CN112301046A - Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof - Google Patents
Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof Download PDFInfo
- Publication number
- CN112301046A CN112301046A CN202010995662.2A CN202010995662A CN112301046A CN 112301046 A CN112301046 A CN 112301046A CN 202010995662 A CN202010995662 A CN 202010995662A CN 112301046 A CN112301046 A CN 112301046A
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- ghd14
- development
- regulating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8291—Hormone-influenced development
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Endocrinology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of plant genetic engineering, and discloses a gene capable of regulating and controlling plant stem elongation and collateral branch developmentGhD14And the application thereof, the nucleotide sequence of the gene is shown as SEQ ID No. 1. By applying the inventionGhD14Gene transfer into plantsThe transgenic plants, which are overexpressed in plants, particularly cotton, have increased plant height and reduced stem branching. The invention provides a new thought for the development mechanism of plants and has important significance in the research of the growth and development of the plants.
Description
Technical Field
The invention belongs to the field of plant genetic engineering, and particularly relates to application of a gene GhD14 in plant stem elongation and lateral branch development.
Background
Strigolactones (SLs) are novel phytohormones, and under normal conditions, SLs synthesized by the roots of wild-type plants regulate and control various physiological activities of the plants in a balanced manner, including controlling the number of branches, lateral roots and root hairs, and simultaneously can accelerate secondary growth of vegetative organs and regulate aging speed of the organs. Conversely, when the SLs biosynthetic pathway is blocked, resulting in a decrease in endogenous SLs content, or the SLs signal is not perceived by the target, the number of branches in the plant increases, root length becomes shorter, and flowering is delayed. The CCD7 and CCD8 genes in the kiwi fruit have the same functions as homologous genes in arabidopsis thaliana, and the silencing of the CCD8 gene in the kiwi fruit can cause more branches and a phenotype of delayed leaf senescence. The pea strigolactone synthesis gene mutant ccd8 shows more branches, and exogenous strigolactone can restore the characteristic of the more branches to the wild characteristic. After mutation of the petunia CCD7 or CCD8 gene, the petunia CCD7 or CCD8 gene shows a more branched character.
The inventor finds a homologous gene CotAD _32039 in cotton by selecting an encoding gene AtD14 of a receptor protein DWARF 14 in an arabidopsis thaliana SLs signal transduction pathway and comparing amino acid sequences, and clones a GhD14 gene by taking Xuzhou 142 of upland cotton as an experimental material. The CDS total length of the GhD14 gene is 816bp, and 272 amino acids are coded; GhD14 has the highest similarity to cocoa alpha/beta hydrolase; the GhD14 gene is relatively expressed in high quantity in stems and flowers; the GhD14 gene is mainly expressed in axillary buds, stems and flowers; GhD14 localized to the cytoplasm and nucleus. The GhD14 gene can complement the multi-branch phenotype of the arabidopsis mutant d 14-1; the expression of the GhD14 gene is reduced, the vegetative branches of cotton grow early, the fruit branch length at the later stage is obviously lengthened, and the GhD14 gene is presumed to be related to the morphogenesis of the overground part of the cotton plant.
Disclosure of Invention
The invention aims to solve the technical problem of how to regulate the plant stem elongation and lateral branch development, after the GhD14 gene is transferred into cotton, the cotton stem development can be regulated, the cotton stem elongation and the branch number of the stem can be reduced, and the basis is that D14 is used as a potential receptor of SLs and participates in the signal conduction of strigolactone. The D14 protein can hydrolyze strigolactone molecules of various structural formulas to generate an active molecule CLIM derived from the D-ring of strigolactone, completely encapsulate the CLIM at the catalytic center thereof and irreversibly bind the CLIM in a covalent bond manner, recruit F-box protein D3, and trigger a hormone signaling chain.
After the GhD14 gene is transferred into Arabidopsis, the development of Arabidopsis stem can be regulated, and the Arabidopsis stem can be elongated and the branch number of the stem can be reduced.
In order to solve the technical problems, the invention provides a GhD14 gene for regulating and controlling plant development, and the nucleotide sequence of the gene is shown as SEQ ID No. 1.
