CN113136388A

CN113136388A - Application of rice OsMAPKKKK 5 gene in improving plant height and grain type of rice

Info

Publication number: CN113136388A
Application number: CN202110353229.3A
Authority: CN
Inventors: 罗小金; 严佩雯; 辛晓云
Original assignee: Suzhou Jinxin Biotechnology Co ltd
Current assignee: Suzhou Jinxin Biotechnology Co ltd
Priority date: 2021-03-31
Filing date: 2021-03-31
Publication date: 2021-07-20
Anticipated expiration: 2041-03-31
Also published as: CN113136388B

Abstract

The application discloses application of a rice OsMAPKKK5 gene in improving the plant height and grain type of rice. Firstly, selecting a target fragment in a CDS region of rice OsMAPKKK5 gene, inserting a target sequence of the target fragment selected in the CDS region of the rice OsMAPKKKK 5 gene into a pBWA (V) H-cas9 vector by taking pBWA (V) H-cas9 as an expression vector, transforming the obtained pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid into transgenic receptor indica rice 1B, and screening to obtain the OsMAPKKK5 gene mutant strain with the plant height of 97.5 +/-2.66 cm and the thousand weight of 21.83 +/-0.42 g, which is 14.1% higher than that of indica rice 1B and 21.7% higher than that of thousand rice 1B.

Description

Application of rice OsMAPKKKK 5 gene in improving plant height and grain type of rice

Technical Field

The invention belongs to the technical field of molecular breeding, and particularly relates to application of a rice OsMAPKKK5 gene in improving the plant height and grain type of rice.

Background

Rice is a major food crop in many countries of the world, and approximately 60% of the population takes rice as staple food, so increasing rice yield has always been a major goal of breeders. The first green revolution in the fifth and sixty years in the last century, the utilization of the short stalk gene sd1 and the dwarfing and breeding of crops, so that rice is not easy to fall down, and the yield is greatly improved; later, the hybrid rice is utilized, so that the rice yield is further improved. At present, rice breeding enters a plateau stage, and the yield is not in a wandering state. The breeding practice shows that on the basis of the current high-yield variety, the plant height is properly increased, the biomass is increased, the thousand seed weight is increased, and the further improvement of the rice yield is expected to be realized.

The plant height is an important agronomic trait of rice and is closely related to the yield of rice. The thousand kernel weight directly affects the rice yield, the grain type is closely related to the appearance quality and the eating quality of rice, and consumers in different regions have different preferences on the appearance and the taste of the rice. Thousand kernel weight is determined by the size of the kernel, which includes the length, width and thickness of the kernel. Since glume determines the storage capacity of the kernel, it plays a dominant role in determining the size of the kernel. The plant height and the grain type are used as two important rice yield-related traits, and more regulatory genes are cloned. The method has the advantages that the inheritance and mechanism of the plant height and the grain type formation of the rice are clarified, the significance is very important for improving the yield of the rice and the quality of the rice, and the method is also one of the hot spots of the research of the functional genomics of the rice. In the experiment, the OsMAPKKKK 5 gene is cloned, and an OsMAPKKKK 5 mutant strain is constructed.

The application selects a target fragment in the CDS region of the OsMAPKKK5 gene, constructs the target fragment into a vector, and then transfers the vector into indica rice variety propylene 1B so as to obtain a mutant strain with improved plant height and grain type.

Disclosure of Invention

In order to improve the plant height and the grain type of rice, the application provides application of a rice OsMAPKKK5 gene in improving the plant height and the grain type of rice.

The application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice adopts the following technical scheme:

an application of rice OsMAPKKKK 5 gene in improving plant height and grain type of rice is disclosed, firstly selecting target fragment in CDS region of rice OsMAPKKKK 5 gene, then using pBWA (V) H-cas9 plasmid as expression vector, inserting the target fragment selected from CDS region of rice OsMAPKKKK 5 gene, namely 23 nucleotides in second exon 2334 nucleotides, as target sequence into pBWA (V) H-cas9 plasmid to obtain pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid, then transforming the WA (V) H-cas9-OsMAPKKK5 recombinant plasmid into indica rice straw 1B, obtaining OsMAKK 5 gene mutant strain with improved plant height and grain type through PCR detection and first generation sequencing screening.

The application takes the indica rice variety 1B as an example for illustration, but the application of the obtained mutant strain with improved plant height and grain type in other rice varieties is not limited.

The application of the rice OsMAPKKK5 gene in improving the plant height and the grain type of rice specifically comprises the following steps:

(1) selection of target sequences

The rice OsMAPKKKK 5 gene (GenBank: XM _015776316.2) has a total length of 7153bp of a landing gene sequence, wherein the length of a coding region is 2334bp, the length of a non-coding region at a 5 'end is 305bp, the length of a non-coding region at a 3' end is 536bp, and the sequence is shown in SEQ.ID NO 1; the total length of a target sequence selected from a CDS region of a coding region is 23bp, and the sequence is shown as SEQ.ID NO 2; the code is 777 amino acids, and the sequence is shown in SEQ ID NO3.

The structure of the rice OsMAPKKK5 gene is shown in figure 1, wherein a black box represents a translation region, a white box represents a non-translation region, and a line segment represents an intron;

(2) construction of expression vector containing target sequence in OsMAPKKK5 gene

The method comprises the steps of adopting pBWA (V) H-cas9 as a vector, and utilizing a target sequence of a CDS region of a rice OsPDCD5 gene as shown in SEQ.ID NO2 as a target site to construct pBWA (V) H-cas9-OsPDCD5 plasmid for targeting the rice OsPDCD5 gene, so as to finally obtain pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

wherein the pBWA (V) H-Cas9-OsPDCD5 recombinant plasmid contains a guide RNA expression frame with the target sequence and a Cas9 nuclease expression frame, and the structure diagram is shown in figure 2.

(3) pBWA (V) transformation of H-cas 9-OsMAPKKKK 5 recombinant plasmid

The pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid is transformed into Agrobacterium EHA105 (purchased from Shanghai Weidi Biotechnology GmbH, Agrobacterium tumefaciens) by the following specific operation method:

adding 10 mu L of a solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells according to the volume percentage of 10%, sequentially placing the solution on ice for 30min, immersing the solution into liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to finish transformation so as to obtain the agrobacterium EHA105 competent cells containing pBWA (V) H-cas 9-OsMAKKK 5 recombinant plasmid;

adding 110 mu L of the obtained agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmids into 500 mu L of LB liquid culture medium (raw engineering Sangon Biotech, B540111) without antibiotics, controlling the temperature at 28 ℃ and the rotating speed at 150 plus 160rpm, and culturing for 3-4H to obtain a culture solution according to the volume percentage of 22%; thirdly, the culture solution obtained by the second step is centrifuged for 10min at the rotation speed of 4000rpm to collect thalli, the thalli collected by centrifugation is evenly mixed with supernatant obtained by centrifugation accounting for 11 percent of the volume of the culture solution, and then the mixture is coated on an LB plate culture medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin (the preparation method of the LB plate culture medium is that 1000ml LB liquid culture medium +15g agar powder (Genebase Gene Tech, A-2180) + three antibiotics) and cultured for 36 to 72h at the temperature of 28 ℃ to form bacterial plaques on the LB plate culture medium;

selecting bacterial plaques by using toothpicks, carrying out bacterial plaque PCR identification in an LB liquid culture medium, wherein the bacterial plaques which are successfully identified by the PCR identification are transformants, and the transformants are agrobacterium tumefaciens EHA105 containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids and are named as EHA105/cas 9-OsMAPKKKK 5;

selecting 1 bacterial plaque with positive bands and successfully identified by PCR, carrying out 1.5ml of EP pipe-connected bacteria, and culturing in a shaking table at 28 ℃, thus obtaining agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid;

the above 1.5ml EP tube contains 1ml LB liquid medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin;

