KR102265780B1 - EFG1 gene for regulating flowering date of plantbody and uses thereof - Google Patents

Abstract

The present invention relates to an EFG1 gene that regulates the flowering period of a plant, and a method for regulating the flowering period of a plant, comprising the step of overexpressing the gene in the plant. Since the flowering period of a plant can be controlled by using the gene of the present invention, it can be utilized in fields such as improvement of crop productivity and biomass.

Description

EFG1 gene for regulating flowering date of plantbody and uses thereof {EFG1 gene for regulating flowering date of plantbody and uses thereof}

The present invention relates to an EFG1 gene that controls the flowering period of a plant, and a method for regulating the flowering period of a plant, comprising the step of overexpressing the gene in the plant.

Rice goes through two major stages of vegetative growth and reproductive growth to end its life. The vegetative growth phase is the time to make the body of rice, and the reproductive growth phase is the time to make the rice seeds for 2 years old. The vegetative growth phase is divided into the seedling phase and the tillering phase, with the survival phase after planting in the middle. In the seedling period, there is the weaning period (離乳期), in which the nutrients of the seeds are depleted, and it refers to the period when the fourth leaf is formed after the third leaf is completely formed. After the mother plant is established in the paddy field, tillering occurs vigorously, and the goal of cultivation during the vegetative growth period is vigorous tillering. Tilling refers to the emergence of new branches from the nodes of rice in the ground. The reproductive growth phase refers to the period from the oily differentiation phase to the maturation phase, starting from the seeding phase (when the ears are sprouted), followed by the elongation phase and the fruiting phase after. The reason why electricity is in the elongation phase is because at this time, the nodes between the nodes of the ear stems grow rapidly. And now, because the physical growth of rice is slowed down and the growth of the ears is accelerated, from this point on, the period of leaf formation is doubled. During this elongation stage, young ears (oiling water) are differentiated and the stems of the ears grow rapidly at the same time, and in the latter part, pollen is produced (germ cell division), and the period from this time until the ears are harvested is called the watering stage. do.

Vegetative growth and reproductive growth are switched between the two growths by the flowering signal. Various factors such as genetic factors within the plant and environmental factors such as photoperiod and light intensity affect these flowering signals. As a result of this growth conversion, various morphological changes occur, so research on flowering-related mechanisms is continuing.

The present inventors have completed the present invention by confirming that the rice-derived EFG1 gene is related to the flowering period of plants while researching on the seeding season and vegetative growth control method of crops.

Korea Patent Registration No. 10-1651940 (registration on August 23, 2016)

An object of the present invention is to provide a recombinant vector comprising the EFG11 gene consisting of the nucleotide sequence of SEQ ID NO: 1 that controls the flowering period of a plant.

Another object of the present invention is to provide a plant transformed with the recombinant vector.

Another object of the present invention is to provide a method of regulating the flowering period of a plant, comprising the step of overexpressing the gene consisting of the nucleotide sequence of SEQ ID NO: 1 in the plant.

Another object of the present invention is to provide a composition for controlling the flowering period of a plant comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The present invention provides a recombinant vector containing the EFG1 (Early flowering gene 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 that controls the flowering period of a plant.

The EFG1 gene may be isolated from rice (oryza sativa L.).

The gene consisting of the nucleotide sequence of SEQ ID NO: 1 consists of 1083 nucleotides.

In one embodiment of the present invention, the EFG1 gene may be amplified by polymerase chain reaction (PCR) using the primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 4.

As used herein, the term "exit season (出穗期)" refers to the period in which the ear buds are elongated prior to flowering in the flower and plants, and the ears appear from the leaf sheaths of the branches. In rice, since flowering starts at the same time as seeding, the time when the tip of the ear comes out is defined as seeding. Therefore, the rice season may have the same meaning as the flowering time of rice.

The control of the flowering period according to the present invention is to shorten the flowering period of the plant by inducing early flowering. Accordingly, the EFG1 gene may be a gene that regulates or shortens the flowering period of a plant.

The nucleotide sequence of SEQ ID NO: 1 encodes the EFG1 protein consisting of the amino acid sequence of SEQ ID NO: 2.

The EFG1 protein consisting of the amino acid sequence of SEQ ID NO: 2 consists of 361 amino acids.

The vector is preferably a recombinant vector for overexpressing the EFG1 gene.

