KR20230033830A - UP gene from Arabidopsis thaliana regulating resistance to environment stress in plant and uses thereof - Google Patents

Abstract

The present invention relates to a UP gene (Unknown Protein, AT3G47850) for regulating growth, flowering, and resistance to environmental stress and uses thereof. Environmental stress resistance in a plant can be controlled and regulated through silencing or overexpression of a UP protein-coding gene. Therefore, it can be used to improve plant productivity.

Description

UP gene regulating resistance to environmental stress and its uses {UP gene from Arabidopsis thaliana regulating resistance to environment stress in plant and uses thereof}

The present invention relates to a UP gene (Unknown Protein, AT3G47850) that regulates growth, flowering, and resistance to environmental stress and uses thereof, and more particularly, to the coding gene of the UP protein (Uncharacterized Protein) represented by SEQ ID NO: 1 A method for controlling growth, flowering, and function against environmental stress, a method for preparing a transgenic plant with improved resistance to drying stress and shortening of flowering period, a transgenic plant prepared therefrom, a composition for genome editing, and including the same It's about a kit that does.

Plants live by exchanging signals constantly under biological stress such as pathogen infection and insect attack, and environmental stress such as drought, heat, cold, and nutrient deficiency. In particular, environmental stress affects the geographic distribution of plants, limits plant productivity in agriculture, and is closely related to food security.

Plants are expected to develop complex and diverse signal responses because they live under complex and diverse environmental stresses, but only a few proteins and genes have actually been identified. This is because several functions of genes encoding stress-related proteins are duplicated, so even if one gene malfunctions, an important phenotype in the stress response may not be observed. stress-related proteins or macromolecules are technically difficult to demonstrate that proteins or macromolecules function as sensors for physical signals (e.g., high pressure, ionic concentration, temperature change). Or the genes are very difficult to identify.

Among them, there are proteins that have been difficult to identify. For example, OSCA1 (reduced hyperosmolality-induced calcium increase 1) of Arabidopsis is a protein related to hyperosmotic stress and is not known to be involved in dryness or salt stress.

Soil salt concentration affects cropland composition and is an important factor limiting agricultural productivity worldwide. High salinity causes secondary stresses such as ion toxicity (Na ⁺ ), hyperosmotic stress, and oxidative damage.

Accordingly, a method for enhancing the resistance of plants to salt, dryness, and ABA stress is being researched, and in this regard, studies on low temperature stress tolerance related genes and transgenic plants are being conducted, but are still incomplete.

Patent Document 1. Republic of Korea Patent Publication No. 10-2021-0069839

Accordingly, the present invention has been made in view of the above problems, and an object of the present invention is to provide a method for controlling plant growth, flowering, and resistance to environmental stress.

Another object of the present invention is to provide a method for producing transgenic plants with improved resistance to drying stress and shortening of flowering period.

Another object of the present invention is to provide transgenic plants with improved resistance to drying stress and shortening of flowering time.

Another object of the present invention is to provide a composition for genome correction that shortens the flowering period of plants and enhances resistance to drying stress.

In order to achieve the above object, the present invention includes the step of regulating the expression of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1, which regulates the growth, flowering and resistance of plants to environmental stress provides a way

Regulating the expression of the UP protein-encoding gene, i) shortening the flowering period and enhancing resistance to drying stress by deleting the UP protein-encoding gene; ii) promoting growth and enhancing resistance to salt stress and ABA stress by introducing and overexpressing the UP protein coding gene;

The overexpression of the UP protein coding gene may be performed using a recombinant vector containing the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1.

The deletion of the UP protein coding gene is VIGS (Virus-induced gene silencing), siRNA, shRNA, miRNA, ribozyme (ribozyme), PNA (peptide nucleic acids), antisense oligonucleic acid, T-DNA insertion or genome / gene correction ( genome/gene editing) system.

The deletion of the UP protein coding gene is a guide RNA specific to the target sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a complex of endonuclease protein (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein ; may be used.

The UP protein (Unknown Protein, AT3G47850) coding gene may be represented by SEQ ID NO: 2.

The endonuclease protein may be a Cas9 protein.

The plant may be Arabidopsis thaliana .

The present invention, in order to achieve the above object, (a) a guide RNA specific to the target sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and an endonuclease a complex of proteins (ribonucleoprotein); Or a UP protein represented by SEQ ID NO: 1 (Unknown Protein, AT3G47850) Recombinant vector containing a DNA encoding a guide RNA specific to the target sequence of the coding gene and a nucleic acid sequence encoding an endonuclease protein; plant Correcting the genome by introducing into cells; and

(b) regenerating the transgenic plant in which the genome has been corrected; a method for producing a transgenic plant with improved resistance to drying stress and shortening of flowering time is provided.

The plant may be Arabidopsis thaliana .

In order to achieve the above another object, the present invention provides a transgenic plant with improved resistance to drying stress and reduced flowering time prepared by the above method.

In order to achieve the above another object, the present invention is a guide RNA specific to the target sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and an endonuclease protein complex of (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein It provides a composition for genome correction that improves resistance to drying stress and shortens the flowering period of plants containing ; as an active ingredient.

In order to achieve the above another object, the present invention provides a kit for preparing a plant containing the composition to shorten flowering time and improve resistance to drying stress.

Since the UP protein (Unknown Protein, AT3G47850) of the present invention has the function of positively or negatively regulating growth, flowering, and resistance to environmental stress in plants, environmental stress resistance in plants can be achieved through silencing or overexpression of UP protein coding genes. can be controlled and regulated, so it can be used to improve plant productivity.

1 is a diagram showing a CRISPR region (red) in a UP mutant allele and a UP primer used in the present invention.
Figure 2 shows the results of genotyping analysis of the Col-0 Ecotime Arabidopsis thaliana plant (WT) and the transgenic plant (UP-CRISPR) prepared in Example 2.
Figure 3 shows the results of RT-PCR analysis of the Col-0 Ecotime Arabidopsis thaliana plant (WT) and the transgenic plant (UP-CRISPR) prepared in Example 2.
4 shows the results of qRT-PCR analysis of the Col-0 Ecotime Arabidopsis thaliana plant (WT) and the transgenic plant (UP-CRISPR) prepared in Example 2.
5 is a photograph of seedlings grown from a transgenic plant (UP-CRISPR) prepared in Example 2, a hos15 transgenic plant prepared from Comparative Example 1, and a wild type (Columbia-0, Col0) plant for 7 days. .
6 is a graph showing the measurement of hypocotyl germination length of transgenic plants (UP-CRISPR) prepared in Example 2, hos15 transgenic plants prepared in Comparative Example 1, and wild-type (Columbia-0, Col0) plants.
7 is a graph showing root lengths of transgenic plants (UP-CRISPR) prepared in Example 2, hos15 transgenic plants prepared in Comparative Example 1, and wild-type (Columbia-0, Col0) plants.
8 is a photograph of seedlings grown from a transgenic plant (UP-CRISPR) prepared in Example 2, a hos15 transgenic plant prepared from Comparative Example 1, and a wild-type (Columbia-0, Col0) plant for 25 days. .
9 is a photograph of seedlings grown from a transgenic plant (UP-CRISPR) prepared in Example 2, a hos15 transgenic plant prepared from Comparative Example 1, and a wild-type (Columbia-0, Col0) plant for 25 days. .
10 shows FT gene expression of seedlings grown for 25 days with transgenic plants (UP-CRISPR) prepared in Example 2, hos15 transgenic plants prepared in Comparative Example 1, and wild-type (Columbia-0, Col0) plants. It is a graph shown by measuring by qRT-PCR.
11 is a photograph of the long angles of transgenic plants (UP-CRISPR) and wild-type (Columbia-0, Col0) plants prepared in Example 2.
12 shows a wild-type (Columbia-0, Col0) plant, a transgenic plant prepared from Example 2 (UP-CRISPR), and a hos15 transgenic plant prepared from Comparative Example 1 in the presence of 0 mM, 75 mM, 100 mM, or 125 mM It was grown for 7 days in NaCl-added MS medium and the degree of seed germination was measured.
13 shows wild-type (Columbia-0, Col0) plants, transgenic plants prepared in Example 2 (UP-CRISPR), and hos15 transformed plants prepared in Comparative Example 1 in MS medium supplemented with 0 mM or 150 mM NaCl. This is a photograph of the root length of the seedling after growing for 7 days.
14 is a result of comparing the germination rates of wild-type (Columbia-0, Col0) plants, transgenic plants (UP-CRISPR) prepared in Example 2, and hos15 transgenic plants prepared in Comparative Example 1 under ABA treatment conditions.
15 is a result of comparing the phenotypes of wild-type (Columbia-0, Col0) plants, transgenic plants (UP-CRISPR) prepared from Example 2, and hos15 transgenic plants prepared from Comparative Example 1 under dry stress conditions. .
16 shows a virtual model for the function of UP.