(4) inducing and culturing the callus of the mature seed of the propylene 1B

Taking and shelling mature seeds of the polypropylene 1B, firstly soaking and washing the seeds for 10-15min by using 75% ethanol and 3-5 times by using sterile water under the aseptic condition, then soaking the seeds in 0.1% by volume of mercuric chloride aqueous solution for 20-30min, and then washing the seeds for 3-5 times by using the sterile water to obtain sterile mature seeds of the polypropylene 1B;

inoculating the obtained sterile mature seeds of the polypropylene 1B into an induction culture medium, controlling the temperature to be 26-28 ℃ for inducing callus for 15-20 days under the dark condition, then transferring into a new induction culture medium or a subculture medium, and continuously inducing callus for 7-10 days to obtain callus;

(5) and infection with Agrobacterium

Inoculating 500 mu L of agrobacterium tumefaciens EHA105 seed solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 50ml of YEP liquid culture medium, controlling the temperature to be 26-28 ℃, culturing for 12-16H, collecting bacterial liquid, and diluting with YEP liquid culture medium (YEP liquid culture medium which contains 10g of beef extract, 10g of yeast extract, 5g of NaCl, 7.0 of pH and the balance of water according to the weight of each liter) until the bacterial liquid concentration of the agrobacterium tumefaciens containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid is OD600 & lt 0.5;

airing the calluses of the indica rice stem 1B obtained in the step (4) on sterile filter paper, then transferring the calluses into a bacterial liquid of agrobacterium tumefaciens containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids with OD600 & lt 0.5 at one time, uniformly mixing, then soaking for 10-30 min at the temperature of 28 ℃ and the rotating speed of 150rpm, and then pouring out the bacterial liquid to obtain infected calluses;

thirdly, placing the infected callus obtained in the second step on sterile filter paper until the bacteria liquid is sucked dry, then transferring the infected callus to a co-culture medium, paving a layer of sterile filter paper on the surface of the culture medium, enabling the callus to be not in direct contact with the culture medium on the filter paper, and performing dark culture for 5-7 days in an incubator at the temperature of 26-28 ℃ to obtain the callus infected by the agrobacterium EHA 105;

the co-culture process (c) does not need to open the incubator frequently so as to prevent the water film from being generated due to too large temperature change;

(6) screening for resistant callus

Respectively adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing the callus with sterile water for 3-5 times, emptying the sterile water, washing the callus with sterile water containing 50mg/L rifampicin and 50mg/L kanamycin resistance for 2-3 times, transferring the callus into a primary screening culture medium after the sterile filter paper absorbs excessive water, carrying out primary screening for 15-20min, and repeating the action for 2-3 times to obtain the callus infected by the agrobacterium EHA105 with weak resistance;

secondly, pouring the weak-resistance callus obtained in the step one onto sterile filter paper, and sucking the weak-resistance callus for about 2 hours to obtain dry weak-resistance callus infected by agrobacterium EHA 105;

thirdly, transferring the dried weak-resistance callus into a secondary screening culture medium, carrying out secondary screening for 15-20 days under the condition of controlling the temperature to be 26-28 ℃, and obtaining the strong-resistance callus infected by the agrobacterium EHA105 after screening.

(7) Differentiation of resistant callus

Transferring the obtained strong-resistance callus infected by the agrobacterium EHA105 into a primary differentiation culture medium, culturing for 15-20 days under the conditions of 26 ℃ and 16h of illumination per day, then transferring into a secondary differentiation culture medium, continuously culturing for 15-20 days under the conditions of 26 ℃ and 16h of illumination per day until 1-5cm of green buds grow, stripping redundant surrounding calluses, cutting off roots to leave about 0.5cm of strong roots, and then transferring into a rooting and seedling strengthening culture medium for rooting culture to obtain seedlings;

the obtained seedling is about 10-15cm high, the root system is vigorous, and the obtained seedling with too small size is strengthened by root cutting, leaf cutting and re-cultivation;

adding 1cm of normal-temperature sterilized water into the obtained seedlings, performing transitional culture for 2 days at the temperature of 25-30 ℃ and in the environment with the relative humidity more than 50%, cleaning the culture medium attached to the roots, transplanting the culture medium into a container with sterilized soil, and transferring the culture medium to a greenhouse for 115-year and 125-day culture to obtain T0-generation transformed plants;

culturing T0 generation transformed plants at 28 ℃ in a greenhouse to obtain seeds, obtaining T1 generation seeds, detecting whether the plants contain pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids, performing generational propagation on positive T1 seeds to obtain T2 generation seeds, detecting whether the plants completely knock out OsMAPKKKK 5 genes, performing generational propagation on the positive seeds to obtain T3 generation seeds, wherein cas 9-MAPKKKK 5-2-1 or cas 9-MAPKKKK 5-8 are OsMAPKKKK 5 gene mutant strains with improved plant height and improved grain type.

The application only takes indica rice stalk 1B as an example for explanation, the obtained 2 OsMAPKKK5 gene mutant strains with the plant height higher than that of indica rice stalk 1B and the grain type improved are cas9-OsMAPKKK5-2-1 plant and cas9-OsMAPKKK5-3-8 plant respectively, but the application of the OsMAPKKKK 5 gene in plant height improvement and grain type improvement in other rice varieties is not limited.

The application has the following beneficial effects:

the application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice is characterized in that a target sequence is selected from a CDS region of the OsMAPKKKK 5 gene to construct a vector and the vector is transferred into wild indica rice stem 1B, the plant height and grain type of obtained cas 9-OsMAKKK 5-2-1 plant and cas 9-OsMAPKKKK 5-3-8 plant are improved, and compared with the wild indica rice stem 1B, the plant heights of the cas 9-OsMAPKKKK 5-2-1 plant and cas 9-OsMAPKKKK 5-3-8 plant are respectively increased by 7.8 percent and 4.1 percent in average, and can reach 14.1 percent and 10.5 percent in maximum; the grain length is respectively and averagely increased by 4.3 percent and 3.6 percent, and the maximum grain length can reach 6.8 percent and 6.7 percent; the grain width is respectively increased by 3.7 percent and 2.5 percent on average, the maximum grain width can reach 6.5 percent and 5.7 percent, and the grain type is improved;

further, compared with wild indica rice stem 1B, the thousand seed weight of the obtained cas 9-OsMAPKKKK 5-2-1 plant and cas 9-OsMAPKKKK 5-3-8 plant is obviously increased, the thousand seed weight is respectively increased by 15.4% and 12.7%, and the maximum thousand seed weight can reach 21.7% and 20.4%. .