The invention also provides an expression cassette, a recombinant expression vector and a transgenic cell line of the gene; wherein the recombinant expression vector is recombinant plasmid pBI121-GhD14, pCAMBIA2300-GhD14pro-GUS, or p35S: GhD 14.
Meanwhile, the invention also provides the GhBLH1 gene or the application of the recombinant expression vector in regulating and controlling plant development.
The application is the application in regulating and controlling the development of plant stems or/and lateral branches.
The application is the application in regulating and controlling the elongation of the stem or/and the application in regulating and controlling the generation number of the side branches of the plant.
The application is to introduce the GhD14 gene into a target plant for overexpression to obtain a transgenic plant with growth development different from that of a receptor plant, preferably a transgenic plant with increased plant height and reduced branch number of stems.
The plant is dicotyledonous plant, monocotyledonous plant, gramineae plant, cruciferae plant, arabidopsis thaliana, wild type arabidopsis thaliana Columbia; the plant is preferably cotton or Arabidopsis, more preferably Asian cotton, upland cotton, or Ramengder cotton.
The nucleotide sequence of the gene GhD14 of the present invention can be mutated by known methods by those skilled in the art, and those nucleotides obtained by artificial modification and having 75% or higher identity with the nucleotide sequence of the gene GhD14 of the present invention are all derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the gene GhD14 and have the function of the gene GhD 14.
The present invention also provides a method for breeding a transgenic plant, comprising the steps of: introducing the encoding gene GhD14 into a receptor plant to obtain a transgenic plant which has different growth and development from the receptor plant.
In the above method, the "introduction of the gene GhD14 into the recipient plant" may be carried out by introducing a recombinant plasmid into the recipient plant.
The recombinant plasmid can be specifically recombinant plasmid pBI121-GhD14, pCAMBIA2300-GhD14pro-GUS, p35S, GhD14 and the like.
The invention has the following beneficial effects:
according to the GhD14 gene, D14 hydrolyzes strigolactone molecules with different structural formulas in SLs signal channels to generate an active molecule CLIM derived from a strigolactone D-ring, the CLIM is completely wrapped in a catalytic center of the strigolactone, and is irreversibly combined with the CLIM in a covalent bond mode, F-box protein D3 is recruited, a trigger hormone signal transduction chain is triggered, and cell elongation is promoted. The invention firstly provides an evolutionary relationship between GhD14 protein and model plant Arabidopsis thaliana homologous protein, the homology with AtD14 protein is 68.4%, qRT-PCR technology is utilized to detect the expression level of GhD14 in different organs and fibers of roots, stems, leaves, flowers and the like in different development periods, the GhD14 gene is expressed in each tissue part and fibers in different development periods, but the expression level is higher in the stems and the flowers. It is presumed that the GhD14 gene may be involved in the growth and development of stems and floral organs. Through GUS staining, the GUS reporter gene driven by the GhD14 gene promoter is found to be expressed in cotyledons and roots of seedlings and leaf primordium, true leaves, flowers, stems and axillary buds of the stems, but the staining of the flowers, the stems, the axillary buds and other parts is deepest, which indicates that the expression level of the GUS gene in the parts is higher, and the GhD14 gene is supposed to be mainly acted on the development of the stems and the flowers and the growth of lateral branches. By constructing an overexpression vector, the GhD14 gene in cotton can obviously increase the plant height of an arabidopsis mutant d14-1 and reduce the branch number of stems. Indicating that GhD14 is associated with stem elongation and collateral development.
The invention provides application of a GhD14 gene in regulation and control of plant development, and after the GhD14 gene is transferred into arabidopsis, the plant height of an arabidopsis mutant d14-1 can be obviously increased, and the branch number of stems is reduced, so that the invention has great significance for research on plant (cotton) development.
Drawings
FIG. 1: expression analysis of GhD14 in different tissues and fibers of cotton at different developmental stages.
FIG. 2: GUS staining results of different parts of Arabidopsis thaliana, wherein A: 5 days of transgenic seedlings; b: 15 days of transgenic seedlings; c: a leaf primordium; d: cotyledons; e: flower; f: a main stem inflorescence; g: axillary buds; h: and (4) a stem.