Hereinafter, the present invention will be described in detail.

Human GPS2 (G protein pathway suppressor 2), which is related to the G protein-mitogen-activated protein kinase signal transduction system, functions as the NCOR1-HDAC3-TBL1 complex, suppressing Ras, MAPK, and JNK signaling, and has various physiological effects. known to be involved in the process. Accordingly, the present inventors discovered an uncharacterized protein (UP) protein having an amino acid sequence represented by SEQ ID NO: 1 in plants, which is a homolog of the GPS2, and while studying the relationship between the UP gene and the environmental stress response, Arabidopsis thaliana The present invention was completed by identifying that the UP gene functions as a negative or positive regulator that regulates and controls plant development, flowering, abscisic acid (ABA), salt stress, and drying stress.

One aspect of the present invention relates to a method for regulating the growth, flowering and resistance to environmental stress of a plant, comprising the step of regulating the expression of a gene encoding the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 will be.

In the present invention, the coding gene for seed germination, flowering, and UP protein (Unknown Protein, AT3G47850) may be represented by SEQ ID NO: 2.

When the expression of the coding gene of the UP protein (Unknown Protein, AT3G47850) is suppressed, plant growth is reduced and resistance to salt stress and ABA stress is lowered, while flowering time is accelerated and resistance to drying stress is increased Confirmed.

In the present invention, the UP protein (Unknown Protein, AT3G47850) may consist of the amino acid sequence represented by SEQ ID NO: 1, and functional equivalents of the protein are also included in the scope of the UP protein.

The "functional equivalent" means at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably, the amino acid sequence represented by SEQ ID NO: 1 as a result of addition, substitution or deletion of amino acids. More specifically, it refers to a protein that has a sequence homology of 95% or more and exhibits substantially the same physiological activity as the protein represented by SEQ ID NO: 1. "Substantially homogeneous physiological activity" means an activity that regulates plant growth, flowering and resistance to environmental stress.

The method for regulating plant growth, flowering and resistance to environmental stress according to the present invention is to selectively control plant growth, flowering and resistance to environmental stress by preparing transgenic plants by regulating the expression of the UP protein-encoding gene. that can be adjusted with Specifically, i) shortening the flowering period and enhancing resistance to drying stress by deleting the UP protein coding gene; ii) It may be to introduce and overexpress the UP protein coding gene to promote growth and enhance resistance to salt stress and ABA stress.

The PWR-HDA9-HOS15 complex is known to be involved in various physiological processes, such as growth-related processes such as plant development and flowering, and environmental stress-related signal transduction systems. As a result of confirming through numerous experiments whether there is a protein or gene related to this, the UP protein, which is a homolog of GPS2 in animals, was identified. In order to confirm whether the UP protein has a substantial effect on plant development, flowering, and environmental stress, phenotypic experiments and qRT-PCR analysis were performed. , ABA, salt stress, and drying stress, it was confirmed that the sequence was completely different, but the function was similar to that of the hos15 gene. From this, it can be inferred that the UP gene functions in various physiological processes together with the PWR-HDA9-HOS15 complex. That is, it can be seen that the UP gene plays an important role in regulating signal transduction mechanisms in response to growth, flowering time, ABA, salt and dry stress in Arabidopsis thaliana .

16 shows a virtual model for the function of the UP according to the present invention based on the experimental results. The UP protein is a multifunctional protein and forms a complex with PWR-HOS15-HDA9 to determine hypocotyl development, flowering time, salt stress, It is believed to be involved in several physiological processes including the ABA response and drying stress. Functional loss of UP protein shortens flowering time and enhances resistance to drying stress, whereas expression of UP protein promotes growth and enhances resistance to salt and ABA stress. Therefore, by regulating the expression of the UP protein-encoding gene, a plant having desired characteristics (growth, flowering time, resistance to stress) can be prepared according to a desired purpose.

Overexpression of the UP protein coding gene may be performed using a recombinant vector containing the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1, but conventional methods in the art for inducing overexpression of the gene The method is not particularly limited thereto.

Deletion of the UP protein coding gene is performed using virus-induced gene silencing (VIGS), RNAi or antisense RNA, T-DNA insertion, endogenous transposon, irradiation, or mutagenesis through the CRISPR/Cas9 gene editing system It may be, but it is not particularly limited thereto, as long as it is a conventional method in the art for inhibiting gene expression.

As used herein, the term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide or a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form. A recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.

In the present invention, the "recombinant vector" used for overexpression of the UP protein-encoding gene may contain essential regulatory elements operably linked to express the gene insert, and the vector may include a plasmid vector, a cosmid vector, a bacteriophage vector and It may be any one selected from the group consisting of viral vectors.

The “recombinant vector” used for overexpression of the UP protein-encoding gene is functionally linked to an expression control sequence so that the UP gene can be expressed. For example, vectors include expression control elements such as promoters, operators, initiation codons, stop codons, polyadenylation signals, and enhancers, as well as signal sequences or leader sequences for membrane targeting or secretion, and can be prepared in various ways depending on the purpose. . In addition, vectors can include selectable markers, and vectors can replicate autonomously or integrate into host DNA. The vector of the present invention can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and ligation using enzymes generally known in the art.

The deletion of the gene encoding the UP protein is a virus-induced gene silencing (VIGS) system, siRNA, shRNA, miRNA, ribozyme, peptide nucleic acids (PNA), antisense oligonucleic acid, T- It may be to inhibit (inhibit) the expression of a UP protein-coding gene using a DNA insertion or genome / gene editing system, etc., but is not limited thereto, and conventional methods in the art for inhibiting gene expression Any way can be possible.

The "VIGS (Virus-induced gene silencing)" refers to a phenomenon in which the expression of endogenous plant genes of the introduced genes is suppressed when a plant gene is introduced into a viral vector and then infected with a plant. This is a type of PTGS (Post-transcriptionalgene silencing), and has the characteristics of post-transcriptional, RNA turnover, and nucleotide sequence-specific.

The "T-DNA (Tranffered DNA)" is a region of Ti plasmid that is transferred to plant cells when Agrobacterium tumefaciens, a soil bacterium equipped with Ti plasmid, infects plants, and is an incomplete tandem repeat sequence of 25 base pairs at both ends (boundary sequence, border sequence), and there are cytokine synthesis genes, auxin synthesis genes, or opin synthesis genes related to the tumorigenization of plant cells by Agrobacterium on the T-DNA.

The "small interfering RNA (siRNA)" refers to a small nucleic acid molecule with a size of about 20 nucleotides capable of mediating RNA interference or gene silencing.

When the siRNA is introduced into cells, it is recognized by dicer protein and degrades the biomarker gene, eventually inhibiting gene expression. The siRNA is a method of directly chemically synthesizing known siRNA (Sui G et al., (2002) Proc Natl Acad Sci USA 99:5515-5520), a method of synthesizing siRNA using transcription in an experimental environment (Brummelkamp TR et al., (2002) Science 296: 550-553), but is not limited thereto.

The "short hairpin RNA (shRNA)" refers to a short hairpin RNA in which the sense and antisense sequences of the siRNA target sequence are interposed with a loop consisting of 5 to 9 bases interposed therebetween.

The shRNA is to overcome the disadvantages of high cost of biosynthesis of siRNA, short-term maintenance of RNA interference effect due to low cell transfection efficiency, etc., using adenovirus, lentivirus and plasmid expression vector system from RNA polymerase promoter It can be introduced into a cell and expressed, and the shRNA is converted into a siRNA having a precise structure by a siRNA processing enzyme (Dicer or Rnase) present in the cell to induce silencing of the target gene.

The "miRNA (micro RNA)" is RNA that plays a role in controlling the gene expression of organisms, and the miRNA may consist of 20 to 25 nucleotides, whereas normal mRNA consists of thousands of nucleotides.

The "ribozyme" refers to RNA having an enzyme function that catalyzes biochemical reactions such as RNA splicing, tRNA synthesis, and protein synthesis.

