CN104073512B - Method for regulating endogenous ethylene content of plant - Google Patents

Abstract

The invention relates to a method for regulating the endogenous ethylene content of plant and discloses the negative regulation of arabidopsis thaliana synthesis by CKI8 (also called CK1.8). Therefore, CKI8 can be used for regulating the ethylene content in specific crop so as to realize improvement of the plant variety.

Description

A kind of method of the plant endogenous ethylene contents of regulation and control

Technical field

A kind of the invention belongs to plant genetic engineering field, it relates in particular to the side of the plant endogenous ethylene contents of regulation and control Method.

Background technology

Ethylene is a kind of phytohormone with gaseous state presence.Come from eighties of last century, ethylene is as a kind of signaling molecule The important function playing in plant body is gradually recognized by people, is therefore listed in one of big hormone of plant six.Ethylene is being planted All serve important regulation and control in the aging of son sprouting, blade and flower, fruit maturation, cell elongation, adverse circumstance and cause of disease reaction to make With.

Dark grow lower Arabidopsis thaliana Seedlings in higher concentration (> 0.1 μ l/l) ethylene process under occur the three of composing type React again, including the elongation of suppression hypocotyls and root, promote hypocotylar expansion and seedling apical too to bend.In normal conditions Under, the ethylene in plant cell needs to maintain a relatively low concentration to keep its normal growth, when generation environmental change Or when meeting with infringement, plant needs rapidly synthesizing ethylene to tackle these changes, to ensure the growth of itself, to study ethylene Some regulatory mechanisms in building-up process contribute to being best understood from the plant regulation and control of ethylene and response in growth and development process Process, thus realize the g and D of artificial regulatory plant.Zhang Shuqun etc. (referring to liu and zhang, 2004；han et Al, 2010 reports) for the phosphorylated regulation of acs, mapk is a highly important class egg in eukaryote to very concern mapk White kinases, is respectively provided with vital function in growth and development of plants with degeneration-resistant reaction, arabidopsiss mpk3/6 and they Isozyme sipk, wipk in Nicotiana tabacum L. has both participated in the degeneration-resistant reaction of plant, and have impact in plant body and have ethylene synthase, its Middle mpk3/6 passes through classes acs such as phosphorylation acs2/6 and is just regulating and controlling its activity, and and then have impact on the ethylene in disease resistance response Synthesis.In addition ethylene synthase can discharge in fruit maturation in a large number, promotes it ripe, and the coming off of blade.Ethylene is in plant Leaf senile, disease resistance response, water resistant flood in also play a very important role.During plant senescence, ethylene contents can be gone up Rise, thus accelerating this process.Botrytis cinerea (botrytis cinerea) can induce the ethylene synthase of plant, thus joining During this disease resistance response.Additionally, ethylene plays positive regulating and controlling effect in water resistant is flooded in Oryza sativa L..

The synthesis of Plant Ethylene is a very conservative and relatively simple process, can be by its precursor s- S-adenosylmethionine Under acc synthase (acc synthases, acss) catalysis, synthesize acc, further ethylene is oxidized to by acc oxidase (aco) Gas (ethylene), as a kind of gas hormone, can be conveniently used in the Preservation of Agricultural Products such as the accelerating ripening of fruit；In addition by Play a very important role during ethylene floods for Oryza sativa L. ground water resistant, the ethylene contents in regulation and control plant body have very Important function.

The precursor of ethylene is methionine (methionine), and methionine and atp react generation s- adenosine-l- first sulfur ammonia Sour (adomet), then generate 1- amino-cyclopropane -1- carboxylic acid (1-aminocyclopropane-1- after acs catalysis Carboxylic acid, acc)；Acc generates second with oxygen reaction under the catalysis of acc oxidase (acc oxidase, aco) Alkene (ethylene), co₂And hcn.Methionine is a kind of biological internal essential amino acids, by isotope-labeled method Find that the carbon atom on the 3rd, 4 of methionine ultimately forms ethylene during synthesizing ethylene, and remaining methyl mercapto Then constantly recycling is circulated by Young.Methionine is reacted with atp, is catalyzed by adomet synthase and generates adomet, A kind of intermediate of ethylene synthase.Adomet is catalyzed through acs and generates acc, during this process is Synthesis pathway One rate-limiting step.

, except being regulated and controled in growth and development of plants and response environment change, it can also simultaneously for the building-up process of ethylene It is associated with some other signal path, form a complicated regulated and control network, the such as interaction of ethylene and optical signal；Auxin energy Enough expression promoting all acs albumen in addition to acs1, ga and ethylene regulate and control arabidopsiss etiolated seedling top crotch growth etc. jointly. The regulation process untiing ethylene synthase and its signal path completely is wanted to also need to more study and explore.

Therefore, this area is in the urgent need to providing a kind of means effectively and delicately regulating and controlling plant endogenous ethylene contents.

Content of the invention

It is an object of the invention to provide a kind of method of the plant endogenous ethylene contents of regulation and control.

In a first aspect of the present invention, provide ethylene contents or tune in a kind of regulation and control (including: raise or lower) plant body The method of control plant growing character, methods described includes: the expression of cki8 gene (being also called ck1.8) in regulation and control plant body.

In a preference, described cki8 gene code:

The polypeptide of aminoacid sequence shown in (a) seq id no:2；Or

B () is by aminoacid sequence shown in seq id no:2 through one or more (such as 1-20；Preferably 1-10；More Good ground 1-5；More preferably 1-3) replacement of amino acid residue, disappearance or interpolation and formed, and there is (a) polypeptide function By polypeptide derived from (a)；

C () and aminoacid sequence shown in seq id no:2 have 70% (preferably 80%；More preferably 90%；More preferably 95%；More preferably 98%；More preferably 99%) above homogeny, and have (a) polypeptide function by polypeptide derived from (a).

In another preference, described cki8 gene is:

(1) polynucleotide of nucleotide sequence shown in seq id no:1；

(2) albumen that the polynucleotide sequence that nucleotide sequence can be limited with (1) under strict conditions hybridizes and encodes The polynucleotide of ethylene contents in plant body can be lowered；

(3) polynucleotide sequence that nucleotide sequence and (1) limit has more than 80% (preferably more than 85%；More preferably More than 90%；More preferably more than 95%；More preferably more than 99%) albumen of homogeny and coding can lower ethylene in plant body The polynucleotide of content；Or

(4) polynucleotide of the polynucleotide sequence complete complementary of nucleotide sequence and the arbitrary restriction in (1)-(3).

In another preference, in described regulation and control plant body, ethylene contents are to reduce ethylene contents or make plant in plant body Thing hypocotyls increase, attenuate, comprising: raise the expression of cki8 gene in plant body.

In another preference, the described method raising the expression of cki8 gene in plant body includes: cki8 gene is turned Enter in plant, obtain the transgenic plant that ethylene contents reduce.

In another preference, the method in the described gene transferred plant by cki8 includes: (s1) provides and carry expression load The Agrobacterium of body, described expression vector contains cki8 gene；(s2) by the cell or tissue of plant or organ and step (s1) In Agrobacterium contact so that described polynucleotide proceed to plant.In another preference, methods described also includes: (s3) select and proceeded to the described plant cell of polynucleotide, tissue, organ；(s4) will be thin for the plant in step (s3) Born of the same parents, tissue, organ or seed regeneration plant.

In another preference, in described regulation and control plant body, ethylene contents are to increase in plant body ethylene contents or make plant Thing hypocotyls shorten, increase thick, top crotch excessively magnifies, comprising: lower the expression of cki8 gene in plant body.

In another preference, the described method lowering the expression of cki8 gene in plant body includes: will lower cki8 base Lower adjustment because of transcription, protein expression or protein active proceeds in plant.

In another preference, described lower adjustment is the disturbing molecule that specificity disturbs cki8 gene expression；It is preferred that Described disturbing molecule is cki8 gene or its transcript is suppression or silence target dsrna, antisensenucleic acidses, little interference rna, Small rna, or can express or be formed described dsrna, antisensenucleic acidses, little interference rna, the construction of small rna.