Drawings

FIG. 1 shows the structure of OsMAPKKK5 gene of rice;

FIG. 2 is a structural diagram of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

FIG. 3 is a comparison of seed particles of wild rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 4 is a comparison graph of rice ear morphology of wild rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 5 is a comparison chart of the whole plant morphology of wild rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 6a is a histogram of plant heights of wild type indica rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 6b is a histogram of thousand-grain weight of wild rice stalk 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 6c is a histogram of grain length of wild rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 6d is a histogram of grain width of wild rice stem 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant.

Detailed Description

The present application is further illustrated by the following specific examples in conjunction with the accompanying drawings, but is not limited thereto.

The composition of the various media used in the examples of the present application is shown in the following table:

(Note: autoclaving at 115 ℃ for 20min)

The experimental methods used in the examples of the present application are all conventional methods unless otherwise specified, and the materials, reagents, and the like used therein are commercially available without otherwise specified.

Example 1

The application of the rice OsMAPKKK5 transgenes in the aspect of improving the plant height and the grain type of rice specifically comprises the following steps:

(2) pBWA (V) construction of the H-cas 9-OsMAPKKKK 5 vector:

enzyme cutting site Eco31I (BsaI) is designed in cas9-MAPKKK5-F: cagtGGTCTCaggcATCCGCAGCCGCGGTTGACC, the sequence of which is shown in SEQ ID NO.4 and cas 9-MAPKKKK 5-R: cagtGGTCTCaaaaCCTGGTCAACCGCGGCTGCG, the sequence of which is shown in SEQ ID NO.5, and then primers cas9-MAPKKK5-F and cas9-MAPKKK5-R are used for amplifying a target sequence of 23bp in a CDS region of an OsMAPKKKK 5 gene, and the nucleotide sequence is as follows: ATCCGCAGCCGCGGTTGACCAGG, a PCR product containing the cleavage site Eco31I (BsaI) was obtained:

cagtGGTCTCaggcaATCCGCAGCCGCGGTTGACCAGGttttGAGACCagtg, the PCR product was named OsMAPKKKK 5.

② the PCR product OsMAPKKKK 5 is recovered by tapping after agarose electrophoresis, and the DNA fragment is purified by using a kit (crude Sangon Biotech, B518131) to obtain a PCR purified product OsMAPKKKK 5.

Preparing an enzyme digestion connection system, wherein the components and contents of the raw materials in the enzyme digestion connection system with the total volume of 20 mu L are as follows:

20 mul enzyme cutting connection system prepared according to the composition and the content is processed by a PCR instrument (Bio-Rad S0000Thermal Cycler) for 20min at 37 ℃ for 5 cycles; 37 ℃ for 10 min; 20 ℃ for 10 min; pBWA (V) H-cas9-OsMAPKKK5 ligation product was obtained after treatment for 20min at 37 ℃.

And fourthly, sucking 5 mu L of pBWA (V) H-cas9-OsMAPKKK5 ligation product in the step, adding the ligation product into Escherichia coli DH5 alpha competent cells (purchased from Shanghai Diego Biotechnology limited), incubating on ice for 30min, thermally shocking at 42 ℃ for 1min, incubating on ice for 2min, adding 900 mu L of LB culture medium, and culturing at 37 ℃ for 1H to activate and recover the Escherichia coli DH5 alpha competent cells.

And (3) coating the recovered escherichia coli DH5 alpha competent cells on a culture dish containing LB solid medium (containing kanamycin) and carrying out inverted culture in an incubator at 37 ℃ for 12h to obtain an escherichia coli DH5 alpha monoclonal for carrying out plaque PCR identification.

Fifthly, selecting 8 bacterial plaques to carry out bacterial plaque PCR identification (Lihua, Liuyanlin and the like, the application of the bacterial colony PCR technology in screening and identifying recombinant plasmids, the scientific and technical university journal of northwest agriculture and forestry (Nature science edition), volume 32 in 9 months in 2004 and pages 35-37) to determine whether the connection is successful.

Identifying primer Pbw2 +: GGCGTCTTCTACTGGTGCTA, the sequence of which is shown in SEQ ID NO.6, Pbw 2-: GTCTTTACGGCGAGTTCTGT, the sequence is shown in SEQ ID NO.7, the length of the amplified fragment is 422bp, the positive strip sequence successfully identified by PCR is compared with the standard sequence, and the standard sequence is shown in SEQ ID NO. 8.

Taking 3 corresponding bacterial plaques with positive bands detected by agarose electrophoresis, inoculating the bacterial plaques into a 1.5ml EP tube containing 700 mu L of LB liquid medium (raw Sangon Biotech, B540111) containing 50ug/ml kanamycin, carrying out shake cultivation at 37 ℃ for 3h, taking bacterial liquid for sequencing, and judging the consistency of the result and the sequence as SEQ ID NO. 8.

Taking bacterial liquid with a sequencing result consistent with a sequence shown as SEQ ID NO.8 as bacterial liquid with a correct sequencing result, taking 500 mu L of the bacterial liquid to perform bacterial conservation (500 mu L of 50% glycerol +500 mu L of LB bacterial liquid), taking 200 mu L of the bacterial liquid to inoculate into 2ml of LB liquid medium, performing shake cultivation at 37 ℃ for 12H, and then extracting plasmids by using a plasmid extraction kit (raw Sangon Biotech, B518191) to obtain pBWA (V) H-cas 9-OsMAKKK 5 recombinant plasmids, wherein the structural schematic diagram is shown in figure 2 and the recombinant plasmids comprise a 35S promoter, a U6 promoter, a target sequence of the OsMAKKK 5 gene, a cas9 protein, a T-nos terminator, a screening gene kanamycin and the like.

(2) pBWA (V) transformation of H-cas 9-OsMAPKKKK 5 recombinant plasmid

adding 10 mu L of pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells according to the volume percentage of 10%, sequentially placing the cells on ice for 30min, immersing the cells in liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to finish transformation so as to obtain the agrobacterium EHA105 competent cells containing the pBWA (V) H-cas 9-OsMAKKK 5 recombinant plasmid.

② adding 110 mu L of the agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid obtained by the previous step into 500 mu L of LB liquid culture medium (raw Sangon Biotech, B540111) without antibiotics according to the proportion of 22 percent by volume, controlling the temperature to be 28 ℃ and the rotating speed to be 150rpm, and culturing for 3 hours to obtain a culture solution.

③ centrifuging the culture solution obtained from the step (c) for 10min at the rotation speed of 4000rpm to collect thalli, centrifuging the thalli collected by centrifugation by 60 mu L to obtain supernatant, mixing the supernatant uniformly, and then coating the mixture on an LB plate culture medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin (the preparation method of the LB plate culture medium is that 1000ml LB liquid culture medium +15g agar powder (Genebase Gene Tech, A-2180) + three antibiotics) to culture for 36-72h at 28 ℃ to form bacterial plaques on the LB plate culture medium.