The "PNA (peptide nucleic acids)" refers to artificial DNA developed through organic synthesis to compensate for the biochemical instability of DNA.

The "antisense" is also referred to as an antisense oligomer, and is hybridized with a target sequence in RNA by Watson-Crick base pairing to form an mRNA and RNA: oligomeric heteroduplex in the target sequence A sequence of nucleotide bases and a backbone between subunits It means an oligomer having The antisense may have exact sequence complementarity or near complementarity to the target sequence, block or inhibit translation of mRNA, and alter the processing of mRNA to produce splice variants of mRNA.

The "genome/gene editing system" is a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and deletion of one or more nucleic acid molecules by DNA cleavage ( Deletion, insertion, substitution, etc., knock-out or knock-in of a specific gene, or non-coding DNA that does not produce a protein It refers to a technology that can introduce mutations into sequences. For the purposes of the present invention, the genome editing may be to introduce mutations into plants using endonuclease proteins, such as Cas9 (CRISPR associated protein 9) protein and guide RNA. Also, the term 'gene editing' may be used interchangeably with 'gene editing'.

Deletion of the UP protein coding gene may be preferably carried out using a genome/gene editing system, which is the target of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 a complex of nucleotide sequence-specific guide RNA and endonuclease protein (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein It may be performed using ;.

The "target gene" refers to a part of DNA in the UP gene represented by SEQ ID NO: 2 in the genome of a plant to be corrected through the present invention, and may include both a coding region and a non-coding region. Depending on the purpose, those skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced, and in the present invention, the coding gene of the UP protein represented by SEQ ID NO: 4 or SEQ ID NO: 5 is used as a target sequence can be used

In the present invention, "guide RNA" is a short single-stranded RNA, including RNA specific to a target DNA among base sequences encoding a target gene, and complementary in whole or in part to the target DNA base sequence. It means ribonucleic acid that serves to guide the endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first region comprising a sequence complementary in whole or in part to a base sequence in a target gene and a second region comprising a sequence interacting with an endonuclease (particularly, an RNA-guided nuclease). Guide RNA (single guide RNA, sgRNA) form, but if the endonuclease can be active in the target sequence, it can be included in the scope of the present invention without limitation, and the type of endonuclease used together or endo It can be prepared and used according to known techniques in the art in consideration of the microorganism derived from the nuclease.

In addition, the guide RNA may be a guide RNA transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide duplex), or synthesized guide RNA, but is not limited thereto.

In the present invention, the guide RNA is designed specifically for the target nucleotide sequence of the UP protein coding gene consisting of the nucleotide sequence of SEQ ID NO: 4 or 5, and the guide RNA designed specifically for the nucleotide sequence of SEQ ID NO: 4 or 5 Forward and reverse oligos may be represented by SEQ ID NOs: 4 to 7, and are characterized by high InDel mutation induction efficiency.

In addition, in the present invention, the endonuclease protein is from the group consisting of Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) and functional analogues thereof It may be one or more selected, preferably a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni, Streptococcus thermophilus or Streptococcus aureus Cas9 protein derived from Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc. It may be one or more selected from the group, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI).

The Cas9 protein is an RNA-guided DNA endonuclease enzyme and induces double stranded DNA break. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein has a PAM sequence (NGG) It is cut by estimating between the 3rd and 4th base pairs from .

The guide RNA and the endonuclease protein may form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

In addition, it is an RNA sequence specific to a target region among nucleotide sequences constituting a UP protein (Unknown Protein, AT3G47850) coding gene, and the target region provides a guide RNA characterized in that the nucleotide sequence of SEQ ID NO: 4 or 5.

In the present invention, the guide RNA includes an endonuclease binding site in addition to the RNA sequence specific to the target region. The endonuclease may preferably be an RNA-guided nuclease, but is not limited thereto.

The guide RNA of the present invention may be in the form of a single guide RNA (sgRNA).

In addition, when the RNA sequence specific to the target region is synthesized, when the base of the target sequence corresponding to the 20th base from the PAM base is adenine (A), thymine (T) or cytosine (cytosine (C)), guanine It can be synthesized by replacing it with (guanine, G).

According to the experimental example of the present invention, the guide RNA according to the present invention induces an insertion-deletion (InDel) mutation in the target sequence of the UP protein coding gene consisting of the nucleotide sequence of SEQ ID NO: 4 or 5, and several bp It was confirmed that a deletion mutation of the size (500 bp) was caused.

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, thereby inducing insertion-deletion (InDel) mutations caused by incomplete repair induced in the DNA repair process. (non-homologous end joining) is a gene editing method.

A method for transducing the complex of the guide RNA and endonuclease protein into plant cells is the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio/Technol. 3:1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70), Agrobacterium tumefaciens (Agrobacterium tumefaciens) mediated gene transfer (incomplete) infection by bacteria and the like.

In addition, in the method of deleting the UP protein-encoding gene, a method using a recombinant vector containing DNA encoding a guide RNA specific to the target sequence and a nucleic acid sequence encoding an endonuclease protein is most preferred, , By introducing the recombinant vector into plant cells, it is possible to provide transgenic plants with reduced flowering time and improved resistance to drying stress.

The recombinant vector may be any plasmid including an expression system capable of inserting DNA encoding a guide RNA specific to the target DNA and a nucleic acid sequence encoding an endonuclease protein and expressing the same in a host cell. The plasmid contains elements for expression of a target gene, may include a replication origin, a promoter, an operator, a transcription terminator, and the like, and is incorporated into the genome of a host cell. A suitable enzyme site (e.g., restriction enzyme site) for introduction of and/or optionally a selectable marker to confirm successful introduction into a host cell and/or a ribosome binding site (RBS) for translation into a protein, and / or transcription regulators and the like may be further included.

In the method according to the present invention, introducing the recombinant vector into plant cells refers to a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vectors according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts ( Shillito et al., 1985, Bio/Technol. 3: 1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202: 179-185), various plant elements ( DNA or RNA-coated) particle bombardment (Klein et al., 1987, Nature 327: 70), Agrobacterium tumefaciens mediated genes by infiltration of plants or transformation of mature pollen or microspores It can be suitably selected from infection by a virus in metastasis (incomplete) (EP 0 301 316) and the like. Preferred methods according to the present invention include Agrobacterium mediated DNA delivery.

In the present invention, "plant" is meant to include not only mature plants but also plant cells, plant tissues, and plant seeds capable of developing into mature plants.

The plant cell may be a cultured cell, a cultured tissue, a cultured organ, or a whole plant, and the plant tissue may be a differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, microspores, and egg cells. , including various types of cells used for seed and culture, namely single cells, protoplasts, shoots and callus tissues. Plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

In the present invention, the plant is not particularly limited, and as an example, food crops including rice, wheat, barley, corn, soybean, potato, wheat, red beans, oats or sorghum; vegetable crops including Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots or bananas; flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one selected from the group consisting of feed crops including ryegrass, red clover, orchard grass, alpha alpha, tall fescue or perennial ryegrass, specifically Arabidopsis thaliana ), but is not limited thereto.

Transgenic plants into which the recombinant vector is introduced can be regenerated through processes such as callus induction, rooting, and soil purification using standard techniques known in the art, and asexual propagation methods such as cuttings and grafting and seeds are used. It can be produced by sexual reproduction method.

Another aspect of the present invention is (a) a complex of a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and an endonuclease protein (ribonucleoprotein); Or a UP protein represented by SEQ ID NO: 1 (Unknown Protein, AT3G47850) Recombinant vector containing a DNA encoding a guide RNA specific to the target sequence of the coding gene and a nucleic acid sequence encoding an endonuclease protein; plant Correcting the genome by introducing into cells; and

(b) regenerating the transgenic plant in which the genome has been corrected; and a method for producing a transgenic plant with improved resistance to drying stress and shortening of flowering period.

In the production method of the present invention, the UP protein may preferably include a protein consisting of the amino acid sequence of SEQ ID NO: 1 and a functional equivalent of the protein, and details are as described above.

In addition, in the production method of the present invention, the method of transforming the plant cells is as described above, and the method of regenerating the transformed plants from the transformed plant cells can be any method known in the art. can Transformed plant cells must regenerate into whole plants. Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vols. 1-5, 1983-1989 Momillan, N.Y.).