FIG. 3 shows the results of phenotypic identification of transgenic Arabidopsis thaliana, A: leaf shape and width of wild type arabidopsis, mutant and mutant complementation plants; b: counting the leaf widths of wild arabidopsis thaliana, mutant and mutation complementary plants; c: counting the height of wild arabidopsis, mutant and mutant complementary plants; d: the plant heights of wild arabidopsis, mutant and mutant complementary plants; e: counting the number of stem branches of wild arabidopsis thaliana, mutant and mutant complementary plants.
Detailed Description
The invention is described in further detail below with reference to specific embodiments, which are given by way of illustration only and are not intended to limit the scope of the invention.
In the following examples, the test methods, unless otherwise specified, are conventional; the materials, reagents and the like used, unless otherwise specified, are commercially available; quantitative experiments are carried out, three times of repeated experiments are set, and the results are averaged; the material is selected from cotton fiber tissue of 0, 3, 5, 10, 15 and 20 days after flowering, which is respectively referred to as 0DPA, 3DPA, 5DPA, 10DPA, 15DPA and 20 DPA.
The cotton variety Xuzhou cotton 142 is a well-known variety and is sourced from the Cotton research institute of Chinese academy of sciences.
Wild type Arabidopsis thaliana, laboratory preserved by the applicant.
Arabidopsis mutant d14-1, purchased from ABRC (Arabidopsis Biological Resource center) Arabidopsis germplasm resources pool, USA.
Wild type arabidopsis thaliana Columbia is described in the following documents:
A Gigon，AR Matos，D Laffray，Y Zuily-Fodil，AT Pham-Thi.Effect of drought stress on lipid metabolism in the leaves of Arabidopsis thaliana(ecotype Columbia).Annals of Botany,2004,94(3):345-351.
agrobacterium tumefaciens GV3101 is described in: xiaoweimin, Gem, Zhoumai, Sucheng, Du soldier Arabidopsis Thaliana injured and inoculated with Agrobacterium tumefaciens GV3101 on transcription, proceedings of agricultural Biotechnology, 2013,21(5):537 and 545.
Plasmid pCAMBIA2300 is described in the following documents: sclera, brave, von yongkun, nianwei, luo hong mei, guo shui, liu lai hua. And (3) constructing and verifying a plant expression vector pCAMBIA 2300-35S-GUS-CaMVterm. Journal of biological engineering in China, 2013,33(3) 86-91.
The light-dark alternate culture is light culture and dark culture alternate, and the specific culture period can be as follows: 14 hours light culture/10 hours dark culture.
The inventor searches a cotton genome database by using a BLAST program by taking the sequence of an Arabidopsis D14 gene as a reference to obtain the full length of a cotton GhD14 gene, wherein the nucleotide sequence of the GhD14 gene is shown as SEQ ID No. 1.
Example 1: expression pattern of GhD14 gene in different stages of cotton fiber development
1. Extracting the RNA of the tissues of Xuzhou cotton 142 such as 0DPA, 3DPA, 5DPA, 10DPA, 15DPA, 20DPA and the like in different organ roots, stems, leaves and fiber development stages, reverse transcribing the RNA into first-strand cDNA, designing a primer according to a dominant gene sequence, wherein the dominant gene sequence is GhD14-QRT-F: CCTTGTGACGGTTCCTTGCCA, GhD 14-QRT-R: GAAGCACCGGGATGACGATATC, performing Q-PCR amplification.
2. The procedure used to carry out the above experiment was a pre-denaturation at 95 ℃ for 15 s; denaturation at 95 ℃ for 5s, renaturation at 60 ℃ for 34s, and extension at 72 ℃ for 40s (data acquisition); for a total of 40 cycles.
3. The internal reference gene used for completing the test is GhUBQ7, and the primer sequence is GhUBQ7-F: GGCATTCCACCTGACCAACAA, GhUBQ7-R: CCGCATTAGGGCACTCTTTTC
4. Each of the above reactions is provided withSetting 3 times of biological repetition and 3 times of technical repetition, adopting 2 to analyze the relative quantitative differential expression–ΔΔCTThe method is described in the following literature (Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2–ΔΔCT Method.Livak and Schmittgen,2001:25,402-408.
5. The results of the quantitative expression were analyzed in FIG. 1.
6. The results prove that: the GhD14 gene is expressed in each tissue site and in fibers at different developmental stages, but is expressed in higher amounts in stems and flowers. It is speculated that the GhD14 gene may be related to the growth and development of plant stems and flower organs.