And (3) picking the bacterial plaque by using a toothpick, carrying out bacterial plaque PCR identification in an LB liquid culture medium, wherein the bacterial plaque successfully identified by the PCR identification is a transformant, and the transformant is agrobacterium tumefaciens EHA105 containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids and is named as EHA105/cas 9-OsMAPKKKK 5.

8 bacterial plaques are picked and simultaneously subjected to 1.5ml of EP inoculation and PCR (polymerase chain reaction) to identify whether the ligation is successful, and a primer Pbw2+ used is identified: GGCGTCTTCTACTGGTGCTA, the sequence of which is shown in SEQ ID NO.6, Pbw 2-: GTCTTTACGGCGAGTTCTGT, the sequence is shown in SEQ ID NO.7, the length of the amplified fragment is 422bp, the positive strip sequence successfully identified by PCR is compared with the standard sequence, and the standard sequence is shown in SEQ ID NO. 8.

1 plaque with positive bands successfully identified by PCR was picked and subjected to 1.5ml of EP tube-ligation and cultured in a shaker at 28 ℃ to obtain an Agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid.

The above 1.5ml EP tube contains 1ml LB liquid medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin.

(3) Inducing and culturing the callus of the mature seed of the propylene 1B

Taking the mature seeds of the polypropylene 1B, removing the shells, firstly soaking and washing the seeds with 75% ethanol for 10min under aseptic conditions, then washing the seeds with sterile water for 5 times, then soaking the seeds in 0.1% mercury chloride aqueous solution by volume percentage for 20min, and then washing the seeds with sterile water for 3 times to obtain the sterile mature seeds of the polypropylene 1B.

Inoculating the obtained sterile mature seeds of the polypropylene 1B into an induction culture medium plate, inoculating 10 sterile mature seeds of the polypropylene 1B onto an induction solid culture medium plate with the diameter of 90mm, inoculating 10 plates, culturing for about 20 days under the dark condition at the temperature of 26 ℃ until callus is available, peeling the induced callus to transfer into a subculture medium plate, carrying out subculture, and continuously inducing the callus for 7 days to obtain callus.

If the peeled callus is large, the callus can be divided into small parts by using a tool such as a forceps and the like;

note: the induced solid culture medium is blown dry for more than 1h on a sterile operating platform after being poured into a flat plate, and the transferred healed wound is sucked dry on sterile filter paper, so that no water film exists between the healed wound and the induced solid culture medium during subculture.

(4) And infection with Agrobacterium

Inoculating 500 mu L of agrobacterium EHA105 seed solution containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid into 50ml of YEP liquid culture medium, controlling the temperature to be 26 ℃ for culturing for 12H, collecting bacterial liquid, diluting the bacterial liquid with the YEP liquid culture medium until the bacterial liquid concentration of the agrobacterium containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid is OD600 approximately equal to 0.5, and measuring OD600 every 5 min.

Secondly, airing the calluses of the indica rice stem 1B obtained in the step I on sterile filter paper, then transferring the calluses into a bacterial liquid of agrobacterium containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids with OD600 being approximately equal to 0.5 at one time, uniformly mixing the bacterial liquid, then controlling the temperature to be 28 ℃ and the rotating speed to be 150rpm, soaking the bacterial liquid for 20min, and then pouring out the bacterial liquid to obtain infected calluses.

Thirdly, placing the infected callus obtained in the second step on sterile filter paper until the bacteria liquid is sucked dry, then transferring the infected callus to a co-culture medium, paving a layer of sterile filter paper on the surface of the culture medium, controlling the temperature of the infected callus to be 26 ℃ in an incubator without directly contacting with the culture medium, carrying out dark culture for about 6 days, and obtaining the callus infected by agrobacterium EHA105, wherein the contact part of the infected callus and the YEP liquid culture medium is provided with a bacterial membrane.

The co-culture process (c) does not need to open the incubator frequently so as to prevent the water film from being generated due to too large temperature change.

(5) Screening for resistant callus

Adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing for 3 times by using sterile water, emptying the sterile water, washing for 2 times by using sterile water containing 50mg/L rifampicin and 50mg/L kanamycin resistance, after sucking off excess water by using sterile filter paper, transferring the callus into a primary screening culture medium, carrying out primary screening for 15min, and repeating the action for 2 times to obtain the callus infected by the agrobacterium EHA105 with weak resistance.

Secondly, pouring the weak-resistance callus obtained in the step (i) on sterile filter paper, and sucking for about 2 hours to obtain dry weak-resistance callus infected by agrobacterium EHA 105.

Thirdly, transferring the dried weak-resistance callus into a secondary screening culture medium, carrying out secondary screening for 15 days under the condition of controlling the temperature to be 26 ℃, and obtaining the strong-resistance callus infected by the agrobacterium EHA105 after screening.

(6) Differentiation of resistant callus

Transferring the obtained strong-resistance callus infected by the agrobacterium EHA105 into a primary differentiation culture medium, culturing for 15 days under the conditions of 26 ℃ and 16h of illumination per day, then transferring into a secondary differentiation culture medium, continuously culturing for 15 days under the conditions of 26 ℃ and 16h of illumination per day until 1-5cm of green buds grow, stripping redundant surrounding calluses, cutting off roots to leave about 0.5cm of green buds, and then transferring into a rooting and seedling strengthening culture medium for rooting culture to obtain 10-15cm seedlings.

The obtained fine seedlings are strengthened by root cutting, leaf cutting and re-cultivation.

Adding the obtained 10-15cm seedlings into 1cm of normal-temperature sterilized water, performing transitional culture for 2 days at 26 ℃ in an environment with the relative humidity of more than 50%, cleaning the culture medium attached to the roots, transplanting the culture medium into a container with sterilized soil, and transferring the culture medium to a greenhouse for 115-year and 125-day culture to obtain T0 generation transformed plants.

(7) Screening and detecting of transformed plants

PCR amplification is adopted to detect candidate T0 generation transformed plants, and the used amplification primers are as follows:

Hyg-CX-S: AGATGTTGGCGACCTCGTATT, the sequence of which is shown in SEQ ID NO. 9;

Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT, the sequence of which is shown in SEQ ID NO. 10;

detecting whether the T0 generation transformed plants contain hygromycin screening markers to obtain 10 positive transformed plants containing pBWA (V) H-cas9-MAPKKK 5.

Culturing the 10 transformation plants (namely T0 generation, numbered T0-1, T0-2 and … T0-10) containing the hygromycin screening marker at 28 ℃ in a greenhouse until the transformation plants bear seeds, namely T1 generation, performing additional generation propagation on the harvested T1 generation seeds (20 seeds are sowed in each number for seedling raising and 10 seedlings are randomly selected for transplanting) in the Hainan island in 2017 for 6 months to obtain T2 generation seeds, taking leaves corresponding to a single plant, checking whether a target area of the single plant DNA is subjected to homozygous mutation, reserving the homozygous seeds, and sowing in the Taicang city base of Jiangsu province in 2017 for 10 months to obtain T3 generation seeds.