A "plant cell" used for plant transformation can be any plant cell. A plant cell is a cultured cell, cultured tissue, cultured organ or whole plant. "Plant tissue" refers to differentiated or undifferentiated plant tissues, such as but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used in culture, i.e., single cells, protoplasts. (protoplast), shoot and callus tissue. The plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

Inhibiting the expression of the gene encoding the UP protein in plant cells can shorten the flowering period and improve resistance to drying stress compared to non-transformed plants, that is, wild-type plants.

The deletion of the UP protein coding gene is VIGS (Virus-induced gene silencing), siRNA, shRNA, miRNA, ribozyme (ribozyme), PNA (peptide nucleic acids), antisense oligonucleic acid, T-DNA insertion or genome / gene correction ( genome/gene editing) system to transform plant cells to inhibit the expression of UP protein-encoding genes, but is not limited thereto, and gene expression inhibition techniques known in the art may be used.

Since the genome/gene editing system is the same as described in the method for controlling plant growth, flowering, and resistance to environmental stress, this reference is made.

The present invention provides a transgenic plant and its seed with improved resistance to drying stress and reduced flowering period prepared by the above method.

Transgenic plants with reduced flowering time and improved resistance to drying stress according to the present invention are characterized in that the expression of the UP protein-encoding gene is inhibited to shorten flowering time and increase resistance to drying stress.

The genome-edited plant having improved resistance to drying stress and shortened flowering period according to the present invention is a UP protein-coding gene corrected using the CRISPR/Cas9 system, and the AT3G47850 gene, an Arabidopsis-derived UP protein-coding gene, is It is a knock-out genome correcting plant.

Another aspect of the present invention relates to a transgenic plant with improved resistance to drying stress and reduced flowering time produced by the above production method.

In the present invention, the term "transformation" is a phenomenon in which, when DNA as a genetic material is injected into a living cell of a different lineage, the DNA enters the cell and changes hereditary character. Also called type conversion.

In the present invention, "transformation" of the plant may be performed by a transformation technique known to those skilled in the art. Specifically, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation method ( liposome-mediated method), in-planta transformation, vacuum infiltration method, floral meristem dipping method, or Agrobacterium spraying method can be used. And, more specifically, a transformation method using Agrobacterium or an Agrobacterium spraying method may be used.

In the present invention, "plant" is meant to include not only mature plants but also plant cells, plant tissues, and plant seeds capable of developing into mature plants.

The plant cell may be a cultured cell, a cultured tissue, a cultured organ, or a whole plant, and the plant tissue may be a differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, microspores, and egg cells. , including various types of cells used for seed and culture, namely single cells, protoplasts, shoots and callus tissues. Plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

In the present invention, the plant is not particularly limited, and as an example, food crops including rice, wheat, barley, corn, soybean, potato, wheat, red beans, oats or sorghum; vegetable crops including Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots or bananas; flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one selected from the group consisting of feed crops including ryegrass, red clover, orchard grass, alpha alpha, tall fescue or perennial ryegrass, specifically Arabidopsis thaliana ), but is not limited thereto.

In the present invention, since the transformed plant does not express the UP protein or the gene encoding it, the UP present in the plant through the CRISPR/Cas9 system containing the UP protein-encoding gene or the sgRNA targeting the UP protein-encoding gene expression can be inhibited.

According to the experimental example of the present invention, a transformant was prepared using the CRISPR/Cas9 system to prepare a transformant in which the Arabidopsis-derived UP gene was deleted. The degree of flowering in the control group (wild-type Arabidopsis thaliana) and transgenic plants (UP-CRISPR) was measured. As a result, it was confirmed that the flowering time of the transgenic plant (UP-CRISPR) proceeded significantly faster than that of wild-type Arabidopsis thaliana, and the expression of the FT gene related to flowering was also significantly higher (Figs. 8 and 9). In addition, in order to confirm the UP gene function in the defense response to drying stress, as a result of confirming the phenotype and survival rate of wild-type (Columbia-0, Col0) plants and transgenic plants (UP-CRISPR), transgenic plants (UP-CRISPR It was confirmed that the seeds of ) had a significantly higher survival rate than wild-type Arabidopsis thaliana (FIG. 15).

Through the above results, the transformed plant of the present invention suppresses the intracellular expression level of the UP gene, which is a gene for flowering time and dry stress resistance, promotes flowering time, and resistance to drying stress, which is a problem in the growth stage was confirmed to be able to improve.

Another aspect of the present invention is a complex of guide RNA and endonuclease protein specific for the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 (ribonucleoprotein ); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein It relates to a composition for genome correction that improves resistance to drying stress and shortens the flowering period of plants containing ; as an active ingredient. The composition of the present invention contains, as an active ingredient, an Arabidopsis thaliana free UP protein coding gene capable of controlling plant growth, flowering time and resistance to environmental stress. May increase resistance to stress

Hereinafter, the present invention will be described in more detail with reference to preferred embodiments. However, these examples are intended to explain the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited thereto.

Experiment material and experiment method

Plant materials and growing conditions

Seeds of Arabidopsis thaliana wild type (Columbia-0, Col0) and transgenic plants were sown at intervals of 3 × 3 mm. Seeds were surface sterilized in 5% sodium hypochlorite and 0.15% Triton-X 100 for 7 minutes, washed in distilled water, and then plated on MS plates (0.5× Murashige-Skoog salts, pH 5.7; 1.5% sucrose; and 0.6% agar). was bred in After germination and growth for 1 week under a light intensity of 110 μmolm ^-2 s ^-1 in the MS medium, transfer to a 22 ℃ chamber maintaining 65% humidity with a 16 h / 8 h day: night cycle and grow for 2 weeks. Arabidopsis thaliana transplanted into soil was grown in a plant growth control room with long-day conditions (16h light/8h dark, 70-90 uE m ^-2 sec ^-1 ) and environmental conditions of 22-23 ° C.

ABA, salt and drying stress treatment

For dry stress, the plants were grown for 2 weeks, filled with soil in a square pot, transferred to the pot, allowed to grow normally for 1 week, stopped watering for 14 days, watered again for 7 days, exposed to drying stress, and the survival rate was evaluated. .

For salt stress, the plants were grown in MS medium supplemented with 0 mM, 75 mM, 100 mM or 125 mM NaCl for 7 days, and then the germination rate and root length of the plants were measured.

In the ABA hormone treatment, the plants were grown in MS medium containing 0 μM, 0.2 μM or 0.5 μM of ABA (SIGMA) for 6 or 10 days, and then the germination rate of the plants was measured.

Tissues were sampled from plants after treatment with ABA, salt and drying stress, and then the tissues were frozen in liquid nitrogen. The frozen tissues were ground in a mortar and total RNA was extracted.

RNA extraction and RT-PCR

Total RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA, USA). The isolated total RNA was treated with DNase I (Qiagen, Valencia, CA, USA) to remove genomic DNA. First-strand cDNA was synthesized from 2 μg of total RNA (20 μl of RNA at a concentration of 0.1 μg/μl) by PCR using a cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). Specific primers were designed using the UP sequence. ACTIN2 was used as a control. Primers used for RT-PCR analysis are listed in Table 1 below.

For quantitative RT-PCR (qRT-PCR) analysis, first-strand cDNA was synthesized from 2 μg of total RNA by PCR using a cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA). QuantiSpeed SYBR No-Rox Mix (PhileKorea, Seoul, Korea) was used for the following qRT-PCR. Conditions of 50 ° C. for 10 minutes, 95 ° C. for 2 minutes, 40 cycles, 95 ° C. for 5 seconds, and 60 ° C. for 30 seconds were repeated. ACTIN2 was used for RNA generalization. The relative expression levels of all samples were automatically calculated using the CFX management program (Bio-Rad, Hercules, CA, USA) and biological transcription was performed three times. Primers used for qRT-PCR analysis are listed in Table 1. The synthesized PCR product was examined for expression level by electrophoresis.