As used herein, the term “recombinant” refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

As used herein, the term "vector" is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "expression vector" is often used interchangeably with "recombinant vector". The term "recombinant vector" refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expression of an operably linked coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotes are known.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the recombinant vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence.

The expression vector will preferably contain one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin ) and antibiotic resistance genes such as chloramphenicol, but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Since the selection of transformants can be made by various tissues at various stages, a constitutive promoter may be preferred in the present invention. Thus, the constitutive promoter does not limit the selectivity.

In one embodiment of the present invention, the recombinant vector pGA2897EFG1 prepared by inserting the EFG1 gene into the pGA2897 vector is exemplified, but the present invention is not limited to this specific vector.

In addition, the present invention provides a plant transformed with the recombinant vector.

The plant may be a monocotyledonous plant, and specifically may be any one selected from the group consisting of rice, wheat, barley, sorghum, corn and millet, and most preferably rice, but is not limited thereto. Transformation of a plant refers to any method of transferring DNA into a plant. Such transformation methods need not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species, including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable plant cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens, FA et al, 1982, Nature 296, 72-74; Negrutiu I et al, June 1987, Plant Mol Biol 8, 363-373), electroporation of protoplasts ( Shillito RD et al, 1985 Bio/Technol 3, 1099-1102), microinjection into plant elements (Crossway A et al, 1986, Mol Gen Genet 202, 179-185), (DNA or RNA-coating of various plant elements) ) particle bombardment method (Klein TM et al, 1987, Nature 327, 70), in Agrobacterium tumefaciens-mediated gene transfer by infiltration of plants or transformation of mature pollen or vesicles by (incomplete) viruses infection (EP 0 301 316) and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particular preference is given to using the so-called binary vector technique as described in EP A 120 516 and US Pat. No. 4,940,838.

A plant cell into which the vector of the present invention is introduced is not particularly limited to a specific form as long as the cell can be regenerated into a plant. These cells include, for example, cultured cell suspensions, protoplasts, leaf sections and callus. In addition, the present invention provides a plant with a shortened flowering period prepared according to the above method and redifferentiated through tissue culture.

In addition, the present invention provides a method for controlling the flowering period of a plant, including the step of overexpressing the gene consisting of the nucleotide sequence of SEQ ID NO: 1 in the plant.

The nucleotide sequence of SEQ ID NO: 1 encodes the EFG1 protein consisting of the amino acid sequence of SEQ ID NO: 2.

The method of overexpressing the gene preferably includes transforming the plant with a recombinant vector in which the gene is operably linked to a promoter, but is not limited thereto.

According to the method, the flowering period of a plant can be controlled by overexpressing the gene consisting of the nucleotide sequence of SEQ ID NO: 1 to increase the intracellular level of the EFG1 protein consisting of the amino acid sequence of SEQ ID NO: 2.

The intracellular level refers to the amount present in the cell, which can be adjusted by various methods known to those skilled in the art. For example, the intracellular level may be achieved through regulation at the transcriptional stage or through regulation at the post-transcriptional stage, but is not limited thereto. Regulation in the transcription step is a method for enhancing the expression of a gene known to those skilled in the art, for example, by preparing a recombinant expression vector linking the EFG1 gene of SEQ ID NO: 1 or a homologous gene thereto to a promoter to express the gene It can be carried out by a method of enhancing the EFG1 gene of SEQ ID NO: 1 or a method of inserting an expression control sequence to promote expression of the gene in the vicinity of the homologous gene thereto. Regulation at the post-transcriptional stage is a method for enhancing protein expression known to those skilled in the art, for example, a method for enhancing the stability of mRNA transcribed using the EFG1 gene of SEQ ID NO: 1 or a functional equivalent thereof, protein or protein It may be carried out by a method for enhancing stability or a method for enhancing a protein or activity of a protein.

The plant may be a monocotyledonous plant, and specifically may be any one selected from the group consisting of rice, wheat, barley, sorghum, corn and millet, and most preferably rice, but is not limited thereto.

The method is preferably a method of accelerating the flowering period of a plant.

In an embodiment of the present invention, the present inventors introduced a recombinant vector containing the EFG1 gene into Agrobacterium, and confirmed 6 overexpressing transformant lines using the introduced Agrobacterium. As a result of obtaining 6 strains of EFG1 gene overexpressing transformants and checking the flowering period, the flowering period was shortened by more than 10 days on average compared to the control, Dongjinbyeol. was confirmed. Therefore, it was confirmed that the transformant overexpressing the EFG1 (Early flowering gene 1) gene shortened the flowering period.