② screening and detecting CDS region mutant plants of OsMAPKKK5

And (2) obtaining leaves of the corresponding T1 generation seed single plant in the step (i), extracting genome DNA, using a detection primer MAPKKKK 5 MAPKKK-SEQ-F: GTCCCCGTCCTCTTCGTC with the sequence shown as SEQ ID NO.4 and MAPKKKK-SEQ-R: CATGTTACTCGCGGTCCTC with the sequence shown as SEQ ID NO.5 to perform PCR, running the PCR product on agarose gel electrophoresis, and using a target band sequence of 325bp as shown as SEQ ID NO. 8.

The purpose of the PCR sequencing is to detect whether the 23bp target sequence of the OsMAPKKK5 of the single strain obtained in the step (1) is mutated; comparing the sequencing result with the standard SEQ ID NO.2 sequence, finding that 23bp target sequences of 7 plants OsMAPKKK5 in 10 plants obtained in the step (7) are changed, namely the 7 plants are plants with mutant target sequences of OsMAPKKKK 5 genes, namely cas 9-MAPKKKK 5-1, cas 9-MAPKKKK 5-2, cas 9-MAPKKKK 5-3, cas9-MAPKK 5-5, cas 9-MAPKKKK 5-6, cas9-MAPKK 5-7 and cas9-MAPKK 5-8, wherein only cas9-MAPKKK5-2 and cas 9-MAKKK 5-3 are homozygous strains, namely T1;

under the seeds of cas9-MAPKKK5-1, cas 9-MAPKKKK 5-2, cas 9-MAPKKKK 5-3, cas 9-MAPKKKK 5-5, cas 9-MAPKKKK 5-6, cas 9-MAPKKKK 5-7 and cas 9-MAPKKKK 5-8, plant leaves showing expected traits (plant height is high) in each strain are taken after maturation, DNA is extracted for sequencing, and finally, the seeds with the numbers of cas 9-MAPKKKK 5-2-1 and cas 9-MAPKKKK 5-3-8 are selected as research objects.

The sequencing results of the target sequences at 23bp of indica rice stem 1B, cas9-MAPKKK5-2-1 and cas9-MAPKKK5-3-8 are as follows:

wherein, the indica rice stem 1B is a wild type and is an original 23bp target sequence of OsMAPKKKK 5, the sequence is shown as SEQ ID NO.2, and cas 9-MAPKKKK 5-2-1 and cas 9-MAPKKKK 5-3-8 are mutant strains with mutation of the OsMAPKKKK 5 target sequence respectively.

Compared with wild rice stem 1B, the mutant cas9-MAPKKK5-2-1 and cas 9-MAPKKKK 5-3-8 are formed by inserting a T base into 6 th-7 th bases at the 3' end of a 23bp target sequence, and the sequences are shown as SEQ ID NO. 11.

(8) The seeds of the cas9-MAPKKK5-2-1 mutant strain (T3), the seeds of the cas9-MAPKKK5-3-8 mutant strain (T3) and wild indica rice stem 1B (used as a control) are sown in 2019 at 6 months, are directly sown in a seedling bed of Taicang base of the compound denier university in Jiangsu province, are transplanted in 7 months, 30 seedlings are transplanted in each regional field, the row spacing is 6 inches multiplied by 6 inches, 10 seedlings are planted in each row, and the seedlings are grown under the field condition after 3 times (90 seedlings are planted in total).

At the mature stage, the average value of 10 individual plants in each cell is counted, then the seeds of each repeated plant are mixed (30 seeds are collected together, and the seeds are T3 generation), the plant height, thousand kernel weight, kernel length and kernel width are counted, and the average value is calculated, and the histogram of the average value is respectively shown in FIGS. 6a, 6B, 6c and 6d, wherein, represents the data compared with the rice 1B, the pUal< 0.01, the most significant level, and the statistical results are shown in the table.

The character statistics of wild indica rice stem 1B, cas9-MAPKKK5-2-1 mutant strain and cas9-MAPKKK5-3-8 mutant strain show in the table, compared with wild indica rice stem 1B, the plant heights of cas9-OsMAPKKK5-2-1 plant and cas9-OsMAPKKK5-3-8 plant are respectively increased by 7.8% and 4.1% on average, and the maximum can reach 14.1% and 15.0%; the grain length is respectively and averagely increased by 4.3 percent and 3.6 percent, and the maximum grain length can reach 6.8 percent and 6.7 percent; the grain width is respectively and averagely increased by 3.7 percent and 2.5 percent, and the maximum grain width can reach 6.5 percent and 5.7 percent, so that the grain type is improved;

further, compared with wild indica rice stem 1B, the thousand seed weight of the obtained cas 9-OsMAPKKKK 5-2-1 plant and cas 9-OsMAPKKKK 5-3-8 plant is obviously increased, the thousand seed weight is respectively increased by 15.4% and 12.7% on average, and the maximum thousand seed weight can reach 21.7% and 20.4%, so that the improvement of the grain type is further verified.

Photographing the seeds of the obtained cas9-OsMAPKKK5-2-1 and cas 9-OsMAPKKKK 5-3-8 mutant strains and the seeds of wild indica rice stem 1B, and taking a picture of the obtained comparison graph as shown in figure 3, wherein the grain size and the grain width of the seeds of the cas9-OsMAPKKK5-2-1 and cas9-OsMAPKKK5-3-8 mutant strains are increased compared with the grain size of the wild indica rice stem 1B in figure 3, thereby further proving that the grain types of the mutant strains of cas9-OsMAPKKK5-2-1 and cas9-OsMAPKKK5-3-8 are improved, so that the thousand weight is obviously improved, and simultaneously photographing the obtained grain size of the mutant strains of cas9-OsMAPK 5-2-1, cas9-OsMAPKK 5-8 and the whole mature rice plant of the wild indica rice stem 1B, the obtained control graphs are shown in FIGS. 4 and 5, and it can be seen from FIGS. 4 and 5 that the plant height of the mutant strains cas 9-OsMAPKKKK 5-2-1 and cas 9-OsMAPKKKK 5-3-8 is higher than that of wild type indica rice stalk 1B.

The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.

