KR101902915B1 - OsPHS2 Gene enhancing pre―harvest sprouting tolerance derived from Oryza sativa and uses thereof - Google Patents

Abstract

The present invention relates to rice (Oryza sativa)-derived Oryza sativa pre-harvest sprouting 1 (OsPHS2) gene which enhances premature sprouting resistance and use thereof. More specifically, the present invention relates to: a method for enhancing premature sprouting resistance of plant compared to a wild type, the method which comprises a step of over-expressing OsPHS2 gene by transforming a plant cell with a recombinant vector comprising rice-derived OsPHS2 gene; a method for preparing a transgenic plant with enhanced premature sprouting resistance compared to a wild type, the method which comprises a step of over-expressing OsPHS2 gene by transforming a plant cell with a recombinant vector comprising rice-derived OsPHS2 gene; transgenic plant, prepared by the method, and seeds thereof; a composition for enhancing premature sprouting resistance of a plant, the composition containing a recombinant vector comprising rice-derived OsPHS2 gene; and a method for enhancing the premature sprouting resistance of high quality rice, which has good taste when the same is cooked but has a very weak premature sprouting resistance. According to the present invention, a plant with a transformed rice-derived OsPHS2 gene has enhanced premature sprouting resistance compared to a wild type of the plant. When the plant having transformed rice-derived OsPHS2 gene is used, the plant with a transformed rice-derived OsPHS2 gene can be used to develop the plant, capable of growing to be strong even in an unfavorable environment with increased danger of damage from premature sprouting caused by abnormal weather, and is effective for an increase of crop yield. The plant with the transformed rice-derived OsPHS2 gene can be usefully applied to implement a platform for developing crop resistance to environmental stress.

Description

Rice-derived OsPHS2 gene and its use for enhancing resistance to athlete's disease (OsPHS2 Gene enhancing pre-harvest sprouting tolerance derived from Oryza sativa and uses thereof)

The present invention relates to a gene for OsPHS2 ( Oryza sativa pre-harvest sprouting 2) gene derived from rice ( Oryza sativa ) promoting aberration resistance, and more particularly to a recombinant vector comprising OsPHS2 gene derived from rice, It was transformed in the method for enhancing the subalah resistance of a plant relative to wild type, comprising overexpressing OsPHS2 gene, was transformed with a recombinant vector comprising a OsPHS2 gene in rice derived from a plant cell comprising the step of overexpressing OsPHS2 gene A method for producing a transgenic plant having increased resistance to athrax compared to a wild type, a transgenic plant produced by the above method and a seed thereof, and a composition for enhancing the resistance to athletic resistance of a plant containing a recombinant vector comprising rice-derived OsPHS2 gene .

Rice, which is the stock of half of all humanity, is the most important food crop in the world. Numerous rice cultivars have been developed as a method of breeding to enhance agricultural characteristics such as increased seed production, good seed production and post-harvest stability after the 20th century (Khush, Plant Mol Biol . , ≪ / RTI > 35: 25-34,1997; Kovach et al ., Trends Genet. , ≪ / RTI > 23: 578-587, 2007). Seed dormancy is a physiological trait that inhibits seed germination under appropriate environmental conditions such as moisture, light, and temperature (Bewley, Plant Cell , 9: 1055-1066, 1997). In general, the dormancy that normally occurs during the development of the seed is maintained for a certain period in the ripened seed, and the dormancy is overcome over time. Seed dormancy is a basic trait necessary for the survival of plants, for example, dormant seeds have the opportunity to spread to a more distant region without germination and are not germinated under adverse environmental conditions, resulting in extreme environmental stress conditions You can also wait until you are in a good environment while maintaining your life.

If the seeds are not dormant or very weak, if the rain is high and the water is constantly high, germination will occur with immature seeds on the ears before harvest. This phenomenon is referred to as pre-harvest sprouting (PHS) (Bewley and Black, Seeds , 1994; Finkelstein et al ., Ann Rev Plant Biol . , 59: 387-415, 2008). Therefore, seed dormancy at harvest time is an important agricultural trait in major crops such as rice, wheat, and corn, and economic losses are serious due to a decrease in grain production and grains quality worldwide. On the other hand, if seed dormancy is too high, germination can not be maintained uniformly on the cultivated land. Therefore, appropriate level of dormancy is an important agricultural characteristic for the development of new varieties.