In addition, the present invention provides a composition for regulating the seeding phase and growth of a plant comprising the gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The nucleotide sequence of SEQ ID NO: 1 encodes the EFG1 protein consisting of the amino acid sequence of SEQ ID NO: 2.

The composition of the present invention includes the EFG1 gene as an active ingredient, and by transforming the gene into the plant, the flowering period of the plant can be controlled.

Controlling the flowering period of the plant is a method of controlling or shortening the flowering period of the plant.

The plant may be a monocotyledonous plant, and specifically may be any one selected from the group consisting of rice, wheat, barley, sorghum, corn and millet, and most preferably rice, but is not limited thereto.

The present invention may provide a gene for controlling the flowering period of a plant and a method for regulating the flowering period of a plant using the same. Since the flowering period of a plant can be controlled by using the gene of the present invention, it can be utilized in fields such as improvement of crop productivity and biomass.

1 shows the nucleotide sequence of the EFG1 gene.
Figure 2 shows the EFG1 protein amino acid sequence and motif analysis.
3 shows the intracellular localization of the EFG1 protein.
4 is a view showing the promotion of flowering of the control group Dongjin rice and EFG1 gene overexpressing rice transformants.
Figure 5 is a control group Dongjin rice (Dongjin, Dongjin) and EFG1 gene overexpression rice transformants (transformants #5-8, #5-14, #5-15) major agricultural traits such as plant length, soy sauce, and ripening rate will be compared

Hereinafter, the present invention will be described in more detail in the following examples. However, the following examples are merely illustrative of the content of the present invention and do not limit or limit the scope of the present invention. What can be easily inferred by those skilled in the art from the detailed description and examples of the present invention is construed as belonging to the scope of the present invention.

<Example 1> Rice-derived EFG1 gene isolation

cDNA was isolated from various tissues of rice and sequenced. Among them, a new gene whose function is not yet known was found and named EFG1 (Early flowering gene 1), which was described as SEQ ID NO: 1 and the corresponding amino acid sequence as SEQ ID NO: 2 (FIG. 1).

The method for isolating the EFG1 gene is as follows. Total RNA from Dongjinbyeo was isolated with trizol, and then 30 μg of cDNA was synthesized from 5 μg of total RNA using reverse transcriptase. From the synthesized cDNA, the coding region of the EFG1 gene was amplified by PCR using primers of EFG1-F (SEQ ID NO: 3) and EFG1-R (SEQ ID NO: 4). After PCR, the PCR product was confirmed by electrophoresis on 1% agarose gel, and DNA was extracted using a Qiagen Gel extraction kit and cloned into pGEM-Teasy vector (Promega). After cloning, the nucleotide sequence of the target gene EFG1 was analyzed using a forward primer (SEQ ID NO: 5), a reverse primer (SEQ ID NO: 6), and BigDye Terminator 31 (ABI). As a result, it was confirmed that the EFG1 gene has the same nucleotide sequence as the gene of NCBI GenBank Accession no AY333184.1. The primer information used is shown in Table 1 below.

SEQ ID NO: Primer name Primer direction Sequence (5'→3') 3 EFG1 forward CACCATGGGAAATGACGAAG 4 EFG1 reverse TTACCTTGCGGCTACAGCAT 5 M13F-pUC forward GTTTTCCCAGTCACGAC 6 M13R-pUC reverse CAGGAAACAGCTATGAC

As a result of analyzing the base sequence and amino acid sequence of the EFG1 gene, it is composed of a cDNA of 1083 bp and a protein composed of 361 amino acids. As a result of domain analysis, it has a bZIP domain and a G box binding domain, so it is expected to be a type of bZIP transcription factor. As a result of determining the intracellular location of the EFG1 protein, it was observed to exist in the nucleus, so it is highly likely to function as a transcription factor. It was confirmed that (Fig. 2, Fig. 3).

<Example 2> Preparation of EFG1 gene overexpression vector

An EFG1 overexpression vector for plant transformation was constructed.

Specifically, a 1083 bp cDNA was amplified by PCR (Polymerase chain reaction) using the EFG1-F primer (SEQ ID NO: 3) and the EFG1-R primer (SEQ ID NO: 4). PCR was performed for 30 cycles of 95 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 1 minute. The amplified cDNA was cloned into pENTR-D-Topo, and then cloned into the pEarleygate201 vector for plant transformation using a gateway method.