In another preference, described lower adjustment is the cki8 of inactive forms；It is preferred that the cki8 of described inactive forms It is the albumen that the albumen of coding encodes with respect to wild type cki8, the 128th cki8 gene mutation body being sported n by d, or the 38 cki8 gene mutation bodies being sported r by k.

In another preference, described plant includes: plant of Solanaceae (includes Fructus Lycopersici esculenti platymiscium, such as Fructus Lycopersici esculenti), cruciate flower Section plant (including Arabidopsis thaliana plants, such as arabidopsiss) or grass (including oryza plant, such as Oryza sativa L.).

In another aspect of this invention, a kind of purposes of cki8 gene is provided, for regulate and control in plant body ethylene contents or Regulating plant growth character；Or the material for ethylene contents or regulating plant growth character in preparation regulation and control plant body；Or use Maturation in delay plant fruit.In a preference.Described cki8 gene be used for reducing in plant body ethylene contents or Plant hypocotyls are made to increase, attenuate.

In another aspect of this invention, provide a kind of purposes of the material of reduction cki8 gene expression, for increasing plant Internal ethylene contents or make plant hypocotyls shorten, increase thick, top crotch excessively magnifies.In a preference, described fall The material of low cki8 gene expression includes: the cki8 of inactive forms；It is preferred that the cki8 of described inactive forms is the albumen of coding With respect to the albumen of wild type cki8 coding, the 128th cki8 gene mutation body being sported n by d, or the 38th be mutated by k Cki8 gene mutation body for r.

In another aspect of this invention, providing a kind of increase in plant body ethylene contents or so that plant hypocotyls is shortened, increase Slightly, the material that top crotch excessively magnifies, it is cki8 gene mutation body；The albumen of its coding encodes with respect to wild type cki8 Albumen, the 128th sports n by d, or the 38th sports r by k.

The other side of the present invention, due to this disclosure, is apparent to those skilled in the art 's.

Brief description

The phenotype of Fig. 1, arabidopsiss ethylene synthase excess mutant cki8-1 and wild type material, ethylene contents measure.Left Figure shows, secretly the lower growth etiolated seedling phenotype of 90 hours, and wt hypocotyls are elongated, top crotch normally closed, and embryo under cki8-1 Axle is shorter, and top crotch is excessively closed to rear simultaneously, is rendered as the ethylene triple response of composing type.Right figure shows, gc/ms surveys The ethylene contents determining different plants show, the ethylene volume that wt produces in secretly lower growth is relatively low, less than test limit, and cki8-1 second Alkene amount is significantly raised, and about the 1/3 of eto1.

The on position of t-dna and checking in Fig. 2, cki8-1.Upper figure is cki8 gene model figure, t- in display cki8-1 Dna is inserted in the 2nd intron.Figure below is the mutation that pcr test cki8-1 is t-dna is inserted in cki8 gene internal Body.

The expression of cki8 gene in Fig. 3, cki8-1.Sxemiquantitative pcr shows, t-dna insertion in cki8-1 leads to cki8 base Because of expression deletion.

Fig. 4, p2 × 35s::cki8-phb carrier schematic diagram.By pcr cki8cdna total length two ends add bamhi with After spei restriction enzyme site, it is connected into phb carrier, make justice expression.

Fig. 5, function complementation experiment t₂The phenotype of transgenic Arabidopsis plants.The secretly lower growth etiolated seedling phenotype of 90 hours, Show whether p35s::cki8 or pcki8::cki8 all can complementary cki8-1 composing type ethylene triple response phenotype.

Fig. 6, cki8-1 are counted with the hypocotyl length of complementary transgenic Arabidopsis plants.The secretly lower growth yellow of 90 hours Seedling hypocotyl length counts, show whether p35s::cki8 or pcki8::cki8 all can complementary cki8-1 composing type Ethylene triple response phenotype.

Fig. 7, pcambia1302-p35s::cki8 Vector map.

Fig. 8, pcambia1302-pcki8::cki8 Vector map.

The phenotype of Fig. 9, cki8 overexpression transgenic Arabidopsis plants.By p2 × 35s::cki8-phb (Fig. 4) is proceeded to Wt background, builds overexpression mutant, shows its phenotype and acs5-1 (purchased from arabidopsis biological Resource center, abrc, cs16567, referring to tsuchisaka et al., genetics, 2009 report), acs9-1 (purchased from arabidopsis biological resource center, abrc, salk_129805c are referring to tsuchisaka Et al., genetics, 2009), acs5-1 × acs9-1 is (purchased from arabidopsis biological resource Center, abrc, cs16593；Referring to tsuchisaka et al., genetics, 2009 report) etc. acs deletion mutant Body is similar to, and secretly descends the phenotype of etiolated seedling not notable with wt difference.This may be relatively low relevant with wt background ethylene contents, i.e. etiolated seedling Excessive impact is larger, lacks DeGrain.

The cki8 that Figure 10, kinase activity are lost^k38rWith cki8^d128nOverexpression is unable to complemented mutant body surface type respectively.Inactivation The cki8 of form carries out transgenic overexpression [cki8^k38rOvx (cki8-1), cki8^d128novx(cki8-1)].

The cki8 that Figure 11, kinase activity are lost^d128nOverexpression can improve the phenotype of ethylene contents.

The detection of acs5 protein level under Figure 12 wt and cki8-1 background

Figure 12, the present inventor pass through to obtain the consistent strain of acs5-cmyc expression, make chx (cycloheximide) and process suppression The protein level change of acs5-cmyc is detected after albumen synthesis processed.Result shows, under wt background, acs5-cmyc is dropped rapidly Solution；And under cki8-1 background, the degraded of acs5-cmyc is delayed significantly.Illustrate that cki8 is a negative regulatory factor of acs5.

Figure 13, fruit differential promoters driven ck1.8 overexpression can delay Tomato Ripening to postpone.

(1) pe8-ck1.8-phb (l1, l2, l4, l9), pe8-ck1.8^k38r- phb (l2, l6, l7, l8) and pe8- ck1.8^d128nThe pcr the result of-phb (l3, l9, l12, l21) transgenic Fructus Lycopersici esculenti.

(2), after artificial pollination, ck1.8 special overexpression in fruit postpones fruit maturation (to redden completely as ripe mark Accurate) statistical result (n=20).

(3) ck1.8 special overexpression in fruit promotes delay of maturation representative schematic diagram, after every 5 heaven-made artificial pollinations, Wt (la1781), pe8-ck1.8-phb (l1, l4, l9), pe8-ck1.8^d128nThe mature condition of-phb (l3, l9, l12), scale =1cm.

Specific embodiment

The present inventor, through in-depth study, finds cki8 (being also called ck1.8) negative regulation arabidopsiss ethylene synthase.Cause This, cki8 can be used for regulating and controlling ethylene contents in specific crops, thus realizing plant species improvement.Overexpression cki8 can be in plant Middle delay fruit maturation.

As used herein, described " plant " including but not limited to: crucifer, grass, plant of Solanaceae, Malvaceae plant etc..Such as, described " plant " includes but is not limited to: Cruciferae Arabidopsis thaliana plants such as arabidopsiss, cross Flower section Brassica plantss such as Brassica campestris L, grass family oryza plant such as Oryza sativa L., grass family Semen Tritici aestivi platymiscium such as Semen Tritici aestivi, grass family Zea Plant such as Semen Maydiss, Solanaceae Fructus Lycopersici esculenti platymiscium such as Fructus Lycopersici esculenti, Malvaceae cotton such as Cotton Gossypii etc..

As used herein, " ethylene triple response " refers to that the growth of ethylene on plants has the elongation growth of suppression stem, rush Enter the increasing three aspect effects that are thick and making stem cross growth (even if stem loses negative geotropism growth) of stem or root, this is ethylene typical case Biological effect.Triple response is the classical reaction of ethylene, as an index, can reflect internal ethylene contents or letter Number intensity.In arabidopsiss, top crotch is excessively exaggerated, hypocotyls shorten and have been recognized that as reflecting ethylene contents in arabidopsiss Or signal intensity.The tissue of nearly all higher plant can produce microscale ethylene.Arid, waterlogging, extreme temperature, chemistry injury Ethylene in plant body can be stimulated to increase with mechanical damage.Ethylene is capable of synthesis and the transport of Developing restraint element.Therefore, change and plant Ethylene contents in object, can adjust plant to multiple adverse circumstances such as arid, waterlogging, high temperature, low temperature, abnormal salinity Resistant function.