Generally, the seed dormancy of wild rice is strong, whereas the Japonica type rice cultivars developed by breeding for a long time have weakened dormancy easily for farming, and the degree of dormancy of seeds is very different among developed rice cultivars. In the process of seed development, embryo differentiation is completed within about one week after heading, and about 25 days after embryo maturation is completed, dormancy is obtained. This is called primary dormancy. The primary dormancy of seeds is a genetically complex feature that is influenced by numerous internal and environmental factors (Li and Foley, Trends Plant Sci. , 2: 384-389, 1997). When the seeds mature, the dormancy gradually disappears or is destroyed by cold or other environmental stimuli. It has been reported that rice varieties developed in Korea have a short duration of dormancy (Suh and Kim, J Crop Sci . , 39, 187-192, 1994. Park and Kim, J Crop Sci . , 54: 241-248, 2009). For example, high-grade rice has been developed as an excellent varietal (Korean Journal of Crop Science 2005. 6: 18-28: Sun et al. PLoS One. 2011.6 (4): e18385) It has weak drawbacks.

ABC (abscisic acid), a plant hormone, is known to be an important regulator involved in the process of acquiring and maintaining seed dormancy (Gubler et al ., Curr Op in Plant Biol . , 8: 183-187, 2005; Kermode, J Plant Growth Regulation. , 24: 319-344, 2005). ABA biosynthesis and ABA reactivity are factors affecting the seed dormancy of major crops such as rice and maize. The dormancy of rice seeds is influenced not only by ABA but also by various conditions such as the environmental conditions of seed maturity, postharvest seed storage temperature, moisture content, oxygen, nitrogen and carbon dioxide (Roberts, J Exp Botany , 13: 75-94, 1962 ; Ikehashi, Jap J Breeding , 22: 209-216, 1972). In addition, the dormancy of rice seeds is known to be influenced by the chemical properties of the seed coat and the physical properties of the seed coat (Bewley and Black, Seeds , 1994). Although the dormancy of seeds is known to be regulated by a variety of genes, little is known about the genetic origin of seed dormancy. In addition, a number of genes known to increase seed dormancy are known to exhibit a tendency to inhibit germination of mature seeds (Nonagaki 2017).

Under these circumstances, the present inventors have made intensive efforts to develop seeds or crops that can be adapted even in a poor environment where the risk of aberrations has increased due to an abnormal climate. As a result, the present inventors have found that, The OsPHS2 gene derived from the rice that improves the expression of the OsPHS2 gene was identified and a plant transformed with the recombinant vector containing the same was prepared and the aeti resistance of the transformed plant or the seed obtained therefrom was enhanced in comparison with the wild type plant or seed Thereby confirming the completion of the present invention. In particular, the present invention can be used to improve the resistance of rice varieties having high quality, such as high quality rice, but with weak resistance to rice paddy.

Khush, Plant Mol Biol., 35: 25-34, 1997 Kovach et al., Trends Genet., 23: 578-587, 2007 Bewley, Plant Cell, 9: 1055-1066, 1997 Finkelstein et al., Ann Rev Plant Biol., 59: 387-415, 2008 Li and Foley, Trends Plant Sci., 2: 384-389, 1997 Suh and Kim, Korean J Crop Sci., 39, 187-192, 1994 Park and Kim, Korean J Crop Sci., 54: 241-248, 2009 Gubler et al., Curr Op in Plant Biol., 8: 183-187, 2005 Kermode, J Plant Growth Regulation., 24: 319-344, 2005 Roberts, J Exp Botany, 13: 75-94, 1962 Ikehashi, Jap J Breeding, 22: 209-216, 1972 Nonagaki, Front Plant Sci. 8:90, 2017 Choi LIM, et al., Crop Science Research Bulletin 6: 18-28, 2005 Sun et al., PLoS One. 6 (4): e18385, 2011 Bahtnahga et al., Plant Mol Biol. 93: 389, 2017

It is an object of the present invention to provide a recombinant vector for promoting the resistance to the avalanche of plants compared to the wild type, including OsPHS2 ( Oryza sativa pre-harvest sprouting 1) gene derived from rice ( Oryza sativa ) And to provide a transformant transformed with said vector.