Sequence listing

<110> Suzhou today's New Biotechnology Co., Ltd

Application of rice OsMAPKKK5 gene in improvement of plant height and grain type of rice

<141> 2021-03-31

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2944

<212> DNA

<213> full-length cDNA sequence of OsMAPKKK5 gene of rice (Oryza sativa)

<400> 1

gtggggaaag aaagagcgga agaaaaaaaa aacatcaaca gcaaaaccga ctcccgagaa 60

gcggagaggg aaaaaaaaat tcgcccaaat ggcgggggtc gtcgtcgtcg tcttcgtctc 120

cgatccccct ctcctcatcc gcctccaccc ctcacatcgc cattgccact gtgatcacta 180

gggtttcgcg ctgctcctcg aggtaaggat tcgctcgcct tcgccgatgc ggtggtggaa 240

gcgctcggtc tccccttccc cgtccccgtc ctcttcgtcc gcgtccgcgt ccacgcccgc 300

gtccccggcg cgggcctcga cctcccgcgt tggcggcggt gtccccagcc gccgccggga 360

tgtggtgggg tttggttggg gtggggggag tgatccgcag ccgcggttga ccaggcagag 420

gcggctgcgg cacgtcgacg acatcgaggt cggggtctcg gcgctcgggc tggattcctc 480

cccctcgccc gccgcgccct cgtcgtgccc ctccagtagg gattcggtgg ggttcggcct 540

cctgaccgcg agctccacgc cgatctcgag gaccgcgagt aacatggagg tggcgccgcc 600

gaggtcgtcg tcgtctcccg tgctgctgcc gcacccgctg cccctgcccg atgaggggga 660

ctcgccctgc cgcggctccg ggagatccct cccgtcgccc aagctattcg aaggagactg 720

caacgggtcg gccgtggagt cgaacttgct cggggtttcc gagatcggga gcgacagagc 780

atcgttgttt ccgagagtga tggctaaaac ggtgcaaaaa aaccctgagc atggtgactt 840

gcgatcaaat ggcacaaatg ggattaactg tggacaacgg aggaaggcat ttaaagagaa 900

attacaggat aagagctcag ctgaaacatt gacattcaga ttgaacatac ccgctaaaag 960

tgctccaagc agtggatttt caagccctgt acagagtcct cgaagactga gtagtgtaga 1020

ctttttgtcc actgcaacat ccacccaagg tgccaattta tcgtcagcac agtcagtctg 1080

gtctcctgat ctatatggat cttcacctcg ttgtgcgtca cctgaaaaaa ttatgggtag 1140

tcaggagcga tctcctcgct ccagtccatt gagaagccct gttctaagat caaaaaaccc 1200

aagtgcacct ccttcaccaa tgcatccaaa gttgttcccg gagaaccatg tttctcgtcc 1260

tgagggcaat gggagtgtaa atttccatcc attacccctc ccacccgcct ctgtaagccc 1320

aaagcagacg aattttagtc accagccagt tccaaaagtt gatgcaccct caatggctgg 1380

tcagtggcaa aaaggaaagc tcattggcag tggaacattt ggatgtgtat atgaggccgc 1440

caatagacac actggagctc tgtgtgccat gaaagaggtc aacataattc ccgatgatgc 1500

taaatcagct gagtctctca agcaattgga gcaggaaata aaatttctta gtcaattcaa 1560

gcatgaaaac atagtgcagt actacggcag tgaatatatt gaagatcgat tctacatata 1620

cctggaatat gttcaccctg gttcaattaa taaatatgtt aatcaacatt gtggagcaat 1680

gacagaatca gtaatccgca gcttcacccg ccatatactt aaaggccttg cctttttaca 1740

tagtcagaag attatgcata gagatatcaa aggagcaaat ttgcttgttg atgtgaatgg 1800

tgtagtcaaa ttggctgact ttggaatggc taagcatttg agtactgcag ctcctaatct 1860

ttcactgaag ggaactccat actggatggc tcctgaggtt gttcaggcta cacttgtcaa 1920

agatgtaggg tatgatcttg ctgtggatat ctggagccta ggttgcacaa ttattgagat 1980

gttcacagga aagcctcctt ggagtggtct tgaagggcct gctgcaatgt ttaaggtgtt 2040

gcataaagat ccgtcaattc cagacagttt atccccggag gggaaggaat ttctgagatg 2100

ctgcttcaga agaaatccag ctgagagacc aacagcaagc aagttgctgg agcatccatt 2160

tgtccacaat tcgaataact tcaaccagca cagtgcttta cattctccca ctggacttaa 2220

atccaccgat accggtcaca atgcaagaga caaaaagtcc tgtaagattg tttcatgcat 2280

gagggggaaa aatatgatta caactggtga aacaagcagt gctagatctc ccggttcatt 2340

atctaatcgg gtggcagtag gcttgacagc cctgccaaat ttggaaactc gtagcttatc 2400

ccctacgccg atgagtttga ggtccagtcc tggctctgcg gcccatacac ctagtatgca 2460

cttttctatc gcataccatc agcctagtcc attgccaagg ccaaatggaa aggaagcaat 2520

aaatttgttc accttgaagc atgacgagct gcctacctaa ggtgcggaaa cacatcatct 2580

gtccatccac ccaatctgtt ggatgcgagc ccatctctaa cttctgatcc ctgtactgcc 2640

agtcatcata attgaacatt cgctgggtct tgtaaagtac ttggcatgcg aaggacatca 2700

gcacggtacg atcgcaatag cttctgaaac ctgtaatgtt tgttttcaag gaaatgatgg 2760

cgtttccttt gtaagatatt atttagggtt agctgtaggt taaactaatg gccctgattg 2820

ttgccaacag gtaggacact agggttgtag ttgtagcttg tgttgttttt gctattgtgt 2880

aaccacacca cgatgtaatc attgttgatt ttttgaggcc cagtaataat gataaagagt 2940

tggc 2944

<210> 2

<211> 23

<212> DNA

<213> target sequence of CDS region of OsMAPKKK5 gene of rice (Oryza sativa)

<400> 2

atccgcagcc gcggttgacc agg 23

<210> 3

<211> 777

<212> PRT

<213> Rice OsMAPKKKK 5 Gene-encoding amino acid sequence (Oryza sativa)