As used herein, " detached cki8 albumen " or " detached cki8 polypeptide " refers to that cki8 albumen is substantially free of sky So relative other albumen, lipid, saccharide or other materials.Those skilled in the art can use the protein purification of standard Technology purification cki8 albumen.Substantially pure polypeptide can produce single master tape in non-reducing polyacrylamide gel.Described Cki8 polypeptide belong to i type casein kinase.

In the present invention, " polypeptide (also referred to as cki8 polypeptide (albumen)) of cki8 gene code " refers to there is regulation and control (downward) The polypeptide of the seq id no:2 sequence of ethylene contents activity in plant body, also include having with cki8 albumen identical function, The variant form of seq id no:2 sequence.These variant forms include (but being not limited to): several (usually 1-50, relatively Good ground 1-30, more preferably 1-20, most preferably 1-10, also more preferably as 1-8,1-5) disappearance of aminoacid, insertion and/ Or replace, and c end and/or n end add or disappearance one or several (usually within 20, preferably 10 Within, more preferably within 5) aminoacid.For example, in the art, replaced with similar nature or similar aminoacid When, generally will not change the function of protein.Again such as, add one in c end and/or n end or several aminoacid is usual Also the function of protein will not be changed.This term also includes active fragment and the reactive derivative of cki8 albumen.

Present invention additionally comprises the fragment of cki8 albumen, derivant and analog.As used herein, term " fragment ", " derivative Thing " and " analog " refer to be kept substantially the cki8 albumen identical biological function of the present invention or the polypeptide of activity.This Bright polypeptide fragment, derivant or the like can be that (i) has one or more conservative or non-conservative amino acid residue (preferably Conservative amino acid) substituted polypeptide, and such substituted amino acid residue can be may not be by heredity Cryptography, or (ii) have the polypeptide of substituted radical in one or more amino acid residues, or (iii) mature polypeptide with Another compound (such as extending the compound of polypeptide half-life, such as Polyethylene Glycol) merges formed polypeptide, or (iv) Polypeptide that additional aminoacid sequence is fused to this peptide sequence and is formed (such as targeting sequencing or secretion sequence or be used for purification this The sequence of polypeptide or proprotein sequence, or fusion protein).These fragments of definition according to this paper, derivant and analog belong to Scope known to those skilled in the art.

The bioactive fragment of any cki8 albumen can be applied in the present invention.Here, cki8 albumen The implication of bioactive fragment refers to as a kind of polypeptide, and it still can keep all or part of work(of the cki8 albumen of total length Energy.Under normal circumstances, described bioactive fragment at least keeps the activity of 50% total length cki8 albumen.In preferred bar Under part, described active fragment can keep 60%, 70%, 80%, 90%, 95%, 99% or the 100% of total length cki8 albumen Activity.

The variant form of polypeptide includes: homologous sequence, conservative variant, allelic variant, natural mutation, induction are prominent Variant, can be with the albumen coded by the dna of cki8 albumen dna hybridization and using anti-under the conditions of high or low stringency Polypeptide or albumen that the antiserum of cki8 albumen obtains.Present invention also offers other polypeptides, such as comprise cki8 albumen or its piece The fusion protein of section.

Any with described cki8 albumen homology height (with the homology of the sequence shown in seq id no:2 is such as 70% or higher；Preferably, homology is 80% or higher；It is furthermore preferred that homology is 90% or higher, such as homology 95%, 98% or 99%) and albumen that there is cki8 albumen identical function be also included in the present invention.

In the present invention, " cki8 albumen conservative variation's polypeptide " refers to, compared with the aminoacid sequence of seq id no:3, to have At most 20, preferably at most 10, more preferably at most 5, most preferably at most 3 aminoacid are by the similar or close ammonia of property Base acid is replaced and is formed polypeptide.These conservative variation's polypeptides carry out amino acid substitution preferably based on table 1 and produce.

Table 1

Amino acid residue	Representational replacement	Preferably replace
			ala(a)	val；leu；ile	val
arg(r)	lys；gln；asn	lys
			asn(n)	gln；his；lys；arg	gln
asp(d)	glu	glu
			cys(c)	ser	ser
gln(q)	asn	asn
			glu(e)	asp	asp
gly(g)	pro；ala	ala
			his(h)	asn；gln；lys；arg	arg
ile(i)	leu；val；met；ala；phe	leu
			leu(l)	ile；val；met；ala；phe	ile
lys(k)	arg；gln；asn	arg
			met(m)	leu；phe；ile	leu
phe(f)	leu；val；ile；ala；tyr	leu
			pro(p)	ala	ala
ser(s)	thr	thr
			thr(t)	ser	ser
trp(w)	tyr；phe	tyr
			tyr(y)	trp；phe；thr；ser	phe
val(v)	ile；leu；met；phe；ala	leu

The invention still further relates to encoding the polynucleotide sequence of cki8 albumen of the present invention or its conservative variation's polypeptide.Described Polynucleotide can be dna form or rna form.Dna form includes the dna of cdna, genome dna or synthetic.Dna can To be single-stranded or double-strand.Dna can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be with Coding region sequence shown in seq id no:1 is identical or the variant of degeneracy.As used herein, " variant of degeneracy " exists Refer to encode the protein with seq id no:2 in the present invention, but have difference with the coding region sequence shown in seq id no:1 Nucleotide sequence.

The polynucleotide of the mature polypeptide of coding seq id no:2 include: the coded sequence of an encoding mature polypeptide；Ripe The coded sequence of polypeptide and various additional coding sequence；The coded sequence (and optional additional coding sequence) of mature polypeptide and Non-coding sequence.

Term " polynucleotide of coded polypeptide " can be wrapped including the polynucleotide of coding said polypeptide or also Include the polynucleotide of additional code and/or non-coding sequence.

The invention still further relates to the variant of above-mentioned polynucleotide, its coding and the present invention have the many of identical aminoacid sequence The fragment of peptide or polypeptide, analogs and derivatives.The variant of this polynucleotide can be natural generation allelic variant or The variant that non-natural occurs.These nucleotide variants include substitution variants, Deletion variants and insert variation.As this Known to field, allelic variant is the alternative forms of polynucleotide, it be probably one or more nucleotide replacement, Disappearance or insertion, but will not be from the function of the polypeptide substantially changing its coding.

The invention still further relates to interfertile polynucleotide with polynucleotide of the present invention under strict conditions.In the present invention In, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and higher temperature and eluting, such as 0.2 × ssc, 0.1% Sds, 60 DEG C；Or added with denaturant during (2) hybridization, such as 50% (v/v) Methanamide, 0.1% calf serum/0.1%ficoll, 42 DEG C etc.；Or (3) only in the homogeny between two sequences at least more than 90%, just hybridize when more preferably more than 95%. And, the polypeptide of interfertile polynucleotide encoding and the mature polypeptide shown in seq id no:2 have identical biological function And activity.

Present invention additionally comprises having more than 70%, more preferably more than 80% with the nucleotide sequence of the present invention, more preferably More than 90%, the nucleic acid of most preferably more than 95% homogeny, described nucleic acid also has sequence identical shown in seq id no:1 and adjusts Control acts on." homogeny " refers to according to position identical percentage ratio, and (i.e. sequence is same for the similar level between two or more pieces nucleic acid Source property, similarity or homogeneity).

It should be understood that although the cki8 gene of the present invention is preferably obtained from crucifer, available from other plants with Arabidopsiss cki8 gene very high homology (such as have more than 70%, such as 80%, 85%, 90%, 95%, even 98% sequence is identical Property) other genes also within the scope of the present invention contemplates.The Method and kit for of aligned sequences homogeny is also this area week Know, for example blast.