Primer name Sequence (5'-3') sgR_U6_KpnI-F GTGGTACCCATTCGGAGTTTTTGTATCT (SEQ ID NO: 12) sgR_end_EcoRI-R ACGAATTCGCCATTTGTCTGCAGAATTG (SEQ ID NO: 13) UP-FL-F ATGCAAGTCGAAATCCCATCG
(SEQ ID NO: 14) UP-FL-R AATTCCATGGACTCTGAAGCCG
(SEQ ID NO: 15) ACTIN2-RT-F TGGGATGAACCAGAAGGATG
(SEQ ID NO: 16) ACTIN2-RT-R AAGAATACCTCTCTTGGATGTGC
(SEQ ID NO: 17) qRT-F GAAGTGGAGGAGAGATTACAAG
(SEQ ID NO: 18) qRT-R AAGAGAAGGACGAGTGGCTA
(SEQ ID NO: 19) ACTIN2-qRT-F CGAGAAGAACTATGAATTACCC
(SEQ ID NO: 20) ACTIN2-qRT-R GAGTTATAGGTTGTCTCGTGGA
(SEQ ID NO: 21)

Genotyping

The PCR reaction product and its distilled water dilution were mixed with a probe solution containing 5 nM Sytoㄾ 9 (Invitrogen ^TM ), 12.5 mM EDTA, and 5 mM Tris (pH 8.0) in a 5-fold volume, and the dilution factor of the final PCR product was 6X to 6X. After setting the temperature to 96X, a temperature response was performed using a Lightcyclerㄾ 2.0 instrument (Roche Diagnostics). The reaction was denatured at 95° C. for 5 seconds and annealed between complementary helices was induced at 60° C. for 1 minute, and fluorescence was measured while gradually raising the temperature at 0.1° C./sec. Genotype was determined based on the temperature at which each UP was denatured.

Example 1. Construction of UP gene targeting recombinant vector using CRISPR/Cas9 system

UP gene sgRNA selection

On the CRISPR RGEN Tools website (www.rgenome.net/Cas-designer), sgRNA specific to the target sequence (SEQ ID NO: 4 or SEQ ID NO: 5) was selected using the UP gene sequence, which is a homolog of the GPS2 gene of animals. The sgRNA was selected by reflecting various conditions (GC contents, out of frame score, mismatch number in genome sequence, etc.).

Production of guide oligonulceotides

Based on the target sequence of the UP gene, a DNA oligo was synthesized as follows.

sgRNA-1;

Forward oligo1: GATT GGTGGCGATATCTATGTACAG (SEQ ID NO: 6)

Reverse oligo1: AAAC CTGTACATAGATATCGCCAC C (SEQ ID NO: 7)

sgRNA-2;

Forward oligo2: GATT GGTTGGTACTCACATGGAAGG (SEQ ID NO: 8)

Reverse oligo2: AAAC CCTTCCATGTGAGTACCAAC C (SEQ ID NO:9)

The bold and underlined portions in the sequence correspond to sgRNAs excluding the PAM sequence, and the reverse oligo is the reverse complement to the forward oligo. Adapter sequences were added in front of the two oligos for subsequent ligation.

Construction of sgRNA-Cas9 plasmid

1 μl forward oligo (100 μmol/L), 1 μl reverse oligo (100 μmol/L), 1 μl 10X T4 DNA ligase buffer, 6.5 μl ddH₂0, 0.5 μl T4 polynucleotide kinase (PNK) (10 U/μl) (New England Biolab) was mixed and treated in a thermocycler (Biorad) at 37 ° C for 30 minutes and at 95 ° C for 5 minutes, and then at 0.2 ° C / s. Oligo pairs were phosphorylated to duplex by ramping down to 25 °C. The oligo duplex prepared through the above process was diluted 1:250. 0.5 μg psgR-Cas9-At vector, 1 μlBbsI (10 U/μl) (New England Biolab) 1 μl Alkaline phosphatase, calf intestinal (CIAP) (10 U/μl) (New England Biolab), 4 μl 10X NEBuffer 2.1, X μl ddH₂0 to make psgR-Cas9-AtBbsI was reacted at 37 °C for 2 hours to prepare a cut vector. Digested vector (10 ng), 1 μl 1:250 diluted oligo duplex, 1 μl 10X T4 DNA ligase buffer, 0.5 μl T4 DNA ligase (400 U/μl) (New England Biolab), ddH₂0 and treated at 16 ° C for 2 hours to form oligo duplex andBbsThe vectors cut by I are concatenated. E. coli (E. coli), and mini-prep was performed to obtain 1X sgRNA1-Cas9 plasmid and 1X sgRNA2-Cas9 plasmid.

Construction of sgRNA1 and sgRNA2 co-expression plasmids

To construct a plasmid co-expressing sgRNA1 and sgRNA, first, sgRNA2 was amplified from 1X sgRNA2-Cas9 plasmid through the following PCR.

AtU6-F-KpnI (SEQ ID NO: 10)

: 5'-gtggtaccCATTCGGAGTTTTTGTATCTTGTTTC-3'

sgR-R-EcoRI (SEQ ID NO: 11)

: 5'-acgaattcacgaattcGCCATTTGTCTGCAGAATTGGC-3'

0.4 μl AtU6-F-KpnI (10 μmol/L), 0.4 μl sgR-R-EcorI (10 μmol/L), 10 μl 2X PCR Buffer for KOD FX, 5 μl dNTP (2 mmol/l) 1 μl 1X sgRNA2 -Cas9 plasmid (10 ng), 0.5 μl KOD FX DNA polymerase (1 U/μl) (Toyoba). 94 °C 2 min, (98 °C 10 sec, 68 °C 30 sec) x 35 cycles, 68 °C 5 min, 12 °C. PCR was completed, PCR products were separated by electrophoresis, and DNA was extracted through a PCR clean-up system (Promega).

In order to ligation the PCR product (100 ng) of sgRNA2 recovered through the above process and 1X sgRNA1-Cas9 (500 ng) plasmid, 3 μl 10X NEB CutSmart buffer, 0.5 μl KpnI-HF (20 U/μl ) (New England Biolab), reacted with 0.5 μl EcoRI-HF (20 U/μl) (New England Biolab) at 37 ° C. for 2 hours, and separated the DNA digested with restriction enzymes by electrophoresis, followed by PCR clean-up DNA was extracted through the system (Promega).

sgRNA2 (10 ng) cut with restriction enzyme and 1X sgRNA1-Cas9 plasmid (10 ng) were mixed with 1.0 μl 10X T4 DNA ligase buffer and 0.5 μl T4 DNA ligase (400 U/μl) (New England Biolab). , 2X sgRNA-Cas9 plasmid was obtained by reacting at 16 ℃ for 2 hours. After transforming the product into E.coli , mini-prep was performed to amplify the 2X sgRNA-Cas9 plasmid.

Construction of recombinant vectors for plant transformation

Plant expression vector, pCAMBIA1300 vector (1 μg), 2X sgRNA-Cas9 plasmid (1 μg) were mixed with 5 μl 10X NEB CutSmart buffer, 1 μl HindIII-HF (20 U/μl) (New England Biolab), 1 μl EcoRI-HF (20 U/μl) (New England Biolab) at 37° C. for 2 hours, and DNA cut with restriction enzyme was separated by electrophoresis, and DNA was extracted through a PCR clean-up system (Promega). Mix pCAMBIA1300 vector (10 ng) digested with restriction enzyme, 2X sgRNA-Cas9 plasmid (20 ng), 1.0 μl 10X T4 DNA ligase buffer and 0.5 μl T4 DNA ligase (400 U/μl) (New England Biolab) Then, the reaction was performed at 16° C. for 2 hours to prepare plasmids into which the sgRNA1-Cas9 and sgRNA2-Cas9 genes were introduced into the pCAMBIA1300 vector. After transforming the product into E.coli , mini-prep was obtained by amplifying the pCAMBIA1300-2X sgRNA-Cas9 plasmid.

Example 2. Production of transgenic plants using recombinant vectors

Arabidopsis thaliana was transformed with the pCAMBIA1300-2X sgRNA-Cas9 plasmid prepared in Example 1 using Agrobacterium tumefaciens strain GV3101 by the floral dipping method.

The seeds of the transgenic plants were sterilized with 2% sodium hypochlorite for 15 minutes and sown on MS (Murashige and Skoog) medium supplemented with 30 mg/l hygromycin and 50 mg/l carbenicillin. did T1 plants germinated and grown in MS medium (0.5× Murashige-Skoog salts, pH 5.7; 1.5% sucrose; and 0.6% agar) under a light intensity of 110 μmolm ⁻² s ⁻¹ for 4 weeks were transferred to soil and planted for a long day. It was grown for 2 weeks in environmental conditions at 22 ° C. under conditions (16 hours of light / 8 hours of darkness).