Example 2: acquisition and phenotypic analysis of GhD14 transgenic Arabidopsis plants
Construction of recombinant plasmid pCAMBIA2300-GhD14pro-GUS vector and obtaining of plant
1. The primer is used for amplification to obtain a sequence about 1893bp shown as SEQ ID No. 2. Primer sequences are shown in the following table. Primers were designed with reference to the sequence of the cotton genome (https:// cottonfgd. org /), and the full length of the GhD14 gene was obtained by PCR amplification. The DNA of the cotton seedling tissue is used as a template, the full length of the GhD14 gene promoter with the carrier joint primer is obtained by amplification, and the underlined in the following table primer is the sequence of the target gene.
2. The promoter is connected to the upstream of GUS coding sequence by means of homologous recombination to obtain recombinant plasmid pCAMBIA2300-GhD14 pro-GUS.
3. And introducing the recombinant plasmid into agrobacterium tumefaciens LB4404 to obtain the recombinant agrobacterium tumefaciens.
4. Transfecting wild type Arabidopsis thaliana by Agrobacterium-mediated floral dip method, and harvesting the T0Seeding on 1/2 MS plate containing Kana 70mg/L, screening to obtain positive seedling, transplanting in nutrient soil to obtain T2Generation of seed and for T2GUS histochemical staining was performed on each tissue of the seed generation.
Secondly, constructing a GhD14 plant expression vector and obtaining a plant by recombinant plasmid p35S
1. The target gene sequence shown as SEQ ID No.1 is obtained by amplification of primers, and the primer sequence is shown in the following table:
using cDNA of cotton seedling whole plant sample as template, amplifying to obtain GhD14 gene segment with carrier homologous arm, underlined as target gene sequence,
3. a p35S plant expression vector GhD14 is constructed by utilizing a homologous recombination method.
4. The recombinant plasmid p35S, GhD14 is introduced into Agrobacterium tumefaciens LB4404 to obtain the recombinant Agrobacterium tumefaciens.
5. The mutant d14-1 is transfected by an agrobacterium-mediated floral dip method, and after a positive seedling is obtained by screening, the leaf shape of arabidopsis is observed.
Phenotypic analysis of transgenic Arabidopsis
1. The result of the pCAMBIA2300-GhD14pro-GUS transgenic plant is shown in figure 2, the GUS reporter gene driven by the GhD14 gene promoter is expressed in cotyledon and root of seedling and leaf primordium, true leaf, flower, stem and stem axillary bud, but the staining of the flower, stem and axillary bud is deepest, which indicates that the GUS gene expression level in the parts is higher, and the GhD14 gene is supposed to be mainly acted on the development of stem and flower and the growth of lateral branch.
2. P35S GhD14 vector, leaf shape of Arabidopsis is observed, wild Arabidopsis leaves with the same leaf age are oval, and mutant plant leaves are nearly elliptical in shape. The aspect ratio of the fourth pair of rosette leaves was measured and found to be significantly smaller than that of the wild type arabidopsis, and the shape of the mutant complementary plant leaves was not different from that of the wild type arabidopsis (fig. 3A, fig. 3D). Meanwhile, observing and counting the leaf width, the plant height and the branch number of the stem of the wild arabidopsis thaliana, the mutant d14-1 and the mutant complementary plant, and finding that the mutant d14-1 plant becomes short and the branch number of the stem is remarkably increased (fig. 3B, fig. 3C and fig. 3E), wherein the statistical results are as follows:
| WT | d14-1 | d14-1/35S:GhD14 | |
| Leaf leagth/width ratio | 2.8±0.3 | 2.3±0.4 | 3.2±0.4 |
| Plant height(cm) | 24.2±3.4 | 11.9±1.5 | 20.4±2.9 |
| Number of branches | 4±2 | 18±4 | 9±3 |
the GhD14 gene in cotton can obviously increase the plant height of the arabidopsis mutant d14-1 and reduce the branch number of the stem. Indicating that GhD14 is associated with stem elongation and collateral development.
<110> university of Shanxi university
<120> gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof
<160> 2
<210> 1
<211> 816
<212> DNA
<400> 1
ATGGGAATCGTCGAAGAAGCTCACAACTTGAAGGTACTGGGTTCAGGCGATCGAGTCATCGTTTTGGCTCATGGGTTCGGTACGGACCAATCGGTTTGGAAGCACTTGGTCCCTCACTTAGTCGACGATTTCCGTGTCGTATTGTACGACAACATGGGTGCCGGAACCACCAACCCCGAATACTTCGATTTCAATCGTTATGCTACTCTCGAAGGTTATGCTTATGATTTGCTTGCGATCCTTGAAGAAATCCACGTCGATTCATGTATTTTCGTCGGCCACTCCGTTTCCGCCATGGTTGGCGCCATAGCTTCTATTTCCCGACCCGATTTTTTCTCTAAAATCATCATGATCTCTGGTTCCCCAAGGTATCTTAATGACGTGGATTACTACGGTGGGTTCGAGCAAGAAGACTTAGACCAACTCTTCGAAGCAATGGGAGCCAATTACAAAGCTTGGTGTTCCGGTTTCGCGCCGTTAGCGGTGGGCGGCGACTTGGAATCGGTGGCAGTTCAAGAATTTAGCCGTACCCTTTTCAATATGAGACCCGATATAGCTCTCAGTGTAGCTCAAACGATATTTCAAAGCGATATGAGACAAATTCTGAACCTTGTGACGGTTCCTTGCCATATCCTTCAAAGTGTTAAAGACTTGGCCGTCCCCGTCGTCGTCTCCGAGTACTTACACCAAAATCTCGGCGGCGAATCCATCGTCGAAGTGATGACGTCCGACGGTCATCTTCCGCAGCTTAGCTCACCGGATATCGTCATCCCGGTGCTTCTTAAGCATATTCGTTACGATATCAGTGTTGCATGA
<210> 2
<211> 1893
<212> DNA
<400> 2
GATGTGAAACTAAAGTAGATTTAGATAATTTCGTATTCTTTTATGATTAATATTTTAACGATCCAATCATTGAATTTATCAATATAATTGTACTTGACATGTATGTAAATTTCGAACCAATTCGATATCTCTAACATATCTATCTAAAACAATGTGTATACTAATATTTATTGAACGGCTGAAATTTGTTCACATAAAACGAATAGCTTAAAATTTTTAATTAATTTACGTCAAATTTGACATACATAAATGATTGAATCATCAAAATATTAATTATACAAAAAATATATTAAAAATATAAAATAATTTTAATGATTCCTCTTAATTATATAAAAATTAAAATAAATATCTTTTATTTTTTTGAAAAACTCATTATTTAAAATGTAAATATCACCTTCTAAAATCTTGTGATACTTTTAAAATTAAATTTCTAAATATTAATTTTGATGACTACTTATCACAGAAAGAAAAAGAAAAAGAAAAATCAAAAGGAAAAAGTGAGAACGAGACTTCCTTTTCTTCACCCCACTTGCAATTAGAACTTTGATCTCATTGTCACCCACAACCCTATTTAGTGGGCCCCACGTACGGTCAATTTACCGCCGCAATAATTTGGAATGACGTAAGTTTAAAATGTATTATTTTAACCGCGTAATTTTTTTTATTTAATTATGAATGATTTTGACATTATATAGAACAACATTATTGAAAATTTTATAACTATATAATTATAATGAATTAAGTTTAAAAATGTTAATTATTTGAATAGAATTAAATTCTATTTTTGTTTAAATTATAATTATTTTTTATGATGTAAAAAGATATTTTATTTTTCTTGAAAACAAATCCTTTTAAAATATTTATGAAAAAAGATATTTTGAGAAGCTATCATTTAATGTCCAAAAGGGACAAATAATTTCAAAGAACCCCAAATTAGGGGTGAGCAATTTTAGTTTTAATTGTAAAATCTTCCCCTTTAACGGTTGGATAGGTTCGTCGGTTTTAATTTCGGTTTAATTGATTAATTTAGTCGATTATCAATTTTTAAATCTTAAAATTTAACTGACAAAAAAATTTTATTTTATATTTTTTAAAATCATTTAAAATATATTTATATTTTATAATATATAATGTATATATAATTATATAAACCCAATTTAATAACCCAAGATTAGTTAACTTGAAAAATTGATCGAATTAAAGTCGTTTCGGTCTGATAAATTTTTTCAACTAAAATCGATTGGATCAATTTTCTTATGTTAAGCTTCGTTAAGTCAATTTGAAAAAAAAGATTACTCCAACCGATTAAACTAATTACTCTCTCTAACTTCAAACCTAAACCAAGTTATCAATCCCATCAAACTGAACCAAACTCACCATTGTATATTAGGTGCTATATATTCTTAAACCGAAAGGATTATATGAAACAGTGACGCCACGTTCTAATAATTTTATGCCACAACAGTACTCTTATTTTGAATTTCAAAATTTTATCCAAATTAAAATATTAAAATTCAGGATAAAATCTTGAAATTTAAGATAAAAATACTGATATGGTATAAAACTATTAAAAATAAATACAAATGACGTGACGTTACTGTTTCATACAATCCTTTTTCATTATATCTTTAGGTTGCTAGAGGAGTTAATTTTCTATAATCAAGTGATTCTCCACCGTCTGATCTATCTTATCCAAAAAAGAAAAAAAATCGCACATGTGCGGTCCATATGAACCATCTGCCTTGCGTCAAGCCTCTTCAAAGCCGTCACAGAGATCAATTTTCTATTAGCTTTCCGAATATAAATATAACCCACATGTGAAACCAAAAATCTTCACTCTTTTTTTCTTCTGGTTTCTGTTTGCCACAATTTTGGTAGAAAAGGGACAATTAA
Claims (10)
1. Regulating plant developmentGhD14The nucleotide sequence of the gene is shown in SEQ ID No. 1.
2. An expression cassette, a recombinant expression vector, a transgenic cell line comprising the gene of claim 1.
3. Comprising the recombinant expression vector of claim 2, which is a recombinant plasmid pBI121- GhD14，pCAMBIA2300-GhD14pro-GUS, orp35S::GhD14。