The cki8 protein nucleotides full length sequence of the present invention or its fragment generally can be with pcr TRAP, recombination method or people The method of work synthesis obtains.For pcr TRAP, can be especially open according to relevant nucleotide sequence disclosed in this invention Reading frame sequence designing primer, and with commercially available cdna storehouse or as prepared by conventional method well known by persons skilled in the art Cdna storehouse, as template, expands and obtains relevant sequence.When sequence is longer it is often necessary to carry out twice or multiple pcr amplification, so The fragment amplifying each time more afterwards is stitched together by proper order.

The present invention also relates to comprising the carrier of described polynucleotide, and with described carrier or cki8 encoding histone sequence The host cell that row produce through genetic engineering.

In the present invention, cki8 protein polynucleotide can be plugged in recombinant expression carrier.Term " recombinant expressed load Body " refer to bacterial plasmid well known in the art, phage, yeast plasmid, plant cell virus, mammalian cell virus or other Carrier.In a word, as long as can replicate in host's body and stable, any plasmid and carrier can be used.One weight of expression vector Feature is wanted to be to usually contain origin of replication, promoter, marker gene and translation control element.

Comprise the carrier of above-mentioned suitable dna sequence and suitable promoter or control sequence, can be used for conversion suitable When host cell, allow it to marking protein.Host cell can be prokaryotic cell, such as bacterial cell；Or it is low Eukaryotic cell, such as yeast cells；Or higher eucaryotic cells, such as plant cell.Representative example has: escherichia coli, streptomycete Genus, Agrobacterium；Fungal cell's such as yeast；Plant cell etc..

When described polynucleotide are expressed in higher eucaryotic cells, if insert in the carrier will during enhancer sequence Transcription is made to be strengthened.Enhancer is the cis-acting factors of dna, generally about has 10 to 300 base pairs, acts on startup Son is with the transcription of enhancing gene.

Persons skilled in the art are aware that how to select suitable carrier, promoter, enhancer and host cell.

Can be carried out with routine techniquess well known to those skilled in the art with restructuring dna transformed host cell.Conversion plant can Using the methods such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as spraying, leaf disk method, Rice Young Embryo conversion method etc..For conversion Plant cell, tissue or organ can regenerate plant with conventional method, thus obtain Starch biosynthesis character changing The plant becoming.

The gene of the negative regulation ethylene resultant of the present invention has important using value in theoretical research and agronomy improvement. This sequence can be applied to the ethylene character improvement of specific crops, change its state of growing, during as fruit maturation Phase, leaf senile time etc.；Or can be applicable to improve the degeneration-resistant border ability of plant, obtain more drought-enduring, cold-resistant, heat-resisting or salt tolerant Plant etc. character.

The gene of the present invention can be driven by tissue specific promoter, specific expressed.Described specific promoter can be External source (heterologous).Nucleotide sequence to described specific promoter has no particular limits (as a kind of structural nucleic acid sequence), For example some have the specific promoter of vitals in agricultural or plant improvement.

Additionally, expression vector preferably comprises one or more selected markers, to provide for selecting conversion The phenotypic character of host cell, such as dihydrofolate reductase, neomycin resistance, hygromycin resistance and green fluorescent protein (gfp) etc..

Comprise the carrier of above-mentioned suitable promoter and genes of interest, can be used for converting suitable host cell, so that It being capable of marking protein.

Host cell can be prokaryotic cell, such as bacterial cell；Or low eukaryotic cell, such as yeast cells；Or it is high Deng eukaryotic cell, such as plant cell.Representative example has: escherichia coli, streptomyces, Agrobacterium；Fungal cell's such as yeast；Plant Thing cell etc..Persons skilled in the art are aware that how to select suitable carrier and host cell.

Can be carried out with routine techniquess well known to those skilled in the art with restructuring dna transformed host cell.When host is former During the biological such as escherichia coli of core, the competent cell that can absorb dna can harvest after exponential phase of growth, uses cacl₂Method is processed, institute Step is generally well-known in the art.Another kind of method is to use mgcl₂.If necessary, conversion also can use the side of electroporation Method is carried out.When host is eukaryote, can be selected for following dna transfection method: calcium phosphate precipitation, conventional mechanical methods are such as Microinjection, electroporation, liposome packaging etc..Conversion plant also can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, example As leaf disk method, rataria conversion method, bud infusion method etc..Conventional method can be used for the plant cell of conversion, tissue or organ Regeneration plant, thus obtain the plant of transgenic.

As a kind of mode, the method for prepare transgenosis plant is: will carry promoter sequence and genes of interest is (operable Ground connect) expression vector proceed to Agrobacterium, the carrier segments containing promoter and genes of interest are incorporated into plant by Agrobacterium again Chromosome on.The transgene receptor plant being related to is, for example, Oryza sativa L., Semen Tritici aestivi, Fructus Hordei Vulgaris and Semen Maydiss.

The invention provides the purposes of described cki8 albumen or its encoding gene, contain for adjusting the ethylene in plant Amount.As a kind of optimal way, described cki8 albumen can be used for: reduces or raise the content of ethylene in specified plant tissue.

Because the process of synthesis in ethylene body is relatively easy, can be directly by engineered means regulation and control not jljl Kind, tissue, the metabolic enzyme content of organ；Activator or the inhibitor of synthetic can be passed through, surface applies such chemical drugs Agent changes endogenous ethylene content.

The invention still further relates to the agonist of cki8 or antagonist and application thereof.Because the agonist of cki8 or antagonist are adjustable The expression of section cki8 and/or the activity etc. adjusting cki8, therefore, it is right that the described agonist of cki8 or antagonist also can pass through The impact of cki8 is adjusting Plant Ethylene content, thus reaching the purpose of improvement plant.

Any activity improving cki8 albumen, the stability improving cki8 albumen, the expression promoting cki8 albumen, prolongation The material of the transcription and translation of cki8 albumen effective acting time or promotion cki8 is used equally to the present invention, for reducing plant Internal ethylene contents.Any activity reducing cki8 albumen, the stability reducing cki8 albumen, the table of suppression cki8 albumen The material reach, reducing cki8 albumen effective acting time or reduce the transcription and translation of cki8 is used equally to the present invention, as The lower adjustment of cki8, antagonist or inhibitor (that is: lowering the material of cki8 protein expression), as described in anti-, cki8 albumen is anti- Body, disturbs the disturbing molecule (such as can form the disturbing molecule of microrna) of the encoding gene expression of described cki8 albumen.Described Lower adjustment, the expression that can be used for by lowering cki8 of antagonist or inhibitor, raise ethylene contents in plant.Knowing target After sequence, the method for the disturbing molecule of preparation interference specific gene expression is well known in the art.

The invention still further relates to a kind of method of improvement plant, the method includes adjusting the table of cki8 albumen in described plant Reach.

On the one hand, present invention also offers a kind of method adjusting Plant Ethylene content, described method includes: reduces institute State the expression (inclusion makes cki8 albumen not express or low expression) of cki8 albumen in plant.

After the purposes knowing described cki8 albumen, can be adjusted using multiple methods well known in the art The expression of described cki8 albumen.The ceneme of cki8 gene will be carried than such as by approach known to those skilled in the art (such as expression vector or virus etc.) is delivered on target spot, and is allowed to the cki8 albumen of expression activity.

In addition it is also possible to reduce the expression of cki8 albumen using multiple methods well known in the art or to be allowed to lack Expression, such as the ceneme (such as expression vector or virus etc.) of carrying antisense cki8 gene is delivered on target spot so that Cell or plant tissue are not expressed or are reduced expression cki8 albumen.

As one embodiment of the present invention, the gene of coding cki8 albumen is cloned into suitably by conventional method Carrier in, the described recombinant vector with exogenous gene is imported in the plant cell that can express described cki8 albumen, Make described plant cell expression cki8 albumen.Overexpression cki8 can be obtained by described Plant cell regeneration is become plant The plant of albumen.