<Example 3> EFG1 gene overexpression rice transformant production and overexpression assay

The vector prepared in Example 2 was transformed into Agrobacterium LBA4404 strain, and rice was transformed using this vector. The present inventors transformed rice using the Agrobacterium-mediated transformation method (Hiei et al 1994) to construct a transformant overexpressing the EFG1 gene.

Specifically, peeled brown rice was used for rice seeds used for rice transformation. The rice seeds were immersed in 70% ethanol for 1 minute and then sterilized in a 50% lax solution (10 μl of Tween 20 added per 30 ml of lax) for 40 minutes. After all the disinfectant solution was discarded, the rice seeds were washed 5 times with sterile water. After the disinfectant solution was well washed, water was removed from the rice seeds using filter paper, and then the rice seeds were placed in 2N6 medium. 2N6 medium is a mixture containing macroelement, trace element and vitamin in N6 medium (Chu et al., Scin Sin (1975) 18:659-668) 4 g/L, 30 g/L sucrose, 0.5 g/L proline , 0.5 g/L glutamine, 0.3 g/L casamino acids, 0.01 g/L myo-inositol, 2 mg/L 2,4-D and 4 g/L phytagel (pH5.8). It was treated at 28 °C and cultured for 5 days, and the endosperm was removed when callus was induced. The endosperm was carefully removed using tweezers so as not to damage the callus, and the cotyledon and roots were left to prevent damage to the callus. The transformed Agrobacterium was cultured in AB solid medium for 3 days, and then collected in AAM liquid medium to make a suspension. The concentration of the suspension was measured using an absorbance meter. First, _{it was made to OD 595} = 0.1, and then diluted 10-fold with AAM to make OD ₅₉₅ = 0.01. The callus from which the endosperm was removed was immersed in the Agrobacterium suspension for 2 minutes, and the solution was gently shaken to inoculate Agrobacterium. After inoculation, only the suspension was discarded from the callus and the filtrate was removed using filter paper. This work was carried out quickly, and care was taken not to dry out the callus from being left on the filter paper for too long. After adding 10 g/L glucose and 100 μM acetosyringone to the 2N6 medium, place a sheet of filter paper on the 2N6-AS medium adjusted to pH 5.2 in advance to allow the medium components to permeate sufficiently, and then place the callus on the filter paper at 25 was co-cultured under dark conditions for 7 days. The filter paper is to prevent the callus from becoming soft due to excessive growth of Agrobacterium during the co-culture period. After co-culture, Agrobacterium can be selectively removed by washing with a solution of 500 mg of antibiotic carbenicillin in 1 L of sterile distilled water, but when using Agrobacterium LBA4404 strain, Agrobacterium during the co-culture period It is more preferable not to carry out the cleaning operation as excessive growth of the bacterium has not been achieved. Thereafter, the callus was transferred to 2N6-CH medium in which 200 mg/L of antibiotics cefotaxime and 40 mg/L of hygromycin were added to 2N6 medium. At this time, the cotyledon and roots were removed using tweezers, and the callus was divided into 2-3 pieces and transferred and cultured to maximize the contact area with the medium. The appropriate incubation temperature was 28 °C, and the transformed callus was induced by culturing for 14 days in the dark incubator. After 14 days of culture, when the transformed callus grew while dividing in 2N6-CH medium to which the antibiotic hygromycin was added, it was subcultured with MSR medium, which is a redifferentiation medium capable of inducing shoots and roots. The distinction of transformed callus was judged by the presence or absence of a newly differentiated callus mass, and the browned and dead callus was discarded. The seedlings grown in the MSR redifferentiation medium were transferred to water supply medium and grown in a greenhouse. For the presence or absence of transformants, the leaves of rice grown for one month in a greenhouse were freeze-dried and crushed, and genomic DNA was isolated from them using the DNeasy Plant Mini Kit (QIAGEN). By confirming the insertion of the hygromycin gene inserted together with the EFG1 gene by performing PCR using the isolated genomic DNA and the hygromycin gene primers (SEQ ID NOs: 7 and 8) of Table 2 below, the insertion of the EFG1 gene was confirmed. Thus, EFG1 overexpressing transformants were selected. And the overexpression of the EFG1 gene in the transformant was assayed. As a result, a rice transformant in which the EFG1 gene was overexpressed was obtained.