4. The method of claim 1GhBLH1Use of a gene, or a recombinant expression vector according to claim 2 or 3, for modulating plant development.
5. Use according to claim 4 for regulating the development of plant stalks and/or collaterals.
6. Use according to claim 5, for regulating the elongation of stalks.
7. Use according to claim 5 for modulating the reduction of the number of lateral shoot generations in a plant.
8. Use according to any one of claims 4 to 7, characterized in that it consists in subjecting saidGhD14The gene is introduced into a target plant and is overexpressed, so that a transgenic plant with the growth development different from that of the receptor plant is obtained, and the transgenic plant with the plant height increased and the branch number of the stem reduced is preferably obtained.
9. Use according to any one of claims 4 to 6, wherein the plant is a dicotyledonous plant, a monocotyledonous plant, a graminaceous plant, a cruciferous plant.
10. Use according to any one of claims 2 to 4, wherein the plant is cotton or Arabidopsis, preferably Asian, upland or Ramender cotton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010995662.2A CN112301046A (en) | 2020-09-21 | 2020-09-21 | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010995662.2A CN112301046A (en) | 2020-09-21 | 2020-09-21 | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112301046A true CN112301046A (en) | 2021-02-02 |
Family
ID=74488014
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010995662.2A Pending CN112301046A (en) | 2020-09-21 | 2020-09-21 | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112301046A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023275048A1 (en) * | 2021-06-30 | 2023-01-05 | Nunhems B.V. | Methods for selecting watermelon plants and plant parts comprising a modified dwarf14 gene |
| CN115918531A (en) * | 2022-10-12 | 2023-04-07 | 新疆农业大学 | Culture medium for improving quality of in vitro cultured cotton ovule fibers and culture method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102942623A (en) * | 2012-11-21 | 2013-02-27 | 中国科学院遗传与发育生物学研究所 | AtTAR2 protein and application of AtTAR2 protein coding genes to regulation of plant lateral root growth |
| WO2018060865A1 (en) * | 2016-09-27 | 2018-04-05 | King Abdullah University Of Science And Technology | New strigolactone analogs and their usage in plant control |
| CN110951775A (en) * | 2019-12-31 | 2020-04-03 | 福建农林大学 | Method for promoting tillering of rice |
-
2020
- 2020-09-21 CN CN202010995662.2A patent/CN112301046A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102942623A (en) * | 2012-11-21 | 2013-02-27 | 中国科学院遗传与发育生物学研究所 | AtTAR2 protein and application of AtTAR2 protein coding genes to regulation of plant lateral root growth |
| WO2018060865A1 (en) * | 2016-09-27 | 2018-04-05 | King Abdullah University Of Science And Technology | New strigolactone analogs and their usage in plant control |
| CN110951775A (en) * | 2019-12-31 | 2020-04-03 | 福建农林大学 | Method for promoting tillering of rice |
Non-Patent Citations (4)
| Title |
|---|
| GENBANK: "PREDICTED：Gossypium hirsutum probable esterase D14L (LOC107931627)，mRNA，Accession NO:XM_016863567.1", 《GENBANK》 * |