Preferably, there is provided a kind of method of prepare transgenosis plant, comprising:

(1) encoding gene of the cki8 albumen of external source is proceeded to plant cell, tissue, organ or tissue, acquisition is transformed into The plant cell of the encoding gene of cki8 albumen, tissue, organ or seed；With

(2) plant cell of the encoding gene having proceeded to external source cki8 albumen that step (1) is obtained, tissue, organ or Seed regenerates plant.

As a kind of preferred example, described method includes step:

(s1) provide the Agrobacterium carrying expression vector, described expression vector contains the encoding gene of cki8 albumen；

(s2) plant cell, tissue, organ are contacted with the Agrobacterium in step (s1), so that the coding of cki8 albumen Gene transferred plant cell, and be incorporated on the chromosome of plant cell；

(s3) plant cell, tissue, organ or the seed of the encoding gene proceeding to cki8 albumen are selected；And

(s4) plant cell in step (s3), tissue, organ or seed are regenerated plant.

Other cki8 genes or the method for its homologous genes expression of increasing are well known in the art.For example, can be by with by force Promoters driven is thus strengthen cki8 gene or its homogenic expression.Or by enhancer (as Oryza sativa L. waxy gene the One intron, actin gene First Intron etc.) strengthening the expression of this cki8 gene.It is applied to opening by force of the inventive method Mover includes but is not limited to: 35s promoter, Oryza sativa L., ubi promoter of Semen Maydiss etc..

Preferably, additionally provide a kind of method reducing the expression of cki8 albumen in plant, described method includes:

(1) disturbing molecule of interference cki8 gene expression is proceeded to plant cell, tissue, organ or seed, obtain conversion Enter plant cell, tissue, organ or the seed of described disturbing molecule；

(2) plant cell, tissue, organ or the seed regeneration that have proceeded to described disturbing molecule that step (1) is obtained Plant.

As a kind of preferred example, described method includes step:

I () provides the Agrobacterium carrying the carrier that may interfere with gene expression, described carrier is selected from the group:

The encoding gene of a cki8 albumen that () starts containing opposite direction or the carrier of genetic fragment (antisense molecule)；

B () contains the composition that can form the encoding gene expression (or transcription) that specificity disturbs cki8 albumen in plant body Disturbing molecule carrier；

(ii) cell of plant, tissue or organ are contacted with the Agrobacterium in step (i), so that described carrier proceeds to Plant cell, tissue or organ.

It is preferred that methods described also includes:

(iii) select plant cell, tissue or the organ having proceeded to described carrier；With

(iv) plant cell in step (iii), tissue or neomorph are become plant.

Present invention also offers ethylene contents or make plant hypocotyls shorten, increase thick material in a kind of increase plant body, It is cki8 gene mutation body；The albumen that the albumen of its coding encodes with respect to wild type cki8, the 128th sports n by d. By method for transformation described above, this cki8 gene mutation body can be transferred in plant body, thus reaching in increase plant body Ethylene contents or make plant hypocotyls shorten, increase thick purpose.

The method of other suppression cki8 genes or the expression of its homologous genes is well known in the art.

Present invention additionally comprises the plant being obtained using any one method aforementioned, described plant includes: has proceeded to cki8 base Cause or its homogenic transgenic plant；Or the plant that cki8 expressing quantity (include low expression or do not express) reduces Deng.

Any suitable conventional meanses can be adopted, to implement described method including reagent, temperature, pressure condition etc..

Ethylene is a kind of highly important phytohormone, has influence on the growth promoter of crop, fruit maturation, resistance etc. all Many-sided.The clone of cki8 gene and application, can apply to the control measures of crop ethylene synthase, ripe as regulating fruit With a kind of technology that is fresh-keeping, improving yield.

With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention Rather than restriction the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip Part such as j. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage ratio and number are calculated by weight.

Embodiment 1, the identification of cki8-1 mutant

1st, arabidopsiss material

Arabidopsiss (arabidopsis thaliana.) mutant cki8-1 (casein kinase i 8) is original wild Material is Arabidopsisecotype " columbia-0 ".

2nd, pcr determines that cki8-1 is a deletion mutant of cki8 gene

2.1st, simplified method (tps method) is used to extract arabidopsis gene group dna

1) Arabidopsis leaf taking 1cm is put in the centrifuge tube of 2ml, adds the tps extract of 200 μ l, and concussion is ground. The preparation of tps extract: 100mm tris-cl (ph 8.0), 10mm edta (ph 8.0), 1m kcl.

2) blade smashed to pieces is put into 75 DEG C of water-baths 20 minutes.

3) 15000rpm is centrifuged 5 minutes.

4) take 120 μ l supernatant in 96 holes are pulled, add isopyknic isopropanol, 3500rpm is centrifuged 10 minutes.

5) abandon supernatant and retain precipitation, add the ethanol of 120 μ l 70%, 3500rpm is centrifuged.

6) abandon supernatant, drying will be precipitated, add 30 μ l ddh₂o.

2.2nd, the pcr identification of mutant arabidopsiss

With mutant arabidopsiss dna as template, carry out pcr to determine whether mutant has t-dna to insert.According to salk Other neighbour's sequence that mutant library provides speculates t-dna insertion point, the both sides of insertion point design primer p1 (5 "- Ctttgcgtccaagacccatc-3 " (seq id no:3)) and p2 (5 "-agatgttgttggtcaatgggtg-3 " (seq id No:4)), t-dna left margin section design primer lba1 (5 "-tggttcacgtagtgggccatcg-3 " (seq id no: 5)), with p1 and p2, p2 and lb3 two, to primer pcr amplification respectively, further confirms that insertion point and identification pure lines.With wild type When the dna of plant is template, the pair of primers p1/p2 of genome can amplify the band of expected 1001bp, and t-dna draws Thing lba1 and p2 combination then can not amplify band；During with the dna of mutant plants for template, t-dna primer lba1 and p2 group Conjunction can amplify the band of 1001bp, and in the mutant of homozygosis, because the t-dna fragment of insertion is too big, p1/p2 can not amplify Band, 3 individual plants (Fig. 2) as shown in cki8-1.

Through it has been observed that showing as composing type ethylene three when the mutant cki8-1 of the present inventor's acquisition is in secretly lower growth React again: hypocotyls shorten (compared with about short 40%) of wild type wt, thicker, top crotch overbending, such as Fig. 1.After cki8-1 Phase growth does not have marked difference with wt.This with it has been reported that ethylene synthase excess mutant (eto1, eto2, eto3 (referring to chae et al.,the plant cell,2003；Yoshida et al., bmc plant biology, 2005)) and second Alkene signal enhancing mutant ctr1 is quite similar to be reported referring to kieber etal., cell, 1993), such as Fig. 9.

3rd, the analysis of gene expression

3.1st, arabidopsiss rna extracts

Arabidopsiss organization material (about 100mg) is taken to be fully ground in liquid nitrogen.It is transferred in 1.5ml centrifuge tube, add 1ml Trizol (invitrogen, cat.15596-018), mixes, and room temperature places 5min.12,000rpm centrifugation 10min, abandon precipitation. Add 600 μ l chloroform in supernatant, mix, 12,000rpm centrifugation 10min.Take supernatant, add -20 DEG C of equal-volume isopropanol Half an hour precipitates rna.12,000rpm centrifugation 10min, precipitate twice with 70% washing with alcohol, and vacuum drying is dissolved in 20-50 μ l h₂o(rnase free).By rna rnase free h₂O does suitable dilution, measures uv between 200-300nm for the wavelength and inhales Receipts value.Rna concentration=40 μ g/ml × a₂₆₀× extension rate.a₂₆₀/a₂₈₀Should be between 1.8 to 2.0.