SEQ ID NO: Primer name Primer direction Sequence (5'→3') 7 Hygromycin F forward CGACGTCTGTCGAGAAGTTTT 8 Hygromycin R reverse CTATTCCTTTGCCCTCGGAC

<Example 4> Effect of EFG1 gene overexpressing transformants to shorten the fertility period

An experiment was conducted to confirm the effect of shortening the seeding season of the EFG1 gene overexpressing rice transformant prepared in Example 3 above.

Specifically, 6 EFG1 gene-overexpressing rice transformant lines and Dongjinbyeo, a control, were compared and investigated by planting date.

As a result, it was confirmed that the period required until the watering period (flowering period) of EFG1 overexpressing rice was shortened by about 10 days on average compared to that of the control, Dongjinbyeo (Table 3).

Comparison between Dongjinbyeo and Gwabyeolhyun transgenic rice date Dongjin (Daejo-gu)
(Number of outflows/
total count) Transformant #8
(Number of outflows/
total count) Transformant #14
(Number of outflows/
total count) Transformant #15
(Number of outflows/
total count) 2016.08.01 -/58 -/25 5/25 15/32 2016.08.04 -/58 10/25 11/25 32/32 2016.08.08 -/58 10/25 24/25 32/32 2016.08.06 3/58 25/25 25/25 32/32 2016.08.18 32/58 25/25 25/25 32/32 2016.08.22 58/58 25/25 25/25 32/32

<Example 5> Agricultural trait assay of EFG1 gene overexpression transformants

The major agricultural traits of the EFG1 gene overexpressing transformant rice prepared in Example 3 were investigated.

Specifically, the transgenic plant used in Example 4 and the control group, Dongjinbyeo, were compared by measuring the plant length, soy sauce, and ripening rate just before harvest (FIG. 5).

As a result, it was confirmed that the EFG1 overexpressing rice had similar agricultural characteristics to Dongjinbyeo as the control, such as soy sauce, soy sauce, and ripening rate, but decreased the number of ears and total seed weight by up to 15%. could