Comparative Example 1. Construction of hos15 Transgenic Plants

The T-DNA insertion transformation mutant hos15-2 (GK_785B10) was purchased from Nottingham Arabidopsis Stock Center (NASC) (.info).

Experimental Example 1. Confirmation of transcription of transgenic plants through CRISPR/Cas9 system

In Example 2, 11 mutant candidates in which the UP gene was transformed with the CRISPR/Cas9 system were obtained. In 11 individuals, UP gene correction was confirmed by genotyping PCR analysis and RT-PCR analysis, and 5 individuals were selected. Specifically, when the sgRNA expression cassette constructed by designing adapter primers is properly recognized, the length of the original 1745 bp is edited by CRISPR/Cas9 gene scissors to appear as 500 bp. Confirmed.

1 is a diagram showing a CRISPR region (red) in a UP mutant allele and a UP primer used in the present invention. Figure 2 is a genotyping (Genotyping) analysis results for wild-type (Columbia-0, Col0) plants (WT) and transgenic plants (UP-CRISPR) prepared from Example 2. Figure 3 shows the results of RT-PCR analysis of wild-type (Columbia-0, Col0) plants (WT) and transgenic plants (UP-CRISPR) prepared from Example 2, and Figure 4 is wild-type (Columbia-0, Col0) It is the qRT-PCR analysis result of the plant (WT) and the transgenic plant (UP-CRISPR) prepared from Example 2. At this time, ACTIN was used as a control for RNA content. UP-CRISPR_1, UP-CRISPR_4, UP-CRISPR_5, UP-CRISPR_9, UP-CRISPR_10, UP-CRISPR_11 are the first (#1), four among the individuals of the transgenic plant (UP-CRISPR) prepared in Example 2 The ninth (#4), fifth (#5), ninth (#9), tenth (#10), and eleventh (#11) entities.

Looking at Figures 2 to 4, it can be seen that the bands appear at 500 bp in the 1st, 4th, 5th, 9th, and 10th plants among the transgenic plants (UP-CRISPR) prepared in Example 2. Through this, it was possible to confirm the indel of the UP gene in 5 individuals among the transgenic plants (UP-CRISPR) prepared in Example 2.

3 and 4, the transgenic plant (UP-CRISPR) (Example 2) is knocked out or knocked down by editing the UP gene from wild type (Columbia-0, Col0) plants through the CRISPR / Cas9 system (knockdown) can be confirmed.

Experimental Example 2. UP gene and Arabidopsis thaliana ( Arabidopsis thaliana ) relevance to the development of

The first, fourth, and fifth plants (T0) were obtained from the transgenic plants (UP-CRISPR) prepared in Example 2, and grown under a light intensity of 110 µmolm ^-2 s ^-1 in MS medium, followed by 16 h/8 h The cells were transferred to a 22° C. chamber maintained at 65% humidity with a day:night cycle and grown. Four-day-old plants were transferred to MS medium and hypocotyl growth was monitored for 7 days. Since the PWR-HDA9-HOS15 complex is known in relation to plant growth, the hos15 transgenic plants prepared in Comparative Example 1 were used as a comparison group, and wild-type (Columbia-0, Col0) plants were used as a control group. The experimental data showed the mean and standard error after 3 experiments.

For statistical analysis of the experiment, a paired t-test was used to confirm a significant difference in average values compared to the control group, and a p value lower than 0.05 was marked with *.

5 is a photograph of seedlings grown from a transgenic plant (UP-CRISPR) prepared in Example 2, a hos15 transgenic plant prepared from Comparative Example 1, and a wild-type (Columbia-0, Col0) plant for 7 days. 6 is a graph showing the measurement of hypocotyl germination length of transgenic plants prepared in Example 2 (UP-CRISPR), hos15 transgenic plants prepared from Comparative Example 1, and wild-type plants (Columbia-0, Col0), 7 is a graph showing root lengths of transgenic plants (UP-CRISPR) prepared in Example 2, hos15 transgenic plants prepared in Comparative Example 1, and wild-type (Columbia-0, Col0) plants.

Looking at Figures 5 to 7, in the case of the UP-CRISPR plant of Example 2 in which the UP gene insertion-deletion (Indel) mutation was induced through the CRISPR / Cas9 system, hypocotyl development was higher than that of the control group (Col-0) you can see it's slow On the other hand, there was no significant difference in root length between the three groups. Through the above results, it was confirmed that the UP gene is involved in the growth process of Arabidopsis thaliana , and the hypocotyl development is delayed when the expression of the UP gene is suppressed.

Experimental Example 3. UP gene and Arabidopsis thaliana ( Arabidopsis thaliana ) relevance to the flowering of

In Arabidopsis thaliana , the PWR-HDA9-HOS15 co-repressor complex has been found to be involved in regulating flowering, cold and drought stress, and is known to regulate the expression of AGL19, FT and GI, especially flowering control genes. .

The present inventors analyzed the flowering time between the 1st, 4th, 5th, and 9th plants (T0), wild-type (Columbia-0, Col0) plants and hos15 transgenic plants among the transgenic plants (UP-CRISPR) prepared in Example 2. For this purpose, it was performed on plants grown under LD (16 h light / 8 h dark) conditions of 22 ° C to 23 ° C. Flowering time was measured by counting the total number of rosettes and peduncle leaves when the height of the peduncle was about 3 to 5 cm, when the first flower bud was visible, and when the first flower bloomed.

8 and 9 are photographs of seedlings obtained by growing the transgenic plant (UP-CRISPR) prepared in Example 2, the hos15 transgenic plant prepared in Comparative Example 1, and the wild type (Columbia-0, Col0) plant for 25 days. This is a picture, and Figure 9 is grown under long-day conditions. 10 shows FT gene expression of seedlings grown for 25 days with transgenic plants (UP-CRISPR) prepared in Example 2, hos15 transgenic plants prepared in Comparative Example 1, and wild-type (Columbia-0, Col0) plants. It is a graph measured by qRT-PCR, and FIG. 11 is a photograph of the long angles of transgenic plants (UP-CRISPR) and wild-type (Columbia-0, Col0) plants prepared in Example 2.

Looking at Figures 8 and 9, it can be seen that the transgenic plants (UP-CRISPR) prepared in Example 2 bloom earlier than wild-type (Columbia-0, Col0) plants. It can be seen that the transgenic plant (UP-CRISPR) prepared in Example 2 has a flowering period similar to that of the hos15 transgenic plant.

Referring to FIG. 10, it can be seen that the transgenic plants (UP-CRISPR) prepared in Example 2 have higher FT gene expression than wild-type (Columbia-0, Col0) plants. In particular, it can be confirmed that the FT gene expression of individuals 1 and 4 of the transgenic plants prepared in Example 2 (UP-CRISPR) is higher than that of the hos15 transgenic plants.

Through the above results, the UP gene is involved in the flowering process of Arabidopsis thaliana , and is predicted to suppress the expression of the target gene by forming a complex with PWR-HDA9-HOS15.

Referring to FIG. 11, the transgenic plants (UP-CRISPR) prepared in Example 2 show a blunt end phenotype compared to wild-type (Columbia-0, Col0) plants.

Experimental Example 4. UP gene and Arabidopsis thaliana ( Arabidopsis thaliana ) to salt stress resistance

In order to confirm the relationship between the UP gene and salt stress, the present inventors under 0, 75, 100, and 125 mM NaCl conditions, wild-type (Columbia-0, Col0) plants, transgenic plants prepared from Example 2 (UP-CRISPR ), and phenotypic analysis of the hos15 transgenic plants prepared from Comparative Example 1 was performed.

12 shows a wild-type (Columbia-0, Col0) plant, a transgenic plant prepared from Example 2 (UP-CRISPR), and a hos15 transgenic plant prepared from Comparative Example 1 in the presence of 0 mM, 75 mM, 100 mM, or 125 mM It was grown for 7 days in MS medium supplemented with NaCl, and the degree of seed germination was measured.

13 shows wild-type (Columbia-0, Col0) plants, transgenic plants prepared in Example 2 (UP-CRISPR), and hos15 transformed plants prepared in Comparative Example 1 in MS medium supplemented with 0 mM or 150 mM NaCl. This is a photograph of the root length of the seedling after growing for 7 days.