<400> 3

Met Arg Trp Trp Lys Arg Ser Val Ser Pro Ser Pro Ser Pro Ser Ser

1 5 10 15

Ser Ser Ala Ser Ala Ser Thr Pro Ala Ser Pro Ala Arg Ala Ser Thr

20 25 30

Ser Arg Val Gly Gly Gly Val Pro Ser Arg Arg Arg Asp Val Val Gly

35 40 45

Phe Gly Trp Gly Gly Gly Ser Asp Pro Gln Pro Arg Leu Thr Arg Gln

50 55 60

Arg Arg Leu Arg His Val Asp Asp Ile Glu Val Gly Val Ser Ala Leu

65 70 75 80

Gly Leu Asp Ser Ser Pro Ser Pro Ala Ala Pro Ser Ser Cys Pro Ser

85 90 95

Ser Arg Asp Ser Val Gly Phe Gly Leu Leu Thr Ala Ser Ser Thr Pro

100 105 110

Ile Ser Arg Thr Ala Ser Asn Met Glu Val Ala Pro Pro Arg Ser Ser

115 120 125

Ser Ser Pro Val Leu Leu Pro His Pro Leu Pro Leu Pro Asp Glu Gly

130 135 140

Asp Ser Pro Cys Arg Gly Ser Gly Arg Ser Leu Pro Ser Pro Lys Leu

145 150 155 160

Phe Glu Gly Asp Cys Asn Gly Ser Ala Val Glu Ser Asn Leu Leu Gly

165 170 175

Val Ser Glu Ile Gly Ser Asp Arg Ala Ser Leu Phe Pro Arg Val Met

180 185 190

Ala Lys Thr Val Gln Lys Asn Pro Glu His Gly Asp Leu Arg Ser Asn

195 200 205

Gly Thr Asn Gly Ile Asn Cys Gly Gln Arg Arg Lys Ala Phe Lys Glu

210 215 220

Lys Leu Gln Asp Lys Ser Ser Ala Glu Thr Leu Thr Phe Arg Leu Asn

225 230 235 240

Ile Pro Ala Lys Ser Ala Pro Ser Ser Gly Phe Ser Ser Pro Val Gln

245 250 255

Ser Pro Arg Arg Leu Ser Ser Val Asp Phe Leu Ser Thr Ala Thr Ser

260 265 270

Thr Gln Gly Ala Asn Leu Ser Ser Ala Gln Ser Val Trp Ser Pro Asp

275 280 285

Leu Tyr Gly Ser Ser Pro Arg Cys Ala Ser Pro Glu Lys Ile Met Gly

290 295 300

Ser Gln Glu Arg Ser Pro Arg Ser Ser Pro Leu Arg Ser Pro Val Leu

305 310 315 320

Arg Ser Lys Asn Pro Ser Ala Pro Pro Ser Pro Met His Pro Lys Leu

325 330 335

Phe Pro Glu Asn His Val Ser Arg Pro Glu Gly Asn Gly Ser Val Asn

340 345 350

Phe His Pro Leu Pro Leu Pro Pro Ala Ser Val Ser Pro Lys Gln Thr

355 360 365

Asn Phe Ser His Gln Pro Val Pro Lys Val Asp Ala Pro Ser Met Ala

370 375 380

Gly Gln Trp Gln Lys Gly Lys Leu Ile Gly Ser Gly Thr Phe Gly Cys

385 390 395 400

Val Tyr Glu Ala Ala Asn Arg His Thr Gly Ala Leu Cys Ala Met Lys

405 410 415

Glu Val Asn Ile Ile Pro Asp Asp Ala Lys Ser Ala Glu Ser Leu Lys

420 425 430

Gln Leu Glu Gln Glu Ile Lys Phe Leu Ser Gln Phe Lys His Glu Asn

435 440 445

Ile Val Gln Tyr Tyr Gly Ser Glu Tyr Ile Glu Asp Arg Phe Tyr Ile

450 455 460

Tyr Leu Glu Tyr Val His Pro Gly Ser Ile Asn Lys Tyr Val Asn Gln

465 470 475 480

His Cys Gly Ala Met Thr Glu Ser Val Ile Arg Ser Phe Thr Arg His

485 490 495

Ile Leu Lys Gly Leu Ala Phe Leu His Ser Gln Lys Ile Met His Arg

500 505 510

Asp Ile Lys Gly Ala Asn Leu Leu Val Asp Val Asn Gly Val Val Lys

515 520 525

Leu Ala Asp Phe Gly Met Ala Lys His Leu Ser Thr Ala Ala Pro Asn

530 535 540

Leu Ser Leu Lys Gly Thr Pro Tyr Trp Met Ala Pro Glu Val Val Gln

545 550 555 560

Ala Thr Leu Val Lys Asp Val Gly Tyr Asp Leu Ala Val Asp Ile Trp

565 570 575

Ser Leu Gly Cys Thr Ile Ile Glu Met Phe Thr Gly Lys Pro Pro Trp

580 585 590

Ser Gly Leu Glu Gly Pro Ala Ala Met Phe Lys Val Leu His Lys Asp

595 600 605

Pro Ser Ile Pro Asp Ser Leu Ser Pro Glu Gly Lys Glu Phe Leu Arg

610 615 620

Cys Cys Phe Arg Arg Asn Pro Ala Glu Arg Pro Thr Ala Ser Lys Leu

625 630 635 640

Leu Glu His Pro Phe Val His Asn Ser Asn Asn Phe Asn Gln His Ser

645 650 655

Ala Leu His Ser Pro Thr Gly Leu Lys Ser Thr Asp Thr Gly His Asn

660 665 670

Ala Arg Asp Lys Lys Ser Cys Lys Ile Val Ser Cys Met Arg Gly Lys

675 680 685

Asn Met Ile Thr Thr Gly Glu Thr Ser Ser Ala Arg Ser Pro Gly Ser

690 695 700

Leu Ser Asn Arg Val Ala Val Gly Leu Thr Ala Leu Pro Asn Leu Glu

705 710 715 720

Thr Arg Ser Leu Ser Pro Thr Pro Met Ser Leu Arg Ser Ser Pro Gly

725 730 735

Ser Ala Ala His Thr Pro Ser Met His Phe Ser Ile Ala Tyr His Gln

740 745 750

Pro Ser Pro Leu Pro Arg Pro Asn Gly Lys Glu Ala Ile Asn Leu Phe

755 760 765

Thr Leu Lys His Asp Glu Leu Pro Thr

770 775

<210> 4

<211> 34

<212> DNA

<213> primer cas9-MAPKKK5-F ("Artificial sequence")

<400> 4

cagtggtctc aggcatccgc agccgcggtt gacc 34

<210> 5

<211> 34

<212> DNA

<213> primer cas9-MAPKKK5-R ("Artificial sequence")

<400> 5

cagtggtctc aaaacctggt caaccgcggc tgcg 34

<210> 6

<211> 20

<212> DNA

<213> primer Pbw2+ ("Artificial sequence") for PCR identification

<400> 6

ggcgtcttct actggtgcta 20

<210> 7

<211> 20

<212> DNA

<213> primer Pbw2- ("Artificial sequence") for PCR identification

<400> 7

gtctttacgg cgagttctgt 20

<210> 8

<211> 325

<212> DNA

<213> Standard sequence ("Artificial sequence")

<400> 8

gtccccgtcc tcttcgtccg cgtccgcgtc cacgcccgcg tccccggcgc gggcctcgac 60

ctcccgcgtt ggcggcggtg tccccagccg ccgccgggat gtggtggggt ttggttgggg 120

tggggggagt gatccgcagc cgcggttgac caggcagagg cggctgcggc acgtcgacga 180

catcgaggtc ggggtctcgg cgctcgggct ggattcctcc ccctcgcccg ccgcgccctc 240

gtcgtgcccc tccagtaggg attcggtggg gttcggcctc ctgaccgcga gctccacgcc 300

gatctcgagg accgcgagta acatg 325

<210> 9

<211> 21

<212> DNA

<213> amplification primer Hyg-CX-S for PCR amplification detection ("Artificial sequence")

<400> 9

agatgttggc gacctcgtat t 21

<210> 10

<211> 24

<212> DNA

<213> amplification primer Hyg-CX-A for PCR amplification detection ("Artificial sequence")

<400> 10

aagatcgtta tgtttatcgg cact 24

<210> 11

<211> 24

<212> DNA

<213> target sequences of cas9-MAPKKK5-2-1 mutant and cas 9-MAPKKKK 5-3-8 mutant ("Artificial sequences")

<400> 11

atccgcagcc gcggttgtac cagg 24

Claims

1. The application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice is characterized in that a target fragment is selected in a CDS region of the rice OsMAPKKKK 5 gene, a pBWA (V) H-cas9 plasmid is used as an expression vector, a target sequence of the target fragment selected in the CDS region of the rice OsMAPKKKK 5 gene is inserted into a pBWA (V) H-cas9 plasmid, the obtained pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid is transformed into indica rice 1B, and the OsMAPKKKK 5 gene mutant strain cas9-MAPKKK5-2-1 or cas 9-KKMAPK 5-3-8 with the plant height and the grain type improved is obtained through PCR detection and first-generation sequencing screening.