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> EFG1 gene for regulating flowering date of plantbody and uses it <130> DP20190264 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 1083 <212> DNA <213> Oryza sativa <400> 1 atgggaaatg acgaagctgt agttactcag aagatgggga aagcaccatc gcccccctaag 60 gatcatccag cccttagtcc ataccttgat tggtcaaata tgcaggcata ttacggccca 120 gggatcttgc caccaacatt ttttagccct ggaatagccg ctggtcatac ccctcctcca 180 tttatcttgg gtcctcagcc tctggtgcca tccgcttttg ggaagccata tgccgcaatt 240 tatcctcctg gtggagcttt ttcacatccg ttcatgcccc taatggtgag cccattgagc 300 atggagccag caaagtctgt caacagcaag gatagctgtt caaataagaa aatgaaggaa 360 attgatggtg cggctgtgtc aactggcagt ggcaacagtg aaaaaacaag tggagattgc 420 agcttagaag gatccagtga tggaaacaac cagaaggcaa gtggaactcc caagaaaagg 480 agcatagatg ataggcctaa atcaggcgtg gaaactggtg gagctttaac acctaatgat 540 agacctagcg aacaagcagc tttgccaaat ctatgcattc cggttacagc aatcaaacca 600 gacgtgagca ctgctagtga cttcagagtt attgccaccc cagtaactga agtgccaact 660 aaggatgata aggaatcgaa gcgcgagaga aggaagcaat caaacaggga gtctgctcgg 720 aggtcaaggt tgaggaagca ggccgagact gaggaactgg ctagaaaagt tgagctattg 780 actgcggaga acacatccct tagacgtgaa ataagcaggc taacggaaag ctccaagaaa 840 cttagattag agaattctgc tctaatggag aaactaacgg aaaccgggcc tgatgaagca 900 caagaagtgc ctccagtcaa aacaaaagca cagcaagctc gaggcgtcga aaatttcctg 960 tcaatgatag acaagactgg cacgccgaga agcagcgggc acatggatca tgccattgcc 1020 acgcccaagc ttcgtcaact cctgggctct ggtctggcga ctgatgctgt agccgcaagg 1080 taa 1083 <210> 2 <211> 360 <212> PRT <213> Oryza sativa <400> 2 Met Gly Asn Asp Glu Ala Val Val Thr Gln Lys Met Gly Lys Ala Pro 1 5 10 15 Ser Pro Pro Lys Asp His Pro Ala Leu Ser Pro Tyr Leu Asp Trp Ser 20 25 30 Asn Met Gln Ala Tyr Tyr Gly Pro Gly Ile Leu Pro Pro Thr Phe Phe 35 40 45 Ser Pro Gly Ile Ala Ala Gly His Thr Pro Pro Pro Phe Ile Leu Gly 50 55 60 Pro Gln Pro Leu Val Pro Ser Ala Phe Gly Lys Pro Tyr Ala Ala Ile 65 70 75 80 Tyr Pro Pro Gly Gly Ala Phe Ser His Pro Phe Met Pro Leu Met Val 85 90 95 Ser Pro Leu Ser Met Glu Pro Ala Lys Ser Val Asn Ser Lys Asp Ser 100 105 110 Cys Ser Asn Lys Lys Met Lys Glu Ile Asp Gly Ala Ala Val Ser Thr 115 120 125 Gly Ser Gly Asn Ser Glu Lys Thr Ser Gly Asp Cys Ser Leu Glu Gly 130 135 140 Ser Ser Asp Gly Asn Asn Gln Lys Ala Ser Gly Thr Pro Lys Lys Arg 145 150 155 160 Ser Ile Asp Asp Arg Pro Lys Ser Gly Val Glu Thr Gly Gly Ala Leu 165 170 175 Thr Pro Asn Asp Arg Pro Ser Glu Gln Ala Ala Leu Pro Asn Leu Cys 180 185 190 Ile Pro Val Thr Ala Ile Lys Pro Asp Val Ser Thr Ala Ser Asp Phe 195 200 205 Arg Val Ile Ala Thr Pro Val Thr Glu Val Pro Thr Lys Asp Asp Lys 210 215 220 Glu Ser Lys Arg Glu Arg Arg Lys Gln Ser Asn Arg Glu Ser Ala Arg 225 230 235 240 Arg Ser Arg Leu Arg Lys Gln Ala Glu Thr Glu Glu Leu Ala Arg Lys 245 250 255 Val Glu Leu Leu Thr Ala Glu Asn Thr Ser Leu Arg Arg Glu Ile Ser 260 265 270 Arg Leu Thr Glu Ser Ser Lys Lys Leu Arg Leu Glu Asn Ser Ala Leu 275 280 285 Met Glu Lys Leu Thr Glu Thr Gly Pro Asp Glu Ala Gln Glu Val Pro 290 295 300 Pro Val Lys Thr Lys Ala Gln Gln Ala Arg Gly Val Glu Asn Phe Leu 305 310 315 320 Ser Met Ile Asp Lys Thr Gly Thr Pro Arg Ser Ser Gly His Met Asp 325 330 335 His Ala Ile Ala Thr Pro Lys Leu Arg Gln Leu Leu Gly Ser Gly Leu 340 345 350 Ala Thr Asp Ala Val Ala Ala Arg 355 360 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EFG1-forward <400> 3 caccatggga aatgacgaag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EFG1-reverse <400> 4 ttaccttgcg gctacagcat 20 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> M13F-pUC-forward <400> 5 gttttcccag tcacgac 17 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> M13F-pUC-reverse <400> 6 caggaaacag ctatgac 17 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hygromycin_forward <400> 7 cgacgtctgt cgagaagttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hygromycin-reverse <400> 8 ctattccttt gccctcggac 20

Claims (10)

A recombinant vector containing the EFG1 (Early flowering gene 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 that shortens the flowering period of a plant. According to claim 1,
The EFG1 gene is a recombinant vector, characterized in that isolated from rice. delete A plant transformed with the recombinant vector of claim 1. 5. The method of claim 4,
The plant is any one selected from the group consisting of rice, wheat, barley, sorghum, corn and millet. A method of shortening the flowering period of a plant, comprising the step of overexpressing the gene consisting of the nucleotide sequence of SEQ ID NO: 7. The method of claim 6,
The method of overexpressing the gene comprises transforming the plant with a recombinant vector in which the gene is operably linked to a promoter. 7. The method of claim 6,
The method of shortening the flowering period of a plant, characterized in that the plant is any one selected from the group consisting of rice, wheat, barley, sorghum, corn and millet. delete A composition for shortening the flowering period of a plant comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Images