast.The result is illustrated in after the co-precipitation; The elution samples of had only cotransformation AtIBH1-myc and PRE1-YFP just has signal with anti-myc hybridization; The sample that has singly the changeed AtIBH1-myc signal of behind wash-out, then can not mixing, this explanation AtIBH1-myc and PRE1-YFP also have interaction (Fig. 6 B) in vivo.

Two, the Function Identification of AtIBH1

1, BR is to the adjusting of AtIBH1 genetic expression

Use the 24-epiBL final concentration to handle Arabidopis thaliana wild-type col and det2 two mutants seedling 2 hours as the aqueous solution of 100nM; Untreated Arabidopis thaliana wild-type col and det2 two mutants seedling are as contrast; Extract the RNA reverse transcription, utilize the expression of the methods analyst AtIBH1 of real-time quantitative PCR, the result is illustrated among the synthetic defective two mutants det2 of BR; The expression amount of AtIBH1 is with respect in wild-type, rising; And after external source applied BR, the expression amount of AtIBH1 was than the contrast downward modulation, and the expression of this explanation AtIBH1 is (accompanying drawing 7) that suppressed by BR.

2, the analysis of AtIBH1 gene expression pattern

Get the root of wild-type Arabidopis thaliana col respectively, seedling, lotus throne leaf; Stem leaf, the RNA reverse transcription is extracted at inflorescence and fruit position, angle, utilizes the expression of the methods analyst AtIBH1 of real-time quantitative PCR; The result shows that AtIBH1 is mainly at root; The lotus throne leaf, mature tissues such as stem leaf express, and lower at young tender position expression amounts such as unopened buds; PRE1 then mainly expresses at the tender position of children, and this shows AtIBH1 and PRE1 these organ coexpressions at Arabidopis thaliana, not only in proper order but also regulating the elongation (accompanying drawing 8) of vegetable cell overlappingly.

3, transcription factor BZR1 is to the adjusting of AtIBH1

BZR1 is the important transcription factor in the BR signal pathway; It directly is attached to CGTG (T/C) the G conserved sequence on the BRs synthetic gene promotor through the DNA binding domains; Be that (BR responseelement BRRE), regulates these expression of gene to the BR response element.Through the AtIBH1 promoter sequence is analyzed, found possible action site CGTG (T/C) G of some BZR1.For the promoter region of confirming BZR1 albumen and PRE1, AtIBH1 has direct interaction, make the experiment (chromatin immunoprecipitation) of chromatin co-immunoprecipitation of the transgenic arabidopsis of pBZR1:BZR1-CFP.Transgenic arabidopsis fixing protein-DNA mixture under the viable cell state with pBZR1:BZR1-CFP; And it is cut to the chromatin small segment in the certain-length scope at random; Precipitate this complex body through immunological method with anti-GFP antibody then; Enrichment target protein bonded dna fragmentation specifically; ChIP DNA hybridizes on the Affymetrix gene chip, and the result analyzes with BZR1 ChIP-chip Genome Browser software, and the result shows that AtIBH1 has enrichment at a section shown in Fig. 9 A.Use again according to BRs response element enrichment region designed primer on the AtIBH1 promotor and carry out pcr amplification.The result is illustrated in the pBZR1:BZR1-CFP sample behind the co-immunoprecipitation, and the promotor selection area of AtIBH1 is with respect to tangible enrichment is arranged in contrast.This shows that BZR1 and AtIBH1 promotor have direct interaction (Fig. 9 B) in vivo.

Embodiment 3, AtIBH1 cross the acquisition of expressing the Arabidopis thaliana transfer-gen plant

One, the structure of recombinant expression vector

1, the segmental acquisition of 35S promoter

With restriction enzyme HindIII and BamHI plasmid vector pBI221 (Clontech) is carried out double digestion, after agarose gel electrophoresis detects, reclaim the 35S promoter fragment that length is about 0.8kb.

2, with restriction enzyme Sac I and EcoR I Noster poly A terminator sequence is downcut from plasmid vector pBI221 (Clontech), be connected in the corresponding site of carrier pUC19 (TaKaRa company), obtain recombinant vectors, called after pUC19-Noster.Use restriction enzyme HindIII and BamHI double digestion pUC19-Noster again; After agarose gel electrophoresis detects; Reclaim the big fragment of linearizing carrier, and will reclaim the 35S promoter fragment that fragment and step 1 obtain and link to each other, obtain recombinant vectors pUC19-35S-Noster.

3, recombinant vectors cutting-out partially digested with restriction enzyme EcoR I and that the HindIII complete degestion makes up from step 2 comprises the fragment of 35S and Noster; This fragment cloning is gone into plasmid vector pCAMBIA1301 (Center for the Application of Molecular Biology to International Agriclture; Www.cambia.org) the EcoR I of MCS and HindIII site; Obtain recombinant vectors, called after pSN1301.

4, extract total RNA of Arabidopis thaliana wild-type col, RNA is synthesized cDNA with reversed transcriptive enzyme.The cDNA that obtains with reverse transcription is a template, carries out the encoding sequence that pcr amplification prepares AtIBH1, and the primer of pcr amplification is following:

F：CCG GGATCC

BamHI

R：GCG GGTACC

KpnI

With pcr amplification product order-checking, the result show amplified production have sequence 5 in the sequence table from ' Nucleotide shown in the end 54-600 position, this amplified production has comprised the encoding sequence of the AtIBH1 shown in the sequence 4.Amplified production is connected into BamHI and the KpnI restriction enzyme site of pSN1301, obtains containing the recombinant expression vector of AtIBH1, called after AtIBH1-OX.Recombinant expression vector is correct through the order-checking check.

Two, AtIBH1 crosses the acquisition of express transgenic plant

1, the recombinant expression vector that step 1 is made up changes Agrobacterium GV3101 over to, is used for arabidopsis thaliana transformation Col and BR signal transduction two mutants Arabidopis thaliana bri1-5, obtains transgenic plant (AtIBH1-OX/Col and AtIBH1-OX/bri1-5), and concrete steps are following:

1) picking contains the Agrobacterium mono-clonal of expression vector on the YEB flat board, and be inoculated in 10ml and contain in the YEB liquid nutrient medium of microbiotic (50mg/L card receive mycin), 28 ℃, 200rpm, shaking culture to logarithmic growth late period.

2) be transferred in the 50ml YEB substratum in 1: 50 ratio, 28 ℃, 200rpm, shaking culture is to OD ₆₀₀Be about 0.6.

3) 5,000rpm, centrifugal 15 minutes, collect thalline, (5% sucrose 0.02%silwetL-77), is transferred OD to be resuspended in the infiltration damping fluid ₆₀₀To about 0.6.

4) get the Arabidopis thaliana of blooming, cut off the fruit pod that forms before transforming, then whole inflorescence is immersed in the bacteria suspension of step 3) 15 seconds, make Agrobacterium well stick in the inflorescence and transform.

5) Arabidopis thaliana after Agrobacterium is infected is put in shady place and preserves moisture and cultivated 24 hours, Arabidopis thaliana is moved on to continue normal cultured in the culturing room then, soaks after 7-10 days to transform once again.

6) the sophisticated Arabidopis thaliana seed of results with after the sterilization of 10% Youxiaolin, is layered on and contains on the corresponding antibiotic 1/2MS substratum after fully drying, the resistance seedling (T that screening obtains ₁Generation) moves into continuation cultivation in the soil.

Replace recombinant expression vector with pSN1301, empty carrier T is changeed in preparation ₁For plant, method is the same.

2, to No. 1 of the transgenic arabidopsis Col that changes AtIBH1-OX, No. 2, the T of No. 3 strains system ₁Further analyze (with changeing empty carrier T for plant ₁For plant and non-transgenic Arabidopis thaliana Col as contrast).

To change empty carrier T ₁For plant, non-transgenic Arabidopis thaliana Col and No. 1 strain system, No. 2 strains system and No. 3 strains be plant under 25 ℃ of conditions, cultivate three time-of-weeks, the result who takes pictures is shown in Figure 10 A, owing to change empty carrier T ₁Identical with Arabidopis thaliana Col phenotype for plant, the contrast among Figure 10 A only shows Arabidopis thaliana Col.Visible by Figure 10 A, transfer-gen plant diminishes, compactness, petiole shortens, blade diminishes and justifies, dark green leaf color, wherein with No. 3 phenotype for the most obvious.In the ripening stage, it is obviously late than other strain systems and wild-type to bloom for No. 3, and its main tongue is also very short and small.Expression amount to AtIBH1 in these transfer-gen plants detects (primer: F:GGAGCAGAGCCCTCTTGCG; R:GCTCTCTGGTTACTCCTCCTCCG), find that the phenotype of transfer-gen plant is corresponding with the expression amount of AtIBH1, in the strongest No. 2 of phenotype, the expression amount of AtIBH1 is maximum.

3, to the T of No. 1 strain system of the transgenic arabidopsis bri1-5 that changes AtIBH1-OX ₁Further analyze (with changeing empty carrier T for plant ₁For plant and non-transgenic Arabidopis thaliana bri1-5 as contrast).

Just change empty carrier T ₁Tie up under 25 ℃ of conditions, cultivate three time-of-weeks for plant, non-transgenic Arabidopis thaliana bri1-5 and No. 1 strain, the result who takes pictures is shown in Figure 10 B, because of changeing empty carrier T ₁Identical with Arabidopis thaliana bri1-5 phenotype for plant, the contrast among Figure 10 B only shows Arabidopis thaliana bri1-5.Visible by Figure 10 B, transfer-gen plant is littler with respect to contrast, compactness, and petiole obviously shortens, and blade diminishes round, dark green leaf color.Expression amount to AtIBH1 in these transfer-gen plants detects (primer: F:GGAGCAGAGCCCTCTTGCG; R:GCTCTCTGGTTACTCCTCCTCCG), the phenotype of discovery transfer-gen plant is corresponding with the expression amount of AtIBH1.

4, ATIBH1 crosses expression plant seedling hypocotyl and root shortening under light

With No. 3 strains system of the transgenic arabidopsis Col of AtIBH1-OX, change empty carrier T ₁For plant and non-transgenic Arabidopis thaliana Col 4 ℃ of refrigerator vernalization two days on 1/2MS, (45umol m under identical intensity of illumination ^-2s ^-1) illumination in 20 hours, 4 hours dark 22 ℃ of relative lengths of observing phenotype and statistics hypocotyl and root after growing simultaneously six days.The relative length measuring method is: Col and AtIBH1-OX/Col measure 45 seedling respectively; After the equal length of making even, be 1 with the mean length of Col, the ratio of the length of ATIBH1-OX/Col and Col is ordinate zou; The result is shown in figure 11, non-transgenic Arabidopis thaliana Col and commentaries on classics empty carrier T ₁Phenotype for plant is consistent, and the contrast among Figure 11 only shows non-transgenic Arabidopis thaliana Col.Visible by Figure 11, ATIBH1 crosses expression plant seedling and compares with non-transgenic Arabidopis thaliana Col, and hypocotyl and root after under light, cultivating shorten.

5, ATIBH1 crosses expression plant seedling darkling than wild-type hypocotyl and root shortening

With No. 3 strains system of the transgenic arabidopsis Col of AtIBH1-OX, change empty carrier T ₁For plant and non-transgenic Arabidopis thaliana Col on the 1/2MS substratum, 4 ℃ of refrigerator vernalization treatment two days, light was placed 2 hours for following 22 ℃, growth is observed phenotype after 6 days and is added up the relative length of hypocotyl and root according to the method described above in dark fully.

The result is shown in figure 12, and ATIBH1 crosses expression plant seedling and compares with non-transgenic Arabidopis thaliana Col, cultivates back hypocotyl and root darkling and shortens.Because non-transgenic Arabidopis thaliana Col and commentaries on classics empty carrier T ₁Phenotype for plant is consistent, and the contrast among Figure 12 only shows non-transgenic Arabidopis thaliana Col.

The acquisition of embodiment 4, AtIBH1-RNAi Arabidopis thaliana transfer-gen plant

One, the structure of recombinant expression vector

1, the acquisition of target fragment

Extract total RNA of Arabidopis thaliana wild-type col, RNA is synthesized cDNA with reversed transcriptive enzyme.The cDNA that obtains with reverse transcription is a template, carries out pcr amplification, and the primer of pcr amplification is following:

F：CG CGGTACC

KpnI Spe I

R：GCG GGATCC

BamH I Sac I

2, make up recombinant expression vector

Pcr amplification product (sequence 5 from the fragment shown in 5 ' the end 66-359 position) enzyme is cut two-step approach to be connected into TCK309 (cutting pcr amplification product with Spe I with Sac I enzyme earlier is connected with pTCK309; Cut pcr amplification product with BamHI and KpnI enzyme more on this basis and be connected into reverse fragment); Obtain containing the recombinant expression vector of AtIBH1, called after AtIBH1-RNAi.Recombinant expression vector is correct through the order-checking check.

Wherein, the construction process of pTCK309 is following:

Contain KpnI, XhoI, SalI, ClaI, SpeI, XbaI, the fragment of SacI restriction enzyme site (sequence 6 in the sequence table) is inserted between the KpnI and SacI restriction enzyme site of pBluescript II SK+ (Stratagene) carrier, constitutes pTCK302;

Use 5 '-GGTAAGTTACTACAAACCTTTTTG-3 ' and 5 '-TGAAAATCTCGAAACAGCCGTGTC-3 ' primer from paddy rice (spend No. 10) genomic dna, to amplify the paddy rice intron of 478bp then, be connected into pGEM-T ( Promega) carrier, constitute reorganization T carrier;

With primer 5 '-GCGTCGACAGATCTGCTAGCGGTAAGTTAC-3 ' and 5 '-CCATCGATCTGAAAATCTCGAAACAGCCGTG-3 ' from as pcr amplification the reorganization T carrier of template; The PCR product is cut and is cloned in the above-mentioned pTCK302 carrier with Sal I and Cla I enzyme, the carrier called after pTCK302-1 of formation.Then with KpnI and Sacl respectively enzyme cut the pSN1301 among pTCK302-1 and the embodiment 3, reclaim the big fragment and the small segment of pTCK302-1 of pSN1301, big fragment is connected formation pTCK309 with small segment.

Two, AtIBH1-RNAi Arabidopis thaliana transfer-gen plant

1, the recombinant expression vector that step 1 is made up imports Arabidopis thaliana col according to the method that embodiment 3 step 2 provide, and obtains transgenic arabidopsis (AtIBH1-RNAi/Col).

Replace recombinant expression vector with pTCK309, empty carrier T is changeed in preparation ₁For plant, method is the same.

2, to 8,1,5,9 of the transgenic arabidopsis Col that changes AtIBH1-RNAi, the T of No. 4 strains system ₁Further analyze for plant

To change empty carrier T ₁For plant, non-transgenic Arabidopis thaliana Col and 8,1,5,9, No. 4 strains be plant under 22 ℃ of conditions, cultivate 30 day time, the result who takes pictures is shown in figure 13, because of changeing empty carrier T ₀Identical with Arabidopis thaliana Col phenotype for plant, the contrast among the figure is merely Arabidopis thaliana Col.Visible by Figure 13 A, the whole plant of transfer-gen plant becomes big, wherein with No. 1 phenotype for the most obvious.Expression amount to AtIBH1 in these transfer-gen plants detects (primer: F:GGAGCAGAGCCCTCTTGCG; R:GCTCTCTGGTTACTCCTCCTCCG), find that the phenotype of transfer-gen plant is and the expression amount of AtIBH1 corresponding (Figure 13 B), in the strongest No. 1 of phenotype, the expression amount of AtIBH1 is minimum.

Sequence table

< 110>Institute of Botany, Chinese Academy of Sciences

Biological Technology institute, Chinese Academy of Agricultural Sciences

Washington Ka Neiji research institute

< 120>a kind of albumen and encoding sox and application of controlling plant growth

<160>6

<210>1

<211>104

<212>PRT

< 213>japonica rice Japan fine (Oryza sativa)

<400>1

Met Ser Ser Ser Arg Arg Ser Arg Ser Arg Arg Ala Gly Ser Ser Val

1 5 10 15

Pro Ser Ser Ser Ser Ser Ser Arg Thr Ser Ile Ser Glu Asp Gln Ile

20 25 30

Ala Glu Leu Leu Ser Lys Leu Gln Ala Leu Leu Pro Glu Ser Gln Ala

35 40 45

Arg Asn Gly Ala His Arg Gly Ser Ala Ala Arg Val Leu Gln Glu Thr

50 55 60

Cys Ser Tyr Ile Arg Ser Leu His Gln Glu Val Asp Ash Leu Ser Glu

65 70 75 80

Thr Leu Ala Gln Leu Leu Ala Ser Pro Asp Val Thr Ser Asp Gln Ala

85 90 95

Ala Val Ile Arg Ser Leu Leu Met

100

<210>2

<211>315

<212>DNA

< 213>japonica rice Japan fine (Oryza sativa)

<400>2

atgtcgagca gccggaggtc gcgctcacgg cgagccggga gctcggtgcc gtcgtcgtcg 60

tcgtcgtcga ggacgtcgat ctcggaggac cagatcgccg agcttctctc caagcttcag 120

gccctgctcc cggagtctca ggctcgcaat ggcgcccata ggggctcggc ggcgagggtt 180

ttgcaggaga cgtgcagcta catcaggagc ctgcaccagg aggtggacaa cctcagcgag 240

acgctcgctc agctgctcgc ctcccccgac gtcaccagcg accaggcggc cgtcatcagg 300

agcctcctca tgtga 315

<210>3

<211>156

<212PRT

< 213>Arabidopis thaliana Columbia (Arabidopsis thaliana)

<400>3

Met Ala Ser Ala Asp Lys Leu Ile Asn Thr Asp Val Pro Glu Lys Asp

1 5 10 15

Val Phe Ala Phe His Phe Leu Gln Ser Leu Ser Asn Leu Arg Lys Gln

20 25 30

Asn Pro Phe Asp Thr Pro Asp Gln Lys Asn Tyr Arg Val Arg Lys Ile

35 40 45

Lys Lys Ala Ala Tyr Val Ser Met Ala Arg Ala Ala Gly Gly Ser Ser

50 55 60

Arg Leu Trp Ser Arg Ala Leu Leu Arg Arg Ala Asp Lys Asp Asp Asn

65 70 75 80

Lys Ile Val Arg Phe Ser Arg Arg Lys Trp Lys Ile Ser Ser Lys Arg

85 90 95

Arg Arg Ser Asn Gln Arg Ala Pro Val Val Glu Glu Ala Ala Glu Arg

100 105 110

Leu Arg Asn Leu Val Pro Gly Gly Gly Gly Met Glu Thr Ser Lys Leu

115 120 125

Met Glu Glu Thr Ala His Tyr Ile Lys Cys Leu Ser Met Gln Val Lys

130 135 140

Val Met Gln Cys Leu Val Asp Gly Leu Ser Pro Lys

145 150 155

<210>4

<211>471

<212>DNA

< 213>Arabidopis thaliana Columbia (Arabidopsis thaliana)

<400>4

atggcctctg cagacaaact cataaacaca gatgtccctg aaaaggacgt ttttgccttc 60

cacttcctcc aatccctctc aaatctcaga aaacaaaacc cttttgatac tccggaccaa 120

aaaaactacc gcgtgaggaa gatcaagaag gctgcgtacg tttccatggc cagagcagcc 180

ggagggagta gccggctatg gagcagagcc ctcttgcgta gagcagacaa agatgacaac 240

aagatcgtaa gattttcaag gaggaagtgg aagatatcat caaaacggag gaggagtaac 300

cagagagctc cggtggtgga ggaggcggcg gagaggctga ggaatcttgt tccgggaggc 360

ggaggaatgg agacgtcaaa gctgatggaa gagacggctc attacatcaa gtgccttagt 420

atgcaggtca aggtcatgca gtgtctcgtt gatggcttat ctcccaaatg a 471

<210>5

<211>898

<212>DNA

< 213>Arabidopis thaliana Columbia (Arabidopsis thaliana)

<400>5

aaaaaaaaaa aagttttata aaggttctca actcaagttc tcttctctaa aaaacccaaa 60

caatggcctc tgcagacaaa ctcataaaca cagatgtccc tgaaaaggac gtttttgcct 120

tccacttcct ccaatccctc tcaaatctca gaaaacaaaa cccttttgat actccggacc 180

aaaaaaacta ccgcgtgagg aagatcaaga aggctgcgta cgtttccatg gccagagcag 240

ccggagggag tagccggcta tggagcagag ccctcttgcg tagagcagac aaagatgaca 300

acaagatcgt aagattttca aggaggaagt ggaagatatc atcaaaacgg aggaggagta 360

accagagagc tccggtggtg gaggaggcgg cggagaggct gaggaatctt gttccgggag 420

gcggaggaat ggagacgtca aagctgatgg aagagacggc tcattacatc aagtgcctta 480

gtatgcaggt caaggtcatg cagtgtctcg ttgatggctt atctcccaaa tgatcatcaa 540

ttaatcatca acatcatcat caatgatcga tgtatataga gatacgacac atacatagtc 600

tattggattg gggtaatcat aacgaatata tatgtgtata tatatatata tatatatata 660

tatattctta tatatataca tacgtgtaag ataggataca tatatgaaat gtgtggatat 720

gtattagtct cgaagtaacg aaagattttt ttctttttct tttcttgaat tttgataaaa 780

ggggatttat tatttatcat atgctatggc cggtttaaac attagggctt ggtaacttgc 840

ccttgtcata tgataaaagg ggatttatta cttatcatat gctaagagaa ttttcttt 898

<210>6

<211>42

<212>DNA

< 213>artificial sequence

<220>

<223>

<400>6

ggtaccctcg aggtcgacat cgatactagt tctagagagc tc 42

Claims (9)

1. the application of protein in regulating development of plants of forming by the aminoacid sequence shown in the sequence in the sequence table 3; Said development of plants is embodied in on the size of strain plant height and/or petiole length and/or hypocotyl length and/or blade.