Referring to FIG. 12, it can be confirmed that the transgenic plants (UP-CRISPR) prepared in Example 2 respond more sensitively to high salt conditions than the wild-type (Columbia-0, Col0) plants, resulting in a decrease in seed germination rate and root length. there is. It can be confirmed that the germination rate and root length of the hos15 transgenic plant prepared in Comparative Example 1 also decreased under high salt conditions. From this result, it can be seen that the UP gene participates in the interaction that occurs when the PWR-HDA9-HOS15 complex is subjected to salt stress. It can be confirmed that the UP gene functions as a positive regulator for salt stress.

Experimental Example 5. Confirmation of ABA sensitivity of UP gene

In order to study the in vivo function of the UP gene, wild-type (Columbia-0, Col0) plants in MS medium containing ABA, transgenic plants prepared from Example 2 (UP-CRISPR), and hos15 prepared from Comparative Example 1 Phenotypic analysis of transgenic plants was performed.

14 is a result of comparing the germination rates of wild-type (Columbia-0, Col0) plants, transgenic plants (UP-CRISPR) prepared in Example 2, and hos15 transgenic plants prepared in Comparative Example 1 under ABA treatment conditions.

Specifically, in MS medium containing 0 μM, 0.2 μM or 0.5 μM ABA, the wild-type (Columbia-0, Col0) plant, the transgenic plant prepared from Example 2 (UP-CRISPR), and the hos15 trait prepared from Comparative Example 1 As a result of germination of the transformed plants, as shown in FIG. 14, there was no significant difference between each group when ABA was not treated, but after ABA treatment, the transgenic plants prepared in Example 2 (UP-CRISPR) The germination rate was more sensitive to ABA than wild-type (Columbia-0, Col0) plants, and it was confirmed that the seed germination rate was lower.

In addition, it can be seen that the seed germination rate of the hos15 transgenic plants prepared in Comparative Example 1 is lower than that of the wild-type (Columbia-0, Col0) plants. , it can be confirmed that it functions as a positive regulator together with the PWR-HDA9-HOS15 complex.

Experimental Example 6. Confirmation of dry stress tolerance of UP gene

In order to confirm the function of the UP gene in the defense response to drying stress, wild-type (Columbia-0, Col0) plants, transgenic plants prepared from Example 2 (UP-CRISPR), and hos15 transgenic plants prepared from Comparative Example 1 After growing for 3 weeks, water supply was stopped for 14 days, and water was re-watered for 7 days and exposed to drying stress.

15 is a result of comparing the phenotypes of wild-type (Columbia-0, Col0) plants, transgenic plants (UP-CRISPR) prepared from Example 2, and hos15 transgenic plants prepared from Comparative Example 1 under dry stress conditions. .

As shown in FIG. 15, no phenotypic difference was observed between each group under conditions of sufficient water supply (before drought stress), but after drought stress, the transgenic plants prepared from Example 2 (UP-CRISPR ) can be confirmed that the survival rate is significantly higher than that of wild-type (Columbia-0, Col0) plants.

Although all 24 wild-type (Columbia-0, Col0) plants died due to drying stress, 20 of the 24 transgenic plants (UP-CRISPR) prepared in Example 2 survived.

After drought stress, the hos15 transgenic plant prepared in Comparative Example 1 was also confirmed to have a high survival rate. Taken together, it can be confirmed that the UP gene functions as a negative regulator along with the PWR-HDA9-HOS15 complex for drought stress and affects drought tolerance.

<110> Konkuk University Industrial Cooperation Corp <120> UP gene from Arabidopsis thaliana regulating resistance to environment stress in plant and uses its <130> HPC10063 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 1745 <212> PRT <213> Artificial Sequence <220> <223> UP Protein (Unknown Protein, AT3G47850) <400> 1 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1 5 10 15 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 20 25 30 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 35 40 45 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 50 55 60 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 65 70 75 80 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 85 90 95 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 100 105 110 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 115 120 125 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 130 135 140 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 145 150 155 160 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 165 170 175 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 180 185 190 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 195 200 205 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 210 215 220 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 225 230 235 240 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 245 250 255 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 260 265 270 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 275 280 285 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 290 295 300 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 305 310 315 320 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 325 330 335 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 340 345 350 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 355 360 365 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 370 375 380 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 385 390 395 400 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 405 410 415 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 420 425 430 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 435 440 445 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 450 455 460 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 465 470 475 480 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 485 490 495 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 500 505 510 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 515 520 525 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 530 535 540 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 545 550 555 560 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 565 570 575 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 580 585 590 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 595 600 605 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 610 615 620 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 625 630 635 640 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 645 650 655 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 660 665 670 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 675 680 685 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 690 695 700 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 705 710 715 720 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 725 730 735 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 740 745 750 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 755 760 765 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 770 775 780 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 785 790 795 800 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 805 810 815 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 820 825 830 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 835 840 845 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 850 855 860 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 865 870 875 880 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 885 890 895 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 900 905 910 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 915 920 925 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 930 935 940 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 945 950 955 960 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 965 970 975 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 980 985 990 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 995 1000 1005 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1010 1015 1020 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1025 1030 1035 1040 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1045 1050 1055 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1060 1065 107 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1075 1080 1085 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1090 1095 1100 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1105 1110 1115 1120 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1125 1130 1135 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1140 1145 1150 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1155 1160 1165 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1170 1175 118 0 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1185 1190 1195 1200 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1205 1210 1215 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1220 1225 1230 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1235 1240 1245 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1250 1255 1260 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1265 1270 1275 1280 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1285 1290 1295 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1300 1305 1310 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1315 1320 1325 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1330 1335 1340 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1345 1350 1355 1360 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1365 1370 1375 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1380 1385 1390 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1395 1400 1405 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1410 1415 1420 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1425 1430 1435 1440 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1445 1450 1455 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1460 1465 1470 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1475 1480 1485 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1490 1495 1500 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1505 1510 1515 1520 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1525 1530 1535 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1540 1545 1550 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1555 1560 1565 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1570 1575 158 0 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1585 1590 1595 1600 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1605 1610 1615 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1620 1625 1630 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1635 1640 1645 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1650 1655 1660 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1665 1670 1675 1680 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1685 1690 1695 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1700 1705 1710 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1715 1720 1725 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 1730 1735 1740 Ala 174 <210> 2 <210> 211> 1059 <212> DNA <213> Artificial Sequence <220> <223> UP CDS (Unknown Protein, AT3G47850) <400> 2 atgcaagtcg aaatcccatc gccgtatgat cacggaagca gaaggcaacg gcgaattcga 60 cgaacggaag aaacccaaaa gcagaagaag atggtggcga tatctatgta cagaggcaac 120 cttcacaaag ttcccgacgt acctcgccgg tggataatgc ctgaccgtaa tctctctttc 180 aaggatttca aatctcttct tcatcgccgt aaaaaagccc tttctcgtct cccccttaac 240 cctaatttga accttagcgt caagactgag ttggttactg atcaggagaa tccaattctt 300 ccatctgaag cgaacggttc ttctgggaag cagaagctat ttgaggtaaa gagagaggag 360 atttgtggga atcgggttaa gggagatgag aacaacgaca gaggttttga aggagctcga 420 tcagacggtg gagatcgtcc cgggagagtg acggaatcaa aggaaaccga taatgtgcca 480 cacaagtatg cggccaagga ggaggagacg aatgaagcag ctgaaaaagt accaagcgag 540 acagagttaa aacggaaaga agtggaggag agattacaag ttttgaatgc aaagaaacac 600 aatctagtcc aagtgcttaa gcagatttta aatgctgagg aagaattgaa aagacgcagc 660 tacatgcaac aacaaggaac caccgtagcc actcgtcctt ctcttccact ccatgtggat 720 gtctcgaatg actcaggagg taatgttggt actcacatgg aaggcgggga aactgatgat 780 gcagcgaatc ataataatgc tcaaactcgt actctgcttc gactgtgtgg cgcttcttca 840 tcatctgaat ctcctctgag aagagcagca gccttgtcac aacacaatat ggttccacat 900 acttctcgat ggagcccgct cgttggtc ct tctcaacccg gtcctgcagt cactgtttct 960 gcgtctggaa caaactacat tgcttcatct ccttcaccag cgggttttgg tggcacttct 1020 gttttcagag aatcacggct tcagagtcca tggaattag 1059 <210> 3 <211> 1745 <212> DNA <213> Artificial Sequence <220> <223> UP gDNA(Unknown Protein, AT3G47850) <400 > 3 atgcaagtcg aaatcccatc gccgtatgat cacggaagca gaaggcaacg gcgaattcga 60 cgaacggaag aaacccaaaa gcagaagaag atggtggcga tatctatgta cagaggcaac 120 cttcacaaag ttcccgacgt acctcgccgg tggataatgc ctgaccgtaa tctctctttc 180 aaggatttca aatctcttct tcatcgccgt aaaaaagccc tttctcgtct cccccttaac 240 cctaatttga accttagcgt caagactgag ttggttactg atcaggagaa tccaattctt 300 ccatctgaag cgaacggttc ttctgggaag cagaagctat ttgaggtaaa gagagaggag 360 atttgtggga atcgggttaa gggagatgag aacaacgaca gaggttttga aggagctcga 420 tcagacggtg gagatcgtcc cgggagagtg acggaatcaa aggaaaccga taatgtgcca 480 cacaagtatg cggccaagga ggaggaggta tgtttgaatt tctttgatat taatctctat 540 gtgaccttcc cgatagaatt tgagtactac ttagctgagt catagtag tgaag0catgtc tgaag0catgtc a ttgggaaaga ttatgtcatt ttaggtgaat 660 ttactgaagt taagtggctg atctgttgaa ttgtagaata aacgttgtat aagcgaagcc 720 gccatggtca caagcagttt gattcattga tgtgtgtgct caagtagttt aagtcacgtt 780 gatagatgtt gtgaatttgt gatgcaacaa gtctattgat gaaacaatca ggcaggctgc 840 aatagagtta ccaattaggg aaccttgaag gcttaaatct cgtagttatt ttctgtgaag 900 ttgttttgtt tctctatagc tttgttgttt ttcgtttcgt gactgtattc tcttttctcg 960 aaacagacga atgaagcagc tgaaaaagta ccaagcgaga cagagttaaa acggaaagaa 1020 gtggaggaga gattacaagt tttgaatgca aagaaacaca atctagtcca agtgcttaag 1080 caggtcagtt cagtgtctgc ccttctctct ataaaggtgt ttcacctgta taccgattcc 1140 catttattga ggtaatcata ctcgtcaaat taactgatac gcagatttta aatgctgagg 1200 aagaattgaa aagacgcagc tacatgcaac aacaaggaac caccgtagcc actcgtcctt 1260 ctcttccact ccatgtggat gtctcgaatg actcaggagg taatgttggt actcacatgg 1320 aaggcgggga aactgatgat gcagcgaatc ataataatgc tcaaactcgt actctgcttc 1380 gactgtgtgg cgcttcttca tcatctgaat ctcctctgag aagagcagca gccttgtcac 1440 aacacaatat ggtaaatatt caatatcttc attttaaaca acaatataac caaactactt 1500 agaatctctt tggtcaatct ctgattttgc attcatatat gtatatatga tgattgattg 1560 ttgttgctgt ttatcaggtt ccacatactt ctcgatggag cccgctcgtt ggtccttctc 1620 aacccggtcc tgcagtcact gtttctgcgt ctggaacaaa ctacattgct tcatctcctt 1680 caccagcggg ttttggtggc acttctgttt tcagagaatc acggcttcag agtccatgga 1740 attag 1745 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target sequence of UP gene_1 <400> 4 gtggcgatat ctatgtacag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> target sequence of UP gene_2 <400> 5 gttggtactc acatggaagg 20 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward oligo of sgRNA_1 <400> 6 gattggtggc gatatctatg tacag 25 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse oligo of sgRNA_1 <400> 7 aaacctgtac atagatatcg ccac 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward oligo of sgRNA_2 <400> 8 gattggttgg tactcacatg gaagg 25 <210> 9 <211> 25 <212> DNA <213> Arti ficial Sequence <220> <223> Reverse oligo of sgRNA_2 <400> 9 aaacccttcc atgtgagtac caacc 25 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> AtU6-F-KpnI <400 > 10 gtggtaccca ttcggagttt ttgtatcttg tttc 34 <210> 11 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> sgR-R-EcoRI <400> 11 acgaattcac gaattcgcca tttgtctgca gaattgg21 1 2 <210> > 28 <212> DNA <213> Artificial Sequence <220> <223> UP sgR_U6_KpnI-F <400> 12 gtggtaccca ttcggagttt ttgtatct 28 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> < 223> UP sgR_end_EcoRI-R <400> 13 acgaattcgc catttgtctg cagaattg 28 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> UP-FL-F <400> 14 atgcaagtcg aaatcccatc g 21 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> UP-FL-R <400> 15 aattccatgg actctgaagc cg 22 <210> 16 <211> 20 <212> DNA <213 > Artificial Sequence <220> <223> ACTIN2-RT-F <400> 16 tgggatgaac cagaaggatg 20 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> < 223> ACTIN2-RT-R <400> 17 aagaatacct ctcttggatt gtgc 24 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> qRT-F <400> 18 gaagtggagg agagattaca ag 22 < 210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> qRT-R <400> 19 aagagaagga cgagtggcta 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ACTIN2-qRT-F <400> 20 cgagaagaac tatgaattac cc 22 <210> 21 <211> 22 <212> DNA <213 > Artificial Sequence <220> <223> ACTIN2-qRT-R<400> 21 gagttatagg ttgtctcgtg ga 22