3.2rt-pcr analysis

Arabidopsis thaliana Seedlings, stem, total rna of Hua Heye, respectively take 1 μ g to carry out reverse transcription, subpackage after dilution, -70 DEG C of preservations.Instead Transcription carries out (rna pcr kit (amv) ver.2.1) according to the method that Dalian Bao Bio-Engineering Company provides.Reverse transcription reaction Condition is: 30 DEG C, 10min；42 DEG C, 30min；99 DEG C, 5min；4 DEG C, 5min.With arabidopsiss actin7 gene primer (actin7-1 5”-ccggtattgtgctcgattctg-3”；Actin7-2 5 "-ttcccgttctgcggtagtgg-3 ") enter The result of row pcr response assays reverse transcription template, determines the consumption of different cdna templates, with gene specific primer (cki8-15”-ctgtgaagcttgaacctgcgag-3”(seq id no:6)；cki8-25”- Ccgtctttagattgaacctccg-3 " (seq id no:7)), with seedling, stem, the total rna reverse transcription of flower and leaf texture cdna For template, have detected the expression of cki8 gene in seedling, stem, flower and leaf respectively with the method for rt-pcr.With respect to wild Type plant, in the leaf of cki8-1 mutant, the transcriptional level of cki8 drops to below test limit, such as Fig. 3.

The preparation of embodiment 2, the justice of cki8 gene and antisense transgene plant and character

1st, the structure of the just carrier of cki8 gene

With the cdna of arabidopsiss leaf as template, using following primer pair carry out pcr amplification (cki8-35 "- cgggatccatggatcgtgtggttggtgg-3”(seq id no:8)；cki8-45”- ggactagtCttcctctttccattccctat-3 " (seq id no:9)): with the cdna described in pfu polymeric enzymatic amplification, pcr Reaction condition is: 94 DEG C, 3min, and 1 circulation；94 DEG C, 30sec, 58 DEG C, 40sec, 72 DEG C, 150sec, 28 circulations；72 DEG C, 10min, 1 circulation.Through sequence verification, its sequence, as shown in seq id no:1, with genbank accession number is amplified production The gene order of at5g43320 is identical, shows that clone products are cki8 gene.It is connected into after bamhi and spei enzyme action through same In phb binary vector (available from Shanghai Communications University) after the process of sample enzyme action, it is configured to the cki8 of 2 × 35s promoters driven Just binary vector p2 × 35s-cki8-phb, such as Fig. 4.

2nd, the structure of the inactive forms carrier of cki8 gene

With the just carrier of cki8 as template, using point mutation test kit (quickchange iisite-directed Mutagenesis kit (agilent stratagene)), using following primer pair carry out pcr amplification (cki8-5 5 "- gaagaagttgctgtgcggcttgaacctgcgagag-3”(seq id no:10)；With cki8-65 "- ctctcgcaggttcaagccgCacagcaacttcttc-3 " builds k38r, and (i.e. the 38th, cki8 albumen sports r (seq by k id no:11))；And cki8-75 "-ggatttcttcatcgtaacataaagcctgataac-3”(seq id no:12)；With cki8-8 5”-gttatcaggctttatgttAcgatgaagaaatcc-3 " (seq id no:13) builds d128n (i.e. cki8 The 128th, albumen is sported n) by d): carry out pcr amplification by test kit requirement.Amplified production through sequence verification, respectively p2 × 35s-cki8^k38r- phb and p2 × 35s-cki8^d128n-phb.

3rd, the structure of the complementing vector of cki8 gene

With the cdna of arabidopsiss leaf as template, using following primer pair carry out pcr amplification (cki8-35 "- cgggatccatggatcgtgtggttggtgg-3”(seq id no:14)；cki8-45”- ggactagtCttcctctttccattccctat-3 " (seq id no:15)): with the cdna described in pfu polymeric enzymatic amplification, pcr Reaction condition is: 94 DEG C, 3min, and 1 circulation；94 DEG C, 30sec, 58 DEG C, 40sec, 72 DEG C, 150sec, 28 circulations；72 DEG C, 10min, 1 circulation.Through sequence verification, its sequence, as shown in seq id no:1, with genbank accession number is amplified production The gene order of at5g43320 is identical, shows that clone products are cki8 gene.It is connected into after bamhi and spei enzyme action through same In pcambia1302 binary vector (cambia company) after the process of sample enzyme action, just it is being configured to the cki8 of 35s promoters driven Adopted binary vector (p35s::cki8-pcambia1302, Fig. 7).With arabidopsis gene group dna as template, with cki8p-1 (acgcgtcgacGaaataagaattttacctgca (seq id no:16)) and cki8p-2 (cgttaccaaatcaaaaagcttc (seq id no:17)) carries out pcr amplification for primer, obtains its own promoter of cki8, Excise had 35s promoter (hindiii/ecori) in above-mentioned 35s carrier, be connected into, obtain final product the mutual of its own promoter driving Mend carrier (pcki8::cki8-pcambia1302, Fig. 8)

4th, strain builds

With conventional cacl₂(referring to " molecular biology experiment technology ", Hao Fuying etc. writes facture, and Peking University goes out Version society, Beijing, 1998) preparation Agrobacterium tumefaciems gv3101 competence, by electroporated method by the just carrier of cki8 gene Proceed to respectively in Agrobacterium with antisense vector, the such as kanamycin containing antibiotic (km) lb culture medium (tryptone 10g/l, Yeast extract 5g/l, nacl 10g/l, agar 15g/l, kanamycin 50mg/l, adjust ph to 7.5 with naoh) on, in 28 DEG C Lower culture 2 days.

Picking single bacterium colony, in yep yeast culture medium (peptone 10g/l, yeast extract 10g/l, nacl containing antibiotic 5g/l, kanamycin 50m g/l, ph 7.0) in 28 DEG C of cultures about 24 hours to logarithmic (log) phase.It is inoculated into identical by 1% amount In culture medium, cultivate 24 hours at 28 DEG C.Culture fluid is centrifuged 10min under 4 DEG C, 3000rpm, takes precipitation (thalline), with etc. Volume transformation of Arabidopsis thaliana buffer (1/2ms 2.2g/l, sucrose 50g/l, acetosyringone 100mm, silwet l-77 400 μ L/l, ph 5.8) suspend.

5th, the conversion of arabidopsiss

5.1st, transformation of Arabidopsis thaliana

Resulting vehicle is converted col-0 or cki8-1 plant respectively, and screens positive transgenic plant, method for transformation reference The floral dipping method of clough and bent (1998).

5.2, the screening of transfer-gen plant with pure lines identification

A) screening of transfer-gen plant

T1 uniform broadcasting (hyg containing 20 μ g/ml) germination and growth on ms solid medium after surface sterilization for seed. After two weeks, the transformation seedlings of picking normal growth move into continued growth in soil.

B) identification of transfer-gen plant pure lines

1) hyg resistance culture base is screened

Determine hyg Resistant segregation ratio, by transplantation of seedlings resistant for each strain, individual plant harvests t3 for seed, then uses resistance Medium on Identification pure lines (previous generation plant hyg resistance has the segregation ratio of 3:1, and this generation plant hyg resistance is 100%, and after Keep 100%hyg resistance for plant).

2) rt-pcr method identifies the expression of related gene in transfer-gen plant

T1 extracts rna detection for plant individual plant part after drawing materials, to determine target gene overexpression or complementary expression water Flat, choose the gene expression obvious plant of change and be further analyzed.

Arabidopsiss in the controlled environment chamber, daily in 22 DEG C, grow under conditions of 16 hours illumination/8 hour dark.

Plant is carried out with identification and the continuous mutant plants (p35s::cki8 observing, finding just carrier conversion (cki8-1), pcki8::cki8 (cki8-1)) composing type ethylene triple response, recovered normal morphology, that is, hypocotyls are more prominent Variant is substantially elongated, top crotch also no longer overbending, suitable with wt (Fig. 5), points out its endogenous ethylene content to return to Normal level.

And the cki8 for inactive forms carries out transgenic [cki8^k38rOvx (cki8-1), cki8^d128novx(cki8-1)] Research finds, is capable of the phenotype of complementary cki8-1 mutant compared to wild type cki8, two kinds of inactive forms cki8 transgenic Strain, all can not be complementary, shows that the function that its kinase activity plays in ethylene synthase for cki8 is requisite (figure 10).In the cki8 transgenic line of two kinds of inactive forms of prompting, endogenous ethylene content is not recovered.

More ironically, the present inventor is by cki8^d128nProceed under wt background, also result in the composition similar with cki8-1 Type ethylene triple response (Figure 11), this probably as a kind of form of dominant suppression it is suppressed that the protein function of endogenous cki8, Thus improving ethylene contents for the present inventor to provide theoretical basiss.