2. The application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice as claimed in claim 1, wherein the target sequence of the selected target fragment in the CDS region of the rice OsMAPKKKK 5 gene is shown in SEQ.ID NO. 2.

3. The use of the rice OsMAPKKKK 5 gene in the improvement of plant height and grain type of rice as claimed in claim 1, wherein the obtained OsMAPKKKK 5 gene mutant strain with increased plant height and improved grain type has the target sequence as shown in SEQ ID No. 11.

4. The use of the rice OsMAPKKK5 gene in the improvement of plant height and grain type of rice as claimed in claim 1, wherein the pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid is transformed into indica rice stem 1B by the following steps:

after husking and sterilizing mature seeds of indica rice stem 1B, inoculating the seeds to a dedifferentiation plant tissue culture medium for inducing callus, culturing the seeds at 26-28 ℃ for about 15-20 days, and then subculturing the seeds to obtain indica rice stem 1B callus, introducing the purified vector pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into indica rice stem 1B callus cells by adopting an agrobacterium-mediated method, and finishing the conversion of the pBWA (V) H-cas 9-OsMAKKK 5 recombinant plasmid into indica rice stem 1B.

5. The use of the rice OsMAPKKK5 gene in the improvement of plant height and grain type of rice as claimed in claim 4, wherein the pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid is introduced into indica rice stem 1B callus cells by Agrobacterium-mediated method, comprising the following steps:

the agrobacterium tumefaciens EHA105 transformed by the recombinant plasmid S1 and pBWA (V) H-cas 9-OsMAPKKKK 5 specifically comprises the following steps:

adding the recombinant plasmid containing pBWA (V) H-cas9-OsMAPKKK5 into an agrobacterium EHA105 competent cell according to the volume percentage of 10%, sequentially placing the recombinant plasmid on ice for 30min, immersing the recombinant plasmid into liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to obtain the agrobacterium EHA105 competent cell containing the recombinant plasmid containing pBWA (V) H-cas9-OsMAPKKK 5;

secondly, adding the obtained agrobacterium EHA105 competent cell containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid into an LB liquid culture medium without antibiotics, controlling the temperature to be 28 ℃ and the rotating speed to be 150-160rpm, and culturing for 3-4 hours to obtain a culture solution according to the proportion of 22 percent by volume;

thirdly, centrifuging the obtained culture solution at the rotation speed of 4000rpm for 10min to collect thalli, uniformly mixing the thalli centrifugally collected with supernatant obtained by centrifuging the culture solution with the volume of 11%, and then coating the mixture on an LB plate culture medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin to culture for 36-72h at the temperature of 28 ℃ to form bacterial plaques on the LB plate culture medium;

the bacterial plaque successfully identified by PCR is the agrobacterium EHA105 containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid;

1 bacterial plaque which is successfully identified by PCR is picked, 1.5ml of EP pipe-connected bacteria are carried out and cultured in a shaking table at the temperature of 28 ℃, thus obtaining agrobacterium EHA105 seed solution containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid;

s2, inducing and culturing the calluses of the mature seeds of the indica rice stem 1B:

husking mature seeds of the indica rice stem 1B, firstly soaking and washing with 75% ethanol for 10-15min under aseptic condition, washing with sterile water for 3-5 times, then soaking in 0.1% mercury bichloride for 20-30min, washing with sterile water for 3-5 times, inoculating into an induction culture medium for inducing callus, culturing under the dark condition of 26-28 ℃, selecting callus for subculture after 15-20 days, and obtaining the indica rice stem 1B callus;

s3, agrobacterium infection:

inoculating agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into YEP liquid culture medium according to the inoculation amount of 10-11% in volume ratio, culturing at the temperature of 26-28 ℃ for 12-16H, collecting bacterial liquid, and diluting with YEP liquid culture medium (YEP liquid culture medium containing 10g of beef extract, 10g of yeast extract, 5g of NaCl, pH =7.0 and the balance of water in terms of per liter) until the bacterial liquid concentration of the agrobacterium containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid is OD 600-0.5;

secondly, airing the calluses of the indica rice stem 1B obtained in the S2 on sterile filter paper, then transferring the calluses into a bacterial liquid of agrobacterium containing pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmids with OD600 & lt 0.5 at one time, uniformly mixing the calluses, then soaking the calluses for 10 to 30min at the rotation speed of 150rpm, and then pouring out the bacterial liquid to obtain infected calluses;

thirdly, placing the infected callus obtained in the second step on sterile filter paper until the bacteria liquid is sucked dry, then transferring the infected callus to a co-culture medium, paving a layer of sterile filter paper on the surface of the culture medium, enabling the callus to be not in direct contact with the culture medium on the filter paper, and performing dark culture for 5-7 days at the controlled temperature of 26-28 ℃ to obtain the callus infected by the agrobacterium EHA 105;

s4, screening of resistant callus:

taking out the callus infected by the agrobacterium EHA105 obtained in the step S3, washing the callus with sterile water for 3-5 times, washing the callus with sterile water containing 50mg/L rifampicin and 50mg/L kanamycin for 2-3 times, transferring the callus into a primary screening culture medium after the sterile filter paper absorbs the excess water, carrying out primary screening for 15-20min, and repeating the above actions for 2-3 times to obtain weak-resistance callus;

and secondly, transferring the weak resistance callus to a secondary screening culture medium, performing secondary screening for 15-20 days under the condition that the temperature is controlled to be 26-28 ℃, and obtaining the strong resistance callus after screening is completed.

6. The use of the rice OsMAPKKK5 gene in the improvement of plant height and grain type of rice as claimed in claim 5, wherein the primer Pbw2+ used in the PCR identification in S1: GGCGTCTTCTACTGGTGCTA, the sequence of which is shown in SEQ ID NO.6, Pbw 2-: GTCTTTACGGCGAGTTCTGT, the sequence is shown in SEQ ID NO.7, the length of the amplified fragment is 422bp, the positive strip sequence successfully identified by PCR is compared with the standard sequence, and the standard sequence is shown in SEQ ID NO. 8.

7. The rice OsMAPKKKK 5 gene of claim 5, which is used for improving the plant height and grain type of rice, and the obtained Agrobacterium EHA105 contains pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid.

8. A pBWA (V) H-cas 9-OsMAPKKKK 5 recombinant plasmid obtained from the application of the OsMAPKKKK 5 gene of rice as claimed in claim 1 in improving the plant height and grain type of rice.