Claims (13)

A method for regulating the growth, flowering and resistance of a plant to environmental stress, comprising the step of regulating the expression of a gene encoding the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1. According to claim 1,
Regulating the expression of the UP protein coding gene,
i) deleting the UP protein coding gene to shorten the flowering period and enhance resistance to drying stress;
ii) introducing and overexpressing the UP protein coding gene to promote growth and enhance resistance to salt stress and ABA stress; According to claim 2,
The overexpression of the UP protein coding gene is performed using a recombinant vector containing the UP protein (Unknown Protein, AT3G47850) coding gene represented by SEQ ID NO: 1, characterized in that the growth, flowering and resistance of plants to environmental stress how to regulate. According to claim 2,
The deletion of the UP protein coding gene is VIGS (Virus-induced gene silencing), siRNA, shRNA, miRNA, ribozyme (ribozyme), PNA (peptide nucleic acids), antisense oligonucleic acid, T-DNA insertion or genome / gene correction ( A method for controlling the growth, flowering, and resistance to environmental stress of a plant, characterized in that it is performed using a genome/gene editing) system. According to claim 2,
The deletion of the UP protein coding gene is a guide RNA specific to the target sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a complex of endonuclease protein (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein A method for regulating the growth, flowering and resistance to environmental stress of a plant, characterized by using ;. According to claim 5,
The UP protein (Unknown Protein, AT3G47850) coding gene is a method for controlling the growth, flowering and resistance to environmental stress of plants, characterized in that SEQ ID NO: 2. According to claim 2,
The endonuclease (endonuclease) protein is a method for controlling the growth, flowering and resistance to environmental stress of the plant, characterized in that the Cas9 protein. According to claim 1,
The plant is Arabidopsis thaliana Method for controlling the growth, flowering and resistance to environmental stress of the plant, characterized in that. (a) a ribonucleoprotein complex of guide RNA and endonuclease protein specific to the target nucleotide sequence of the coding gene of UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1; Or a UP protein represented by SEQ ID NO: 1 (Unknown Protein, AT3G47850) Recombinant vector containing a DNA encoding a guide RNA specific to the target sequence of the coding gene and a nucleic acid sequence encoding an endonuclease protein; plant Correcting the genome by introducing into cells; and
(b) regenerating the transgenic plant in which the genome has been corrected; a method for producing a transgenic plant with improved resistance to drying stress and shortening of flowering period, comprising: According to claim 9,
The plant is Arabidopsis thaliana Method for producing a transgenic plant with improved resistance to shortening of flowering time and drying stress, characterized in that. A transgenic plant with improved resistance to drying stress and reduced flowering time prepared by the method of claim 9. UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1, a guide RNA specific to the target nucleotide sequence of the coding gene and an endonuclease protein complex (ribonucleoprotein); Or a recombinant vector containing DNA encoding a guide RNA specific to the target nucleotide sequence of the coding gene of the UP protein (Unknown Protein, AT3G47850) represented by SEQ ID NO: 1 and a nucleic acid sequence encoding an endonuclease protein A composition for genome correction that improves resistance to drying stress and shortens the flowering period of plants containing ; as an active ingredient. A kit for preparing a plant containing the composition according to claim 12 with improved resistance to shortening of flowering period and drying stress.

Images