Justice proceed to wt plant, and acs5-1, it is prominent that the ethylene contents of the report such as acs9-1, acs5-1acs9-1 reduce Variant is compared does not have significant Character change.

Embodiment 3, the mensure of Plant Ethylene content

Take wt, cki8-1 and eto1 (available from Chinese Academy of Sciences's Shanghai plant physiological ecology institute, referring to chae et Al, the plant cell, 2003) arabidopsiss seed, through drift ice sterilizing, and sterilized water is cleaned, and is placed in aseptic flat On wet filter paper in ware, it is placed on 4 DEG C of refrigerator cold treatments 4 days.Then plate is placed in 22 DEG C of phjytotrons, sees light 3 hours, so After make dark processing 2 days.Add 0.5ml ms solid medium in 2ml ampoule bottle, congeal into an inclined-plane, take sprouting good Wt, cki8-1 and eto1 seed, every 20 is a sample, each 5 samples, light culture 2 days.Take air in ampoule bottle, gc/ms Measure ethylene contents, statistical analysiss.

Measure through the ethylene contents to wt, cki8-1 and eto1, the inventors discovered that ethylene contents during wt normal growth Very low, less than test limit, and the ethylene synthase amount of cki8-1 and eto1 is all greatly improved.Wherein cki8-1 is about the 1/ of eto1 3 (Fig. 1).This is consistent with the supposition of the present inventor, i.e. the present inventor's new discovery inhibitive factor cki8 of one ethylene synthase, can Endogenous ethylene regulation and control for plant.

Embodiment 4, the protein level of cki8 and acs5

The present inventor passes through the protein level of detection acs5 under wt and cki8-1 background, acs5 be one very unstable Albumen, keep the balance of synthesis and degraded under the conditions of normally internal, add the inhibitor chx of albumen synthesis, little at 1 When after can be degraded in a large number, and under cki8-1 background, acs5 protein degradation substantially slack-off (as Figure 12).Visible cki8 accordingly It is an inhibitive factor of acs5.

Embodiment 5, the preparation of transgenic Fructus Lycopersici esculenti

1st, Fructus Lycopersici esculenti material

Fructus Lycopersici esculenti (solanum lycopersicum) is wild-type fruit normal mature material la1781, available from Chinese science Institute's Shanghai plant physiological ecology institute.

2nd, experimental technique

2.1st, the structure of the acquisition of fruit differential promoter e8 and its driving just or dominant suppression carrier

(1) simplified method (tps method) is used to extract tomato dna group dna

The tomato leaf taking about 100mg is put in the centrifuge tube of 2ml, adds the tps extract of 200 μ l, and concussion is ground. The preparation of tps extract: 100mm tris-cl (ph 8.0), 10mm edta (ph 8.0), 1m kcl.The blade smashed to pieces is put Enter 75 DEG C of water-baths 20 minutes.15000rpm is centrifuged 5 minutes.Take 120 μ l supernatant in 96 holes are pulled, add isopyknic isopropyl Alcohol, 3500rpm is centrifuged 10 minutes.Abandon supernatant and retain precipitation, add the ethanol of 120 μ l 70%, 3500rpm is centrifuged.Abandon supernatant, Drying will be precipitated, add 30 μ l ddh₂o.

(2) pcr obtains the e8 promoter of fruit specific expression

With the dna of wild-type tomatoes extraction as template, with primer e8-pro-f (xbai) (gctctagaaggaatttcacgaaatcggccctt (seq id no:18)) and e8-pro-r (spei) (ggactagtaaaaatctcaatatgaggatgccatattt (seq id no:19)) carries out pcr and expands once (pcr condition and plan Southern mustard conversion is identical), obtain e8 promoter, the existing document report of this promoter.

(3) build conversion carrier

By three carrier (p2 × 35s-cki8-phb, p2 × 35s-cki8^k38r- phb and p2 × 35s-cki8^d128n-phb) In 2 × 35s carry out enzyme action with xbai and two kinds of enzymes of spei, be inserted into the e8 promoter of above-mentioned acquisition, that is, obtain pe8- Cki8-phb, pe8-cki8^k38r- phb and pe8-cki8^d128n- phb), conversion Agrobacterium gv3101 (purchased from invitrogen), For tomato conversion.

2.2nd, tomato conversion

(1) explant prepares

By seed 70% alcohol disinfecting 1 minute, with aseptic water washing 3 times.Then, on super-clean bench, use 10% hypochlorous acid Sodium processes 5-10 minute, with aseptic water washing 5-6 time.By seed transfer in 1/2ms culture medium germinate (26 DEG C, 16 little time According to).The seed of 7-9 days is suitable for Agrobacterium and infects.Take cotyledon, cut away blade tip and leaf base with aseptic shears, transfer to solid b In culture medium, in low-light conditions (10umol/m2/s) preculture 24 hours.

(2) Agrobacterium prepares

Draw within 4-5 days flat board (ym culture medium) in advance, obtain and separate good monoclonal, cultivate 2 days for 28 DEG C.Select monoclonal Draw ym flat board, cultivate 2 days for 28 DEG C.Collects thalline, with mso, 2% (1l formula: ms salt 4.3g；myo-inositol 100mg； thiamine hcl(1mg/ml)0.4ml；mes 10mm；Sucrose 20g) suspension thalline is to od=0.5-0.6.

(3) co-culture

Agrobacterium bacterium solution is poured into be filled in culture dish cotyledonous, and room temperature is placed 30 minutes, and frequently rocks to help The contact with cotyledon for the Agrobacterium.Unnecessary bacterium solution pipettor is removed, co-cultures 48 hours under 25 DEG C of dark conditions.

(4) regeneration plant

After 48 hours co-culture, cotyledon is transferred in screening culture medium c, the upper table of cotyledon faces up.Every 2 turnovers later Move on in fresh c culture medium.

After two weeks, the wound healing with bud former base is cut into pieces, and transfer to successive transfer culture is carried out on culture medium d.

The differentiation of bud, shifts once every two weeks.Shift in shorter time if necessary.

After the selection in 2-3 week is carried out on culture medium d, need to transfer to different trainings by there being 3 kinds of different regenerating tissues On foster base: a). compact green wound healing (with or without green bud, little clump bud), transfer in the c culture medium containing 1mg/lzeatin. B) .1cm about budlet, transfer in d culture medium.C). throw away black brown wound healing (showing non-resistance wound healing) and relax or white Color wound healing (no differentiation capability).

When cane length is to 2-4cm, bud is cut off from wound healing and transfers on root media e.Must not retain on stem Any wound healing.2 weeks about, seedling should have good root system, if it did not, again cutting off stalk and transferring to fresh taking root In culture medium e.

5cm about seedling can be transplanted to soil.

Conversion culture medium (1000ml)

*, the last fortnight 2mg/l zeatin, reduced to 1mg/l from the 3rd week.

*, uses only in the culture medium of zeatin containing 1mg/l.

Culture medium containing glucose should take out (70 DEG C about) after sterilization as early as possible from autoclave, to reduce glucose Degraded, oxidation.

Screening resistance hygromycin b:10mg/ml.

Ym culture medium (1l: yeast extract, 400mg；Mannitol, 10g；Nacl, 100mg；mgso₄.7h₂O, 200mg； kh₂po₄, 500mg).

(negative control, pe8-cki8-phb, pe8-cki8 are made in phb zero load to have obtained now four carriers of conversion respectively^k38r- Phb and pe8-cki8^d128n- phb) antibiosis positive plant (each 5 strains), plant is carried out with identification and continuous observes.

By to pe8-ck1.8-phb, pe8-ck1.8^k38r- phb and pe8-ck1.8^d128nThe one-tenth of-phb transgenic Fructus Lycopersici esculenti The ripe time is investigated, the inventors discovered that, normal Fructus Lycopersici esculenti starts to turn yellow for 35 days after artificial pollination, has started within about 37 days about Entirely redden；And ck1.8 (conversion pe8-ck1.8-phb) special overexpression in fruit to make Fructus Lycopersici esculenti be rendered as always orange-yellow, arrive 48 days about just gradually redden, fruit maturation is significantly delayed, and its inactive forms ck1.8^k38r(conversion pe8-ck1.8^k38r- ) and ck1.8 phb^d128n(conversion pe8-ck1.8^d128n- phb) all can not promote to postpone or promote fruit maturation (Figure 13).