2. a method of cultivating transgenic plant is following 1) or 2) method:

1) will import by the proteinic encoding sox that the aminoacid sequence shown in the sequence in the sequence table 3 is formed in the purpose plant; Obtain transgenic plant, said transgenic plant become transgenic plant short and/or that petiole shortens and/or hypocotyl shortens and/or blade diminishes for compare plant height with said purpose plant;

2) the proteinic encoding sox that the aminoacid sequence shown in the sequence 3 is formed in will be by sequence table in the purpose plant suppresses to express, and obtains transgenic plant, and the plant type size of said transgenic plant is greater than said purpose plant.

3. method as claimed in claim 2 is characterized in that: said proteinic encoding sox is following 1) or 2) or 3) dna molecular:

1) its encoding sequence is the dna molecular shown in the sequence 4 in the sequence table;

2) in the sequence table sequence 5 from ' dna molecular shown in the end 54-600 position;

3) dna molecular shown in the sequence 5 in the sequence table.

4. like claim 2 or 3 described methods, it is characterized in that: said method 1), said proteinic encoding sox imports in the said purpose plant through the recombinant expression vector that contains said proteinic encoding sox.

5. method as claimed in claim 4 is characterized in that: the recombinant expression vector that said recombinant expression vector obtains for the MCS that said proteinic encoding sox is inserted plasmid pSN1301;

Said plasmid pSN1301 obtains inserting the 35S-Noster sequence between the EcoRI of plasmid pCAMBIA1301 and HindIII restriction enzyme site;

Said 35S-Noster sequence obtains with HindIII complete degestion plasmid pUC19-35S-Noster with restriction enzyme EcoRI is partially digested;

Said plasmid pUC19-35S-Noster obtains inserting the 35S promoter fragment between the HindIII of plasmid pUC19-Noster and BamHI restriction enzyme site;

Said 35S promoter fragment obtains with restriction enzyme HindIII and BamHI double digestion plasmid pBI221;

Said plasmid pUC19-Noster obtains inserting Nosterpoly A terminator sequence between the Sac I of plasmid pUC19 and EcoR I restriction enzyme site; Said Noster poly A terminator sequence obtains with restriction enzyme Sac I and EcoRI double digestion plasmid pBI221.

6. like claim 2 or 3 described methods, it is characterized in that: said method 2), the inhibition expression imports AtIBH1-RNAi in the purpose plant and realizes;

Said AtIBH1-RNAi is that the fragment forward from shown in 5 ' the end 66-359 position with sequence in the sequence table 5 inserts between SpeI and the Sac I restriction enzyme site of pTCK309 and constitutes pTCK309-1; The fragment from shown in 5 ' the end 66-359 position of sequence in the sequence table 5 is oppositely inserted BamH I and the Kpn I restriction enzyme site of pTCK309-1, formation AtIBH1-RNAi;

The construction process of said pTCK309 is following: the fragment shown in the sequence in the sequence table 6 is inserted between the KpnI and SacI restriction enzyme site of pBluescriptII SK+, constituted pTCK302; From paddy rice, spend the paddy rice intron that amplifies 478bp in No. 10 genomic dnas with 5 '-GGTAAGTTACTACAAACCTTTTTG-3 ' and 5 '-TGAAAATCTCGAAACAGCCGTGTC-3 ' primer, be connected into the pGEM-T carrier, constitute reorganization T carrier; With said reorganization T carrier is template; With primer 5 '-GCGTCGACAGATCTGCTAGCGGTAAGTTAC-3 ' and 5 '-CCATCGATCTGAAAATC TCGAAACAGCCGTG-3 ' pcr amplification; Amplified production is cut and is cloned in the said pTCK302 carrier with Sal I and Cla I enzyme, the carrier called after pTCK302-1 of formation; Cutting pTCK302-1 with KpnI and Sacl enzyme obtains constituting pTCK309 between KpnI and Sacl restriction enzyme site that small segment inserts said pSN1301.

7. like claim 2 or 3 described methods, it is characterized in that: said purpose plant is a dicotyledons.

8. method as claimed in claim 7 is characterized in that: said dicotyledons is an Arabidopis thaliana.

9. method as claimed in claim 8 is characterized in that: said Arabidopis thaliana is the Columbia Arabidopis thaliana.

Images