It is another object of the present invention to provide a method for enhancing the resistance of a plant to avalanche compared to a wild type comprising the step of overexpressing the OsPHS2 gene by transforming the recombinant vector into a plant cell, A method for producing the same, a transgenic plant improved in resistance to athlete's foot produced by the method, and seeds thereof.

It is still another object of the present invention to provide a composition for enhancing aberration resistance of a plant containing a recombinant vector comprising OsPHS2 gene derived from rice.

As one embodiment for achieving the above object, the present invention provides a recombinant vector for transfection comprising a gene represented by SEQ. ID.

The term " pre-harvest sprouting (PHS) " in the present invention refers to a phenomenon in which the seeds reaching the physiological maturity germinate with the seeds before harvest in wet conditions caused by rainfall, It is known to be associated with seed dormancy.

The term " seed dormancy " in the present invention refers to a phenomenon in which germination does not occur for a certain period of time even if germination conditions suitable for mature seeds are given. If the seed is not dormant or very weak, Early immature seeds will cause germination with germination on the ears.

"OsPHS2 (Oryza sativa pre-harvest sprouting 2)" of a gene as shown in SEQ ID NO: 1 in the present invention is rice (Oryza sativa) as derived from the gene, chromosome 1 times the current Os01g20030 gene function is unknown up in the (chromosome 1) to be.

In one embodiment of the present invention, the rice-derived OsPHS2 gene selected as the causative agent gene of the present invention has been confirmed to be seed-specific and the OsPHS2 gene function unknown to date is closely related to the seed (Fig. 2). In addition, it was confirmed that the overexpression of the OsPHS2 gene promoted the resistance to seedling of rice seeds (FIGS. 7 and 8).

The term " wild type " in the present invention means a control group for transgenic plants containing the rice-derived OsPHS2 gene of the present invention. Specifically, the plant is rice or Arabidopsis, and rice includes all varieties of rice known in the art. More specifically, the rice plant may be Dongjin rice, but is not limited thereto.

The term " plant " of the present invention is intended to include a plant type, a whole plant, part of a plant, seed or plant cell.

The term " pre-harvest sprouting tolerance " in the present invention means that seedling before harvesting does not germinate while attached to the ears. Even if the ears reaching the physiological maturity are subjected to wet conditions caused by rainfall, This means the resistance of the plant to inhibit the germination of the seed for a certain period due to increased seed dormancy.

In one embodiment of the present invention, when the OsPHS2 gene is overexpressed, it has little effect on the germination of the mature seed, and it has been confirmed that the mating resistance in the seed of the ripening stage is greatly improved.

The term " recombinant " as used herein refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a polypeptide encoded by a peptide, heterologous peptide or heterologous nucleic acid. Recombinant cells can express genes or gene segments that are not found in the wild-type form of the cells, either in sense or antisense form. In addition, recombinant cells can express genes found in wild-type cells, but these genes have been modified and reintroduced intracellularly by artificial means.

In the present invention, the OsPHS2 gene sequence can be inserted into a recombinant vector. The term " vector " of the present invention is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The recombinant vector means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell viral vector, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors containing the respective sequences of the OsPHS2 gene and appropriate transcription / translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a so-called T-region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

In the recombinant expression vector of the present invention, the promoter may be, but is not limited to, the CaMV 35S promoter, the actin promoter, the ubiquitin promoter, the pEMU promoter, the MAS promoter, the histone promoter or the Clp promoter, . The term " promoter " of the present invention means a region above the DNA from the structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A " plant promoter " is a promoter capable of initiating transcription in plant cells. A " constitutive promoter " is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. In the present invention, the use of a constant promoter may be desirable. Therefore, the constant promoter does not limit the selectivity.

In the recombinant vector of the present invention, a conventional terminator can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, Agrobacterium tumefaciens Octopine gene A phaseoline terminator of Escherichia coli, and an rrnB1 / B2 terminator of Escherichia coli, but the present invention is not limited thereto. Regarding the need for a terminator, it is generally known that the terminator region increases the certainty and efficiency of gene transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The recombinant vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, hygromycin, chloramphenicol, G418, Bleomycin, Resistant gene, aadA gene, and the like, but are not limited thereto.

In another embodiment, the present invention provides a transgenic plant having enhanced avalanche resistance transformed with a recombinant vector containing OsPHS2 ( Oryza sativa pre-harvest sprouting 2) gene of the present invention.

The term " transformation " in the present invention means genetically changing the traits of an individual or a cell by DNA, which is a genetic material given from the outside. In the present invention, the rice ( Oryza sativa ( Oryza sativa pre-harvest sprouting 2) gene derived from OsPHS2 .

Transformation with the recombinant expression vector of the present invention in the present invention can be carried out by a transformation technique known to a person skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion PEG-mediated fusion, microinjection, liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, Agrobacterium sp. mediated method, and the like, but the present invention is not limited thereto.

The term " transformant " in the present invention means a host cell transformed with a recombinant expression vector containing OsPHS2 ( Oryza sativa pre-harvest sprouting 2) gene derived from rice, which promotes the resistance to sprouting of the present invention.

The transformant is preferably a microorganism, including, but not limited to Escherichia coli), Bacillus subtilis (Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Proteus Mira Billy's (Proteus may be mirabilis), Staphylococcus (Staphylococcus) and Agrobacterium Tome Pacific Enschede (Agrobacterium tumefaciens) may be, more preferably Agrobacterium Tome Pacific Enschede (Agrobacterium tumefaciens).

In yet another aspect, the present invention overexpressing OsPHS2 gene by transforming a recombinant vector containing the rice (Oryza sativa) OsPHS2 (Oryza sativa pre-harvest sprouting 2) derived from the gene shown in SEQ ID NO: 1 into a plant cell Wherein the method comprises the steps of:

The method of transforming the plant cell is as described above.

In the method according to an embodiment of the present invention, the OsPHS2 gene may be a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . &Quot;% of sequence homology to polynucleotides " is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In another embodiment, the present invention relates to a method for promoting the resistance to pandemic of the wild type comprising the step of overexpressing the OsPHS2 gene by transforming a plant cell with a recombinant vector comprising OsPHS2 gene derived from rice, A method for producing a transgenic plant is provided.

The method of transforming the plant cell is as described above. Further, the method of the present invention includes a step of regenerating the transformed plant from the transformed plant cell. Regeneration of transgenic plants can be carried out by any method known in the art. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989, Momillan, N. Y.).

In the method according to one embodiment of the present invention, the OsPHS2 gene may be a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In another aspect, the present invention provides transgenic plants and seeds thereof produced by the above method with enhanced avalanche resistance.

The plant may be a monocot plant or plant ssangjayeop, preferably rice (Oryza sativa) plants or Arabidopsis (Arabidopsis thaliana , but are not limited thereto. More specifically, the rice varieties may be high grade rice.

In yet another embodiment, the present invention provides a composition for promoting aberration resistance of a plant containing a recombinant vector comprising a rice-derived OsPHS2 gene comprising the nucleotide sequence of SEQ ID NO: 1. The above composition is capable of enhancing the resistance to aberration of a plant by transforming a plant with a recombinant vector comprising the OsPHS2 gene consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient.

According to the present invention, plants transformed with rice-derived OsPHS2 gene are more resistant to pandemic resistance than wild-type plants. Therefore, when used, it can be used to develop plants that can grow strongly even in a poor environment where the risk of pandemics is increased due to abnormal weather, And it can be useful for constructing environmental stress tolerance crop development platform.

FIG. 1 is a diagram showing a seed expression gene OsPHS2 selection using transcript analysis according to the seed development stage: (A) analysis of various gene expression rates according to seed development stage of high quality rice, (B) seed development stage, (C) selection Expression rate of OsPHS2 gene according to seed initiation stage.
FIG. 2 is a diagram showing the results of analysis of the expression pattern of the OsPHS2 gene, which is a gene related to the resistance to aphrodisiac, in a public database (public DB).
FIG. 3 is OsPHS2 Is a schematic diagram of a plant overexpression vector into which a gene has been introduced.
4 is OsPHS2 In transgenic rice plants where the genes are differentiated The degree of expression of OsPHS2 was confirmed by RT-PCR.
FIG. 5 shows the expression of OsPHS2 protein in the nucleus by transient expression in rice protoplasts in order to confirm the intracellular expression pattern of OsPHS2 protein.
Figure 6 shows the results of applying yeast GAL4 system to determine whether the OsPHS2 protein is a transcriptional promoting factor. As a result, it was confirmed that the protein did not function as a transcriptional promoting factor.
FIG. 7 shows the germination rate of the seeds of transgenic rice plants that overexpress OsPHS2 gene in the control (high rice) and OsPHS2 gene: (A) Photographs of germination of high grade rice and OsPHS2 overexpressed rice 36 days after emergence , (B) Comparative analysis of germination rate of high - quality rice and OsPHS2 overexpressing seeds.
8 is a comparison of the germination rates of mature seeds of high- grade rice with OsPHS2 overexpressing high- grade rice.

Hereinafter, the constitution and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  One: OsPHS2  Gene selection

The seeds were harvested from high-quality rice at 3-6 days and 25 -40 days after heading, respectively (Fig. 1 (A)) and total RNA was isolated. To analyze the changes in gene expression pattern according to seed development stage, cRNA was prepared from total RNA using Low RNA Input Linear Amplification Kit PLUS (Agilent Technology, Santa Clara, CA, USA) and analyzed with Agilent Rice 44K Oligo Microarray Hybridization reaction was carried out. Microarray data were analyzed using GeneSpring GX 7.3 (Agilent Technology), and a group of genes (group I) showing an increase in gene expression with seed maturation was selected (FIG. 1 (B)). In the case of cultivated rice, the seed dormancy is started to decay by the genetic and environmental factors in the ripening period (25 DAH ~ 40 DAH) An increased gene (LOC_Os01g20030) expressing a seed specific expression pattern was selected and named as " OsPHS2 " while the expression was increased more than 2 times. The corresponding sequence is shown in SEQ ID NO: 1. As shown in FIG. 2, the expression pattern of the OsPHS2 gene in the rice tissue was examined through a search of a public database (RiceXPro http://ricexpro.dna.affrc.go.jp/). As a result, the OsPHS2 gene The gene expression was high in the seeds.

Example  2: for plant transformation OsPHS2  Over-expression vector and transformation High-quality rice  making

In the case of the seedling-specific expression pattern of OsPHS2 ( Oryza sativa pre-harvest sprouting 2), which is expressed in the seedling-specific expression pattern of the seedling dormant of high-quality rice, Transgenic rice plants were constructed by constructing transgenic vectors to produce transgenic plants and inserting the vectors into high quality rice plants.

Example  2-1: For plant transformation OsPHS2  Overexpression vector production

OsPHS2 gene was isolated for overexpression of OsPHS2 gene from rice. OsPHS2 through public database information The evaluator has confirmed that the gene has no introns, specific primer sets OsPHS2 gene of the genomic DNA as a substrate dongjinbyeo (OsPHS2 -1F: GGACTCTAGAGGATCCATGCCGGCGTCGTACCTGCAG (SEQ ID NO: 2) OsPHS2 -738R: CGGTACCCGGGGATCCCTAGAGGCCCCGCCGGCCGCCGTTG (SEQ ID NO: 3)) of the gene by using the ORF OsPHS2 (open reading frame) was amplified by PCR. After confirming the base sequence of the amplified OsPHS2 gene, the OsPHS2 gene was inserted into the pCAMBIA1300 sequence vector, which is a rice transformation vector, as shown in Fig. 3, to construct a pCAMBIA1300- OsPHS2 overexpression vector.

Specifically, making the OsPHS2 over-expression vector The PCR amplification product of OsPHS2 gene was cut with BamH I restriction enzyme OsPHS2 gene in plants by connecting OsPHS2 gene in CaMV35S promoter (35SP) of the downstream BamH Ⅰ restriction site is to always express Hygromycin resistance gene was used as an antibiotic resistance marker.

Example  2-2: Construction and Analysis of Rice Transformants Using Agrobacterium

To the Cal Ruth (callus) derived from the seeds of the development at RDA selected to the list of countries listed gopum rice varieties (Suwon No. 479) and inoculated with Agrobacterium (Agrobacterium) containing the vector pCAMBIA1300- OsPHS2, 30 ㎍ / Ml of hygromycin, and the stem and root were induced to produce transgenic rice.

Thereafter, RNAs were isolated from wild-type (WT) high- grade rice of the control group and transgenic rice leaves prepared to overexpress the OsPHS2 gene, and cDNA was prepared using the RNA as a template. The OsPHS2 gene specific RT-PCR was performed using a primer set ( OsPHS2 -45F: 5'-GCGTATTATGGAGCACGGCG 3 '(SEQ ID NO: 4); OsPHS2 -229R: 5'-CCTTGCGCTCGTAGTACTCC3' (SEQ ID NO: 5)).

RT-PCR was performed to determine the expression level of OsPHS2 gene in transgenic rice plants transfected with OsPHS2 gene. As shown in FIG. 4, OsPHS2 transgenic rice transgenic plants were wild type (wild type, WT), the OsPHS2 gene, which is a gene related to the resistance to pheasants, was strongly expressed.

Example  3: OsPHS2  Expression of protein Location and  Promotional activity assay

OsPHS2 In order to investigate the molecular biological properties of proteins, we first examined the intracellular expression of proteins. For this purpose, the OsPHS2 gene was introduced into the Xba I restriction site of the plant expression vector (pCAMBIA1300smGFP) containing the GFP fluorescent protein gene, and the OsPHS2 - GFP A fusion vector was prepared. The protoplasts were isolated from the stem sections of the rice seedlings cultured on the arm culture using the method of Bahtnahga et al. (Plant Mol Biol. 2017. 93: 389), and then the fusion vector was introduced and cultured for 24 hours. The location was observed with a confocal microscope (Leica TCS SP8). As a result, it was confirmed that the OsPHS2-GFP protein was located in the nucleus (Fig. 5).

In addition, we confirmed that the OsPHS2 protein was expressed in the nucleus, and therefore, the possibility of acting as a transcription promoting factor was examined using yeast GAL4 system. A fusion plasmid in which the ORF of the OsPHS2 gene was inserted into the pBDGAL4 (Stratagene) vector was prepared and introduced into yeast strains (AH109, Clontech). The transfected beta-galactosidase enzyme activity was analyzed by culturing the introduced strain in an SD-T medium containing X-α-GAL. From the results, it was found that OsPHS2 binds to the GAL4 DNA binding site to increase reporter gene expression (Fig. 6). Thus, the OsPHS2 protein has no transcriptional promoting activity but has proved to be a protein that acts on the nucleus.

Example  4: OsPHS2  Resistance analysis of overexpressed transgenic rice

Example  4-1: OsPHS2  Overgrown transgenic rice seeds Avalanche resistance  analysis

High-quality rice is a rice variety with very weak resistance to water. The OsPHS2 gene isolated in Example 2-1 was used to investigate whether or not the resistance to aphids of high quality rice could be improved. For this purpose, a high-quality rice transgenic plant overexpressing the OsPHS2 gene prepared in Example 2-2 was cultivated in a package, seeds were harvested from about 35 to 40 days after heading, seeds were removed from the seeds, The seed germination rate was measured at 100% relative humidity, 30 degree, and dark condition for 5 days. As a result, it was confirmed that the immature seeds of wild-type high-quality rice germinated more than 50% on the second day under proper germination conditions, while the immature seeds of OsPHS2 transformants were 10% or less, A) and 7 (B)). Thus, overexpression of the OsPHS2 gene has been shown to improve the resistance of the high - quality rice, which is a problem in the ripening stage.

Example  4-2 OsPHS2  Overexpressed transgenic rice seed mature Germination  analysis

It has been known that many genes that increase the dormancy of seeds show hyperdormancy of germination of mature seeds (Nonogaki 2017), so we investigated whether these transgenic rice plants overexpressing OsPHS2 gene had such a problem. The germination rate of 5-day-old seedlings grown in high-paddy rice, over-expressing OsPHS2 gene, at 100% relative humidity, 30 degree, and darkness, (Fig. 8). Therefore, the germination of the mature gene OsPHS2 gopum introduced rice seed has confirmed that the resistance of the grain filling stage subalah without significantly enhancing effect.

TL: T-DNA left border
35ST: cauliflower mosaic virus (CaMV) 35S terminator
35SP: cauliflower mosaic virus (CaMV) 35S promotor
NOS: nopaline synthase
PHS2 CDS: Oryza sativa pre-harvest sprouting 1 gene coding sequence
TR: T-DNA right border

<110> Republic of Korea <120> OsPHS2 Gene enhancing pre harvest sprouting tolerance derived          from Oryza sativa and its <130> P17R12C0967 <160> 5 <170> KoPatentin 3.0 <210> 1 <211> 738 <212> DNA <213> Oryza sativa <400> 1 atgccggcgt cgtacctgca gccgcgccgc gggacgaacg ggcggcgtat tatggagcac 60 ggcgcgggcg aggagatggt ggcgttctac gaggcgtggg tggggcgcga ggagcggatc 120 gtcgcggacc tcacggacgc gctcctcccg gcgcggcggc ggcgggacgt gctcgccccg 180 ctcgtggacg ccgcggtggg ccacgtgtcg gagtactacg agcgcaaggc ccgcctcgcc 240 gaccgcgacg tggtggcggc gctggacccg cgctggctca acccgctcga gcgcaccttc 300 ctctgggcgt ggggctggaa gcccgcgctg gtgttccgct tcgcggacgg cgccgtcgcc 360 ggcggctcgt cgcaccagca gcagcgccgc gcgctggagc gcgtgcgcgc cgccaccgcg 420 gaggccgagc gggaggtgga ccgggaggtg gcggtcgtgc aggagtcgct cgccggaccc 480 cgcgtgctgg cggcgctgcg gaggcagcac ccgcggaacg gcgaggccga cgaggccgtc 540 gccgcggtcg ggcgctcgct ccgcgtgctg ctcgccgcgg ccgacgcgct ccgcgagcgc 600 acggtgcggg acgtcgtcgg gacgctcgcg ccagaccagg ccggcgcgtt cctcgcggcc 660 atgctgaggt tccacctcgg cgtgcaccgc gccggccgca actggggctc cggcaacggc 720 ggccggcggg gcctctag 738 <210> 2 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> OsPHS2-1F <400> 2 ggactctaga ggatccatgc cggcgtcgta cctgcag 37 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> OsPHS2-738R <400> 3 cggtacccgg ggatccctag aggccccgcc ggccgccgtt g 41 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsPHS2-45F <400> 4 gcgtattatg gagcacggcg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsPHS2-229R <400> 5 ccttgcgctc gtagtactcc 20

Claims (9)

1. A recombinant vector for transformation comprising a gene represented by SEQ. ID.
A transgenic plant having enhanced avalanche resistance transformed with the recombinant vector for transformation of claim 1.
1. A method for enhancing the resistance to aberration of a plant, comprising the step of transfecting a plant cell with a recombinant vector comprising the gene represented by SEQ ID NO: 1 to overexpress the gene represented by SEQ ID NO: 1.
1. A method for producing a transgenic plant having enhanced avalanche resistance, comprising the step of transfecting a plant cell with a recombinant vector comprising the gene of SEQ ID NO: 1 to overexpress the gene of SEQ ID NO: 1.
3. The transgenic plant according to claim 2, wherein the plant is a terminal leaf or a twin leaf plant.
6. The transgenic plant according to claim 5, wherein the monocotyledonous plant is rice ( Oryza sativa ) and the dicotyledonous plant is Arabidopsis thaliana .
The transgenic plant according to claim 6, wherein the rice varieties are high-quality rice.
A transformed seed of a plant according to claim 2.
1. A composition for promoting aberration resistance of a plant containing a recombinant vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Images