According to ethylene for Fruit Ripening of Tomato facilitation, the fruit maturation of pe8-cki8-phb transgenic Fructus Lycopersici esculenti becomes In evening, can be applicable to fresh preservation.

Earlier studies have shown that, ethylene synthesizes in fruit maturation process in a large number.Research in Fructus Lycopersici esculenti shows, in fruit In ripe process, the expression of leacs2 and leacs4 raises, and ethylene synthase amount accordingly rises (the tomato genome consortium.the tomato genome sequence provides insights into fleshy fruit evolution.nature,2012,doi:10.1038/nature11119；kamiyoshihara y,iwata m, fukaya t,tatsuki m,mori h.2010.turnover of leacs2,a woundinducible 1- aminocyclopropane-1-carboxylic acid synthase in tomato,is regulated by Phosphorylation/dephosphorylation.plant j.64:140 50 etc.).The down-regulated expression of acs can be significantly Delayed fruit is ripe.In addition also evidence suggests the theory that leacs2 is regulated and controled by protein phosphorylation in vivo, with the present invention Basis is consistent.This area is using a kind of important means regulating and controlling as tomato pr eservation of ethylene contents at present.

Embodiment 6, the preparation of transgenic paddy rice

1st, rice material

Oryza sativa L. (oryza sativa) is to spend 11 in wild type material.

2nd, rice conversion

(1) co-culture the preparation of explant (rataria)

Take japonica rice (in spend 11) immature seed, use rinsed with sterile water 3 times after 75% ethanol rinse 1min, use afterwards 0.1% mercuric chloride soaks 15min, then with rinsed with sterile water 3 times；Then rataria is taken to be inoculated in nd2 culture medium (n6 a great number of elements, n6 Trace element and n6 vitamin, proline 500mg/l, casein 300mg/l, sucrose 30g/l, 2,4-d 2mg/l, agar 8g/ L, ph 5.8) on, cultivate three days under 25 DEG C, dark condition.

(2) convert explant

Explant after culture is immersed above-mentioned 2 gained thalline suspensions, stands 20min, turn after being blotted with aseptic filter paper Move on in nd2-as culture medium (nd2 culture medium add acetosyringone (30 μm of ol/l)), 25 DEG C, co-culture 3 under dark condition My god.

With sterilized water, the explant after cultivating is washed 5 times to remove the Agrobacterium of surface adsorption, then blue or green with benzyl containing carboxylic The sterilized water of mycin 250mg/l and cephamycin 100mg/l soaks 2 hours.It is transferred to nd2ch (nd2 with aseptic filter paper after being blotted Culture medium adds caseinhydrolysate 500mg/l, 2,4- dichlorphenoxyacetic acid 2mg/l) culture medium, cultivate at 25 DEG C, screen resistance Wound healing, subculture is once every two weeks.

(3) regenerate

Screen the resistant calli obtaining and transfer to nn1b2h division culture medium (n6 a great number of elements, n6 trace element, n6 Vitamin, casein 300mg/l, sucrose 30g/l, 6-benzyladenine 2mg/l, hygromycin 50mg/l, agar 10g/l, ph 5.8) on, culture differentiation at 25 DEG C.Differentiation seedling out transfers to the ms division culture medium containing resistance such as hygromycin In (duchefa biochemie company), cultivate high to about 10cm at 25 DEG C, move to phjytotron and cultivate to maturation.

Oryza sativa L. in the controlled environment chamber, is cultivated 12 hours daily at 26 DEG C；Cultivate 12 hours at 18 DEG C.

Obtain now just carrier (identical with arabidopsiss, be p2 × 35s-cki8-phb, Fig. 4) the antibiosis positive of conversion Plant, carries out identification and continuous observation to plant.

Because ethylene plays important facilitation, p2 × 35s-cki8-phb rice transformation in the leaf senile of plant Extending the growth time of Oryza sativa L., thus improving nutritious substances accumulation, improving yield.

The all documents referring in the present invention are all incorporated as reference in this application, independent just as each document It is incorporated as with reference to like that.In addition, it is to be understood that after the above-mentioned teachings having read the present invention, those skilled in the art can To make various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited Enclose.

Claims (13)

1. in a kind of regulation and control plant body the method for ethylene contents or regulating plant growth character it is characterised in that methods described bag Include: the expression of cki8 gene in regulation and control plant body, described aminoacid sequence shown in cki8 gene code seq id no:2 many Peptide；Wherein said regulating plant growth character includes: regulation and control hypocotyl growth, and top crotch is developed or fruit maturation period； Described plant includes: plant of Solanaceae, crucifer or grass.

2. the method for claim 1 it is characterised in that in described regulation and control plant body ethylene contents be to reduce plant Interior ethylene contents, described regulating plant growth character be make plant hypocotyls increase, attenuate or delay plant fruit maturation, Including: raise the expression of cki8 gene in plant body.

3. method as claimed in claim 2 is it is characterised in that methods described includes: by cki8 gene transferred plant, obtains The transgenic plant that ethylene contents reduce.

4. the method for claim 1 it is characterised in that in described regulation and control plant body ethylene contents be to increase plant Interior ethylene contents, described regulating plant growth character is so that plant hypocotyls is shortened, increase thick, top crotch and excessively magnify, bag Include: lower the expression of cki8 gene in plant body.

5. method as claimed in claim 4 is it is characterised in that include: will lower the downward of cki8 genetic transcription, protein expression Agent proceeds in plant.

6. method as claimed in claim 5 is it is characterised in that described lower adjustment is specificity interference cki8 gene expression Disturbing molecule.

7. method as claimed in claim 6 is it is characterised in that described disturbing molecule is cki8 gene or its transcript is suppression The dsrna of system or silence target, antisensenucleic acidses, little interference rna, small rna, or can express or be formed described dsrna, antisense core Sour, little interference rna, the construction of small rna.

8. method as claimed in claim 5 is it is characterised in that described lower adjustment is the cki8 of inactive forms.

9. method as claimed in claim 8 is it is characterised in that the cki8 of described inactive forms is the albumen of coding with respect to open country The albumen of raw type cki8 coding, the 128th cki8 gene mutation body being sported n by d, or the 38th cki8 being sported r by k Gene mutation body.

10. a kind of purposes of cki8 gene, for regulating and controlling ethylene contents or regulating plant growth character in plant body；Or

Material for ethylene contents in preparation regulation and control plant body；Or

For preparing the material of regulating plant growth character, wherein said regulating plant growth character includes: regulation and control hypocotyls Growth, top crotch is developed or fruit maturation period；Described aminoacid sequence shown in cki8 gene code seq id no:2 Polypeptide；Described plant includes: plant of Solanaceae, crucifer or grass.

11. purposes as claimed in claim 10 are it is characterised in that described cki8 gene is used for reducing ethylene in plant body and contains Measure or make plant hypocotyls to increase, attenuate.

12. a kind of purposes of the lower adjustment of reduction cki8 gene expression or activity, for increasing in plant body ethylene contents or making Plant hypocotyls shorten, increase slightly, and top crotch excessively magnifies；Described plant includes: plant of Solanaceae, crucifer or standing grain Graminaceous plant；The polypeptide of described aminoacid sequence shown in cki8 gene code seq id no:2.

13. a kind of increase in plant bodies ethylene contents or so that plant hypocotyls is shortened, increase thick, the thing that top crotch excessively magnifies Matter, it is cki8 gene mutation body；The albumen of its coding, with respect to the albumen of wild type cki8 gene code, is dashed forward by d for the 128th It is changed into n, or the 38th sports r by k；Described plant includes: plant of Solanaceae, crucifer or grass；Institute The polypeptide of the aminoacid sequence shown in wild type cki8 gene code seq id no:2 stated.