| PING WANG ET AL.: "Functional analysis of the GbDWARF14 gene associated with branching development in cotton", 《PEERJ》 * |
| YAO ET AL.: "Rice DWARF14 acts as an unconventional hormone receptor for strigolactone", 《JOURNAL OF EXPERIMENTAL BOTANY》 * |
| 刘虎等: "DWARFl4响应独角金内酯信号的分子机制", 《湖北农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023275048A1 (en) * | 2021-06-30 | 2023-01-05 | Nunhems B.V. | Methods for selecting watermelon plants and plant parts comprising a modified dwarf14 gene |
| CN115918531A (en) * | 2022-10-12 | 2023-04-07 | 新疆农业大学 | Culture medium for improving quality of in vitro cultured cotton ovule fibers and culture method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110066774B (en) | Corn receptor kinase gene ZmRLK7 and application thereof | |
| CN112301046A (en) | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof | |
| CN113462690B (en) | Application of soybean gene promoters pRPS28 and pRPS28-I in soybeans, arabidopsis thaliana and tobaccos | |
| CN113462689B (en) | Application of soybean gene promoters pEIF1 and pEIF1-I in soybeans, arabidopsis thaliana and tobaccos | |
| CN112522283B (en) | Pollen development related gene and application thereof | |
| KR101291365B1 (en) | Gene Implicated in Drought Stress Tolerance and Growth Accelerating and Transformed Plants with the Same | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CN115960189B (en) | Application of shinyleaf yellowhorn protein and encoding gene thereof in improving anthocyanin content in plant petals | |
| WO2023087761A1 (en) | APPLICATION OF SOYBEAN GIBBERELLIN 3β-HYDROXYLASE ENCODING GENE GMGA3OX1 | |
| CN114214333B (en) | Gene for regulating and controlling plant leaf epidermal hair development and secondary wall thickness and application thereof | |
| CN112430604B (en) | Gene engineering application of gene OsPIN10b | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| KR102265780B1 (en) | EFG1 gene for regulating flowering date of plantbody and uses thereof | |
| CN110904131B (en) | Cotton GhGlu19 gene and application thereof in improving cotton yield | |
| CN109266649B (en) | Inducible promoter CDM1 promoter responsive to salt stress | |
| KR101902915B1 (en) | OsPHS2 Gene enhancing pre―harvest sprouting tolerance derived from Oryza sativa and uses thereof | |
| CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance | |
| NL2030997B1 (en) | Zea mays receptor-like kinase 7 (zmrlk7) gene related to kernel and plant type development of maize and use thereof | |
| CN112251445B (en) | Gene GhZFP8 for regulating cotton fiber elongation and application thereof | |
| CN110272907B (en) | Gene SD1 for regulating and controlling stem development of tomato and application thereof | |
| CN116789785B (en) | High-yield and high-light-efficiency gene FarL a of long stamen wild rice and application thereof | |
| CN115976072B (en) | Histone deacetylase GhHDT3_A01 gene and application thereof, recombinant expression vector and recombinant expression method | |
| CN113308489B (en) | Creation method of novel salt-tolerant oat germplasm | |
| KR101820925B1 (en) | Root tissue-specific promoter | |
| CN118620914A (en) | Application of BjuARGOS-like gene in promotion of plant organ enlargement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |