CN110951775A - Method for promoting tillering of rice - Google Patents
Method for promoting tillering of rice Download PDFInfo
- Publication number
- CN110951775A CN110951775A CN201911416464.XA CN201911416464A CN110951775A CN 110951775 A CN110951775 A CN 110951775A CN 201911416464 A CN201911416464 A CN 201911416464A CN 110951775 A CN110951775 A CN 110951775A
- Authority
- CN
- China
- Prior art keywords
- rice
- tillering
- gene
- promoting
- osvha
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for promoting rice tillering, and belongs to the technical field of plant genetic engineering. According to the method, the OsVHA-A gene is expressed in rice in a silent mode, and the elongation of rice tillering buds is promoted in the rice tillering bud forming period; in the mature period of rice, the tillering number of rice is increased remarkably, a new way is provided for breeding new varieties of high-yield rice, in addition, a new gene resource and a recombinant plasmid preparation method are provided, and the method has important significance for increasing the yield and income of rice.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to a method for promoting rice tillering.
Background
The number of tillers, the number of grains per ear and the grain weight are three factors that determine the yield of rice. Tillering is a special Branching mode formed during the growth and development of rice, which directly determines the number of rice ears and the yield of rice, and the tillering process of rice is divided into two stages, i.e. tillering bud formation and tillering bud elongation, and the initiation and elongation of tillering buds are mainly regulated and controlled through a Plant hormone signaling pathway (Rameau C, Berthoot J, Leduc N, et al (2013) Multiple pathways regulated hybrid Plant Sci 5: 741; Brett J. Ferguson and Christine A.Bergenidge, (2009) rounds for Autoxin, Cykinin, and strigol in Regulation shoot, Plant Physiology 149: 1929-. Previous studies have shown that CTK promotes rice tillering, while IAA and SLs inhibit rice tillering (Leyser O (2009) The control of shoot transformation: an example of Plant information processing. Plant Cell Environ 32: 694-. Auxin can increase The content of SLs by promoting The expression of MAX3 and MAX4 genes (Hayward A, Stirnberg P, Beveridge CA, et al (2009) Interactions between auxin and strigolactone in shoot branched control. Plant Physiol 151: 400. sup. 412), and can inhibit The synthesis of CTK at nodules by regulating The expression of OsIPT genes (Liu Y, Gu DD, Ding YF, et al (2011) The relative gene between auxin and auxin The growth regulation of rice (Oryza sativa L.) filler blocks. Aust J Crop Sci 5(8): 1019. sup. 1026), and finally achieves The effect of inhibiting tillers. SLs are mainly synthesized in the roots of plants and transported up to the site of tillering buds to inhibit the elongation of tillering buds, which requires a long-distance signal transduction process to function (Kohlen W, Charnikhova T, Liu Q, et al (2011) strain isolated from the xylem and Plant a key roll in shootashire structural response to phosphate modification in nonarbulated mycortizal Arabidopsis. Plant Physiol 155: 974. 987). Known studies have demonstrated that DWARF27, DWARF17, DWARF10, and OsMAX1 are involved in SLs synthesis (Rishu, Gaohui, Cuvitta et al (2015) study progress of strigolactone in regulation of rice tillering, plant bulletin 50: 539-. DWARF53 is the main target of SLs downstream signal, it can bind with DWARF3 and DWARF14, and restrain SLs signal (Jiang L, Liu X, Xiong G, et al (2013) DWARF53 acts as a decompressor of strigolactone signalling in rice 504: 401 and 405). OsTB1/FC1 is a downstream response factor of SLs, the expression of which is inhibited by DWARF53, and can also interact with OsMADS57 to feedback regulate the expression of DWARF14 (Zhou F, Lin Q, Zhu L, et al (2013) D14-SCF (D3) -dependent irradiation of D53 ligands strain signalling. Nature 504: 406-. Like SLs, CTK is also a direct factor regulating the growth of lateral buds of plants, and it is synthesized mainly at the root or aerial parts and transported to the lateral buds to regulate their growth. CTK can regulate the growth of rice tillering buds by regulating the expression of genes such as OsTB1 in the tillering buds (Liuyang, Gudandan, xujunxu, etc. (2012) cytokinin regulates the growth of rice tillering buds and the expression of genes related to tillering, Chinese agricultural science 45: 44-51).
Monoculum1（MOC1) Is the first gene identified to regulate rice tillering, which encodes a plant-specific GRAS transcription factor that controls the initiation and growth of tillering shoots and is the major factor in rice tillering (Li XY, QianQ, Fu ZM, et al (2003) Control of tillering in rice, Nature 422: 618-. LAX1 (LAX panicle) in rice is another transcription factor identified to regulate tillering, which controls the activation of axillary meristems (Komatsu K, Maekawa M, Ujiie S, et al (2003) LAX and SPA: Majorreregulators of shoot braching in rice, Proc Natl Acad Sci U.S. A. 100: 11765-.OsTB1（Teosinte branched 1) Encodes a potential transcription factor with a basic helix-loop-helix DNA binding domain (Takeda T, Suwa Y, Suzuki M, et al (2003) The OsTB1 genetic transformation regulation in Plant J33: 513-520). Functional analysis of the TB1 homolog in Arabidopsis BRC1/TBL1 showed that TB1 might function downstream of auxin and SLs signaling (Aguilar-Martinez JA, Poza-Carion C, Cubas P (2007) Arabidopsis BRANCHED1acts an integration of BRANCHED signalings in Plant Cell19: 458; (Finlayson SA)(2007) Arabidopsis goose Branched1-like 1 ligands a canalary bud outlet and is homologus to monocot goose Branched1. Plant Cell Physiol 48: 667-and 677). Transgenic Plant analysis of OsTB1 showed that rice tillers increased after RNAi for OsTB1, whereas over-expressed plants were reversed, suggesting that OsTB1 may be a negative regulator of tillering (Choi MS, Woo MO, Koh EB, et al (2012) toastine Branched1 modular tillering in rice plants. Plant Cell Rep 31: 57-65). OsTB1 may be combined with another transcription factor OsMADS57 to regulate The gene expression of downstream D14 (Dwarf 14) so as to control The outward growth of tillering buds (GuoSY, Xu YY, Liu HH, et al (2013) The interaction between OsMADS57 and OsTB1 models tilling virus DWARF14. Nature Commun 4: 1566).
The regulation and control of rice tillering is a very complex process, although some progress is made on the research of molecular mechanism related to the regulation and control of rice tillering, a plurality of genes for directly or indirectly regulating and controlling rice tillering are still to be discovered and researched, and the genetic improvement of rice plant type also urgently needs more gene resources
The invention aims to provide a method for promoting rice tillering. In order to achieve the purpose, the invention adopts the following technical scheme:
a method for promoting tillering of rice comprisesOsVHAThe gene is expressed in rice plant in silence.
A method for promoting tillering of rice,OsVHAthe gene recombinant plasmid transforms rice to promote the growth of tillering bud of transgenic rice plant.
A method for promoting tillering of rice and its carrierOsVHAThe agrobacterium of the gene recombinant plasmid transforms rice to promote the tillering number of transgenic rice plants to increase.
A method for promoting tillering of rice,OsVHAthe gene is expressed in rice plants in a silent mode, so that the tillering number of the transgenic rice plants is increased, and the rice yield is increased.
As described aboveOsVHAThe gene is obtained by cloning from rice, and the cloning method comprises the following steps: extracting total RNA from rice leaf, reverse transcribing total RNA to synthesize the firstStrand cDNA, first strand cDNA as template, primer VHAF: 5'-ATCGAGCGAGAGAGCCGTCT-3' and VHAR: 5'-GATGTTCAAGTAGATGGTCATCGT-3' is a primer obtained by amplificationOsVHAA gene.
As described aboveOsVHAThe construction of the gene recombinant plasmid is disclosed in patent with application number 201110105497. X.
The recombinant plasmid of the invention is transformed into rice to obtain rice transgenic plants. Experiments show that: the transgenic rice plant can promote the elongation of rice tillering buds and the increase of tillering number. Therefore, the gene and the eukaryotic recombinant plasmid can be applied to tillering development and yield improvement of rice.
The invention has the following beneficial effects:
the OsVHA-A gene is silenced and expressed in rice, so that the elongation of tillering buds of the rice and the increase of tillering number of the rice are promoted, the rice yield is improved, a new way is provided for breeding new high-yield rice varieties, a new gene resource and a preparation method of recombinant plasmid are provided, and the method has important significance for increasing the yield and income of the rice.
Drawings
FIG. 1 is a tillering bud phenotype diagram of a transgenic line. WT represents wild type rice Nipponbare; v-5 represents a transgenic rice line.
FIG. 2 is a phenotypic picture of increased tillering of transgenic rice, WT representing wild type rice Nipponbare; v-5 represents a transgenic rice line.
FIG. 3 statistical histogram of tillers. WT represents wild type rice Nipponbare; v-5 represents a transgenic rice line.
Detailed Description
In order to make the present invention more comprehensible, the technical solutions of the present invention are further described below with reference to specific embodiments, but the following examples are only examples of the present invention and do not represent the scope of the present invention defined by the claims.
In the following examples, where specific experimental conditions are not indicated, the molecular cloning is carried out according to conventional conditions well known to those skilled in the art, for example Sambrook, Russell: the conditions described in the Laboratory Manual (New York: Cold spring harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.
Example 1: cloning of OsVHA Gene
Cloning of the OsVHA gene refers to application nos.: 201110105497. X.
Rice leaves are taken as materials to extract rice RNA, and the rice RNA is synthesized into rice cDNA through reverse transcription; taking rice cDNA as a template and a primer VHAF: 5'-ATCGAGCGAGAGAGCCGTCT-3'; and (3) taking VHAR (very high-frequency amplification) 5'-GATGTTCAAGTAGATGGTCATCGT-3' as a primer, and carrying out PCR amplification to obtain the rice OsVHA gene.
Example 2: construction of eukaryotic recombinant plasmids
Construction of eukaryotic recombinant plasmids reference application No.: 201110105497.X, the specific steps of patent example 2 construct and obtain eukaryotic recombinant plasmids carrying rice OsVHA genes.
Example 3: obtaining of transgenic Rice
The transgenic rice was obtained according to application No.: 201110105497. X. The eukaryotic recombinant plasmid carrying the rice OsVHA gene constructed in the example 2 is transformed into a wild rice variety Nipponbare by an agrobacterium transformation method, and 3 transgenic rice lines, namely OsV-5, OsV-11 and OsV-18 are obtained through resistance screening of callus, subculture of the resistant callus and plant regeneration.
Example 4 phenotypic analysis of transgenic plants
1. Quantitative detection of transgenic rice line
1.1 extraction of RNA
RNA extraction kits were purchased from Beijing Tiangen biology, Inc., and RNA extraction procedures were performed on wild-type and transgenic rice (OsV-5, OsV-11, OsV-18) according to manufacturer's recommended procedures.
1) Rapidly grinding 100mg rice leaves in liquid nitrogen to powder, adding 450. mu.L RL (β -mercaptoethanol is added before use), vortexing and shaking uniformly, incubating at 56 ℃ for 1-3 min to crack rice tissues, 2) transferring all solutions to a filtration column CS, centrifuging at 12000rpm for 5min, carefully absorbing supernatant in a collection tube into a centrifuge tube of RNase-free, washing the tube to avoid contact with cell debris precipitates in the collection tube, 3) slowly adding 0.5 times of volume of absolute ethyl alcohol, mixing uniformly, transferring the obtained solution and precipitates into an adsorption column CR3, centrifuging at 12000rpm for 60s, discarding the collection solution, placing adsorption column CS3 back into the collection tube, 4) adding 350. mu.L of deproteinization solution RW1 into the adsorption column CS3, centrifuging at 00rpm for 60s, discarding the collection solution, placing the collection column CS3 back into the collection tube, 5) preparing a working solution of DNase I, placing 10. mu.L of the RNase I storage solution into the adsorption column CS 865, placing the collection tube in the centrifugation column CS3 for 500. mu.00 rpm, placing the centrifugation column for 10. mu.10. mu.20 min, adding the supernatant into the centrifugation column CR 2 for centrifugation column CR 8, placing the centrifugation column CR 2 for 10. mu.7 min, adding the centrifugation column CR 2 for centrifugation for 10. mu.10. mu.8, placing the centrifugation for 5 minutes, adding the centrifugation for 10. mu.10. mu.20 minutes, adding the centrifugation for 10. mu.10. mu.20 minutes, adding the centrifugation for 5 minutes, adding the centrifugation for the centrifugation column CR 2 minutes, adding the centrifugation for the centrifugation column CR 2 minutes, adding the centrifugation for the centrifugation column CR 2 for the centrifugation column CR 2 for the.
Synthesis of (1) mixing 1. mu.g of total RNA with 1. mu.L of 25pmol oligo dT primer, complementing the mixture to 12.75. mu.L with RNase-freeddH2O, and gently mixing; 2) Preserving heat at 65 ℃ for 5min, immediately transferring to an ice bath, and standing for 2 min; 3) adding 5 × reaction buffer 4 μ L, 10mM dNTP 2 μ L, RNA inhibition 0.25 μ L (40U/μ L), ReverTraace reverse transcriptase 1 μ L (100U/μ L), incubating at 42 deg.C for 30 min, and synthesizing first cDNA;
4) heating at 95 deg.C for 5min, inactivating reverse transcriptase, and terminating the synthesis reaction.
Quantitative PCR detection
A rice Actin gene (EU155408.1) is selected as an internal reference gene, quantitative PCR is carried out according to Bestar SybrGreen qPCRmastermix (DBI, DBI-2043), and the reaction system is as follows:
the method for calculating the relative expression amount of the gene employs 2-△△CtThe method is carried out.
The PtPTATPase gene quantitative PCR primers are as follows:
QQ OsVHA-AF: 5’ GGTGTTTCAGTCCCTGCTCTTG 3’
QQVHA-AR: 5’ CCCATAGAACCAGGAGGAAGG3’
the internal reference uses Actin, and the primer is as follows:
QQOsActinF: 5’ ACCTTCAACACCCCTGCTAT 3’
QQOsActinR: 5’ CACCATCACCAGAGTCCAAC 3’
2. phenotypic analysis of tillering shoots
Selecting 50 seeds of typical transgenic rice T2 generation (OsV-5) and wild type Nipponbare rice (WT) seeds, culturing in Mucun culture solution, and observing with a body type microscope at 4 leaves and 1 heart.
Phenotypic analysis of tillering number at maturity stage
Counting tillering numbers of wild rice seeds Nipponbare and typical transgenic rice T2 generation seeds (OsV-5) respectively, and counting at least 100 strains.
Results of the experiment
4.1 analysis of Rice tillering shoots
Transgenic and wild-type tillering shoots as shown in fig. 1, the tillering shoots of the transgenic line were significantly longer than the wild-type (fig. 1). Experiments show that down-regulationOsVHAThe gene expression can promote the elongation of rice tillering buds.
Analysis of Rice tillering number
The statistical results of the tillering number of the wild rice seed Nipponbare and the typical transgenic rice T2 generation seed (OsV-5) show that the tillering number of the transgenic OsV-5 rice is obviously increased compared with the wild type (figure 2 and figure 2)3) Experiments show that down-regulationOsVHAThe expression of the gene can show the growth and development of rice tillering.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> a method for promoting rice tillering
<130>6
<160>6
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213>VHAF
<400>1
<210>2
<211>24
<212>DNA
<213>VHAR
<400>2
gatgttcaag tagatggtca tcgt 24
<210>3
<211>22
<212>DNA
<213>QQ OsVHA-AF
<400>3
ggtgtttcag tccctgctct tg 22
<210>4
<211>21
<212>DNA
<213>QQVHA-AR
<400>4
cccatagaac caggaggaag g 21
<210>5
<211>20
<212>DNA
<213>QQOsActinF
<400>5
<210>6
<211>20
<212>DNA
<213>QQOsActinR
<400>6
Claims (4)
1. A method for promoting rice tillering is characterized in that:OsVHAthe gene is expressed in rice plant in silence.
2. The method for promoting rice tillering according to claim 1, wherein the method comprises the following steps: carry aboutOsVHAThe agrobacterium of the gene recombinant plasmid transforms rice, and promotes the growth of transgenic rice tillering buds in the rice tillering bud forming period.
3. The method for promoting rice tillering according to claim 1, wherein the method comprises the following steps: carry aboutOsVHAThe agrobacterium of the gene recombinant plasmid transforms rice, and promotes the increase of the tillering number of the transgenic rice in the mature period of the rice, thereby promoting the increase of the yield of the transgenic rice.
4. Use of the method according to claims 1-3 for promoting rice tillering and rice yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911416464.XA CN110951775B (en) | 2019-12-31 | 2019-12-31 | Method for promoting tillering of rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911416464.XA CN110951775B (en) | 2019-12-31 | 2019-12-31 | Method for promoting tillering of rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110951775A true CN110951775A (en) | 2020-04-03 |
| CN110951775B CN110951775B (en) | 2021-09-28 |
Family
ID=69985467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911416464.XA Active CN110951775B (en) | 2019-12-31 | 2019-12-31 | Method for promoting tillering of rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110951775B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112301046A (en) * | 2020-09-21 | 2021-02-02 | 陕西师范大学 | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242136A (en) * | 2011-04-26 | 2011-11-16 | 重庆大学 | Gene influencing root system development and yield of rice and application of gene |
| CN103665127A (en) * | 2013-12-10 | 2014-03-26 | 南京农业大学 | Rice tillering relevant protein, encoding gene thereof and application of rice tillering relevant protein and encoding gene thereof |
| CN106868019A (en) * | 2017-03-16 | 2017-06-20 | 周口师范学院 | Control rice tillering gene OsHT1 and its application |
-
2019
- 2019-12-31 CN CN201911416464.XA patent/CN110951775B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242136A (en) * | 2011-04-26 | 2011-11-16 | 重庆大学 | Gene influencing root system development and yield of rice and application of gene |
| CN103665127A (en) * | 2013-12-10 | 2014-03-26 | 南京农业大学 | Rice tillering relevant protein, encoding gene thereof and application of rice tillering relevant protein and encoding gene thereof |
| CN106868019A (en) * | 2017-03-16 | 2017-06-20 | 周口师范学院 | Control rice tillering gene OsHT1 and its application |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112301046A (en) * | 2020-09-21 | 2021-02-02 | 陕西师范大学 | Gene GhD14 for regulating and controlling plant stem and lateral branch development and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110951775B (en) | 2021-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | MicroRNA393 is involved in nitrogen-promoted rice tillering through regulation of auxin signal transduction in axillary buds | |
| EP1945021B1 (en) | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby | |
| CN104292317B (en) | Drought resistant correlative protein of plant and coding gene and application thereof | |
| CN102906267A (en) | Identification of diurnal rhythms in photosynthetic and non-photosynthetic tissues from zea mays and use in improving crop plants | |
| CN112831504B (en) | Pseudo-ginseng WRKY transcription factor gene PnWRKY9 and application thereof | |
| CN110747202B (en) | Lilium regale WRKY transcription factor gene LrWRKY11 and application thereof | |
| CN112831505B (en) | Pseudo-ginseng WRKY transcription factor gene PnWRKY15 and application thereof | |
| BRPI0712201A2 (en) | compositions for silencing the expression of gibberellin 2-oxidase and uses thereof | |
| Min et al. | Successful genetic transformation of Chinese cabbage using phosphomannose isomerase as a selection marker | |
| Lee et al. | Brassinosteroids facilitate xylem differentiation and wood formation in tomato | |
| CN100532554C (en) | Plant anther specific promoter and its application | |
| Krishnamurthy et al. | Brassica rapa expansin-like B1 gene (BrEXLB1) regulate growth and development in transgenic Arabidopsis and elicits response to abiotic stresses | |
| CN110951775B (en) | Method for promoting tillering of rice | |
| CN113322257A (en) | Panax notoginseng inducible promoter PPO1 and application thereof | |
| Woo et al. | Auto-excision of selectable marker genes from transgenic tobacco via a stress inducible FLP/FRT site-specific recombination system | |
| Liu et al. | Establishment of Agrobacterium-mediated genetic transformation and application of CRISPR/Cas9 genome-editing system to Brassica rapa var. rapa | |
| Zheng et al. | MIGS as a simple and efficient method for gene silencing in rice | |
| WO2015052732A2 (en) | A method for production of transgenic cotton plants | |
| CN107253980B (en) | Application of OsGRF7 gene in rice plant type regulation | |
| CN112359049A (en) | Lilium regale chitinase gene LrCHI2 and application thereof | |
| EP1236801A2 (en) | Method of agrobacterium mediated plant transformation through treatment of germinating seeds | |
| CN114540381B (en) | Apple histone deacetylase MdHDA6 gene and application thereof | |
| CN106397556A (en) | Plant drought-resistant related protein ZmNAC111, coding gene and applications thereof | |
| CN112662688B (en) | Application of walnut SnRK1 protein kinase coding gene JrSnRK1 in synthesis and accumulation of oil | |
| CN108218967B (en) | Rice heading stage related protein and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |