CN106086063B - RNAi vector constructed based on isocaudarner and application thereof - Google Patents

Abstract

The invention discloses an RNAi vector constructed based on isocaudarner, which is characterized in that the construction method of the vector comprises the following steps: introducing a target fragment of the targeted gene into a transition vector to construct an RNAi vector capable of generating hairpin-structure RNA; the method of the invention utilizes the characteristics of the isocaudarner, only needs to obtain a section of DNA fragment by one-time PCR amplification, and performs enzyme digestion on the fragment once, thereby simplifying the construction process and improving the construction efficiency. Meanwhile, only two isocaudarner enzyme cutting sites are needed for forming a part of a hairpin structure (a target fragment-intron-inverted repeat target fragment) in the RNAi vector constructed by the method, so that more single cloning sites can be reserved, and the construction flexibility of the vector is improved. The RNAi vector constructed by the method can be widely used for function research, genetic modification, molecular breeding and the like of genes of multiple species, and has very important value in basic research and agricultural production.

Description

RNAi vector constructed based on isocaudarner and application thereof

(I) technical field

The invention relates to an RNAi vector, in particular to an RNAi vector constructed based on isocaudarner and application thereof.

(II) background of the invention

RNA interference (RNAi) is a ubiquitous sequence-specific post-transcriptional gene silencing in animals and plants triggered by homologous double-stranded RNA of target genes (Hannon, (2002) Nature,418: 244-251). It was first discovered in plants and has now become an important research tool in the post-genome era. RNAi has important application value in the aspects of plant functional genome, growth and development, virus resistance, quality improvement and the like.

In plants, RNAi is typically achieved by hairpin-structured RNA (hairpin RNA (hpRNA)) with double-stranded RNA (dsRNA) (Waterhouse and Helliwell, (2003) Nat Rev Genet,4: 29-38). Although antisense RNA-mediated gene silencing has been widely used as a phenomenon of RNAi in plant gene function analysis, hpRNA-mediated RNAi has higher efficiency (Chuang and Meyerowitz, (2000) P Natl Acad Sci USA 97: 4985-. hpRNA-producing vectors are typically cloned from a target gene into a set of reverse complementary nucleotide sequences, which are linked by an unrelated spacer sequence, and then expressed using a strong promoter. The promoter may be 35S CaMV (used mostly in dicots) or maize ubiquitin 1 (used mostly in monocotyledons). The unrelated spacer sequence in the middle of the reverse complement is preferably an Intron (Intron), which is important for the stability of the inverted repeat in Escherichia coli and for the efficiency of gene silencing in plants (Smith et al, (2000) Nature 407: 319-320; Wesley et al, (2001) Plant J27: 581-590). The vector for generating hpRNA has high stability and efficiency, but the vector construction is relatively complex, and a simple and efficient vector construction method for generating hpRNA is needed to be found.

A isocaudarner is a restriction enzyme that cleaves to produce the same sticky end. Commonly used isocaudarner enzymes include: BglII and BamHI, NheI and XbaI, SalI and XhoI, etc. These properties of the isocaudarner can be used to simplify the construction of an RNAi vector for hpRNA production.

Disclosure of the invention

The invention aims to provide an RNAi vector constructed based on isocaudarner and application thereof, which solve the technical problem that a plurality of target fragments (forward sequence, reverse sequence and intron) need to be cloned when a hairpin RNA vector is constructed and generated at present. The method only needs to clone a target fragment by using a PCR method to construct the RNAi vector with high interference efficiency.

The technical scheme adopted by the invention is as follows:

the invention provides an RNAi vector constructed based on isocaudarner, and the construction method of the vector comprises the following steps: introducing a target fragment of the targeted gene into a transition vector to construct an RNAi vector capable of generating hairpin-structure RNA;

an intron and a terminator are preset in the transition vector, isocaudarner enzyme cutting sites A1 and B1 are sequentially arranged at the 5 'end of the intron, isocaudarner enzyme cutting sites B2 and A2 are sequentially arranged at the 3' end of the intron, wherein A1 and A2 are one group of isocaudarner enzyme cutting sites, B1 and B2 are the other group of isocaudarner enzyme cutting sites, a letter has no meaning, and the enzyme cutting sites designed for conveniently expressing the two ends of the intron are named from two groups of isocaudarner enzymes; the 5 'end and the 3' end of the target fragment are respectively provided with an A1 enzyme cutting site, a B1 enzyme cutting site, an A2 enzyme cutting site and a B2 enzyme cutting site; through two times of enzyme digestion, connection and transformation reactions, the target fragment is respectively connected with the 5 'end and the 3' end of the intron to form a DNA fragment with a structure of 'target fragment-intron-inverted repetitive target fragment-terminator', and then the DNA fragment is connected into a final vector with a preset promoter through one time of enzyme digestion, connection and transformation reactions, or the DNA fragment and the designed promoter are connected into the final vector through three sections of connections, so that the RNAi vector is obtained.

Further, the isocaudarner is one of the following: (1) BglII and BamHI, (2) NheI and XbaI, (3) SalI and XhoI. Other restriction enzymes with similar properties are also possible.

Further, the intron nucleotide sequence is shown in SEQ ID NO. 1.

Further, the nucleotide sequence of the terminator is shown as SEQ ID NO. 2.

Further, the Vector was pGEM-T easy Vector.

Further, the final vector is a binary vector pCambia 1300-pZmUbi-G10.

Further, the RNAi vector construction method based on the isocaudarner construction comprises the following steps:

(1) taking pGEM-T easy Vector as a framework, connecting an intron and a terminator into the Vector, and simultaneously sequentially arranging enzyme cutting sites A1, B1, B2 and A2 at two ends of the intron to form a transition Vector 1; (2) carrying out enzyme digestion recovery on target genes with enzyme digestion sites A1 and B1 or A2 and B2 respectively arranged at two ends obtained by PCR amplification to obtain target fragments;

(3) then, carrying out enzyme digestion and recovery on the transition vector 1 by using two isocaudarner enzymes arranged on a target gene to obtain a vector;

(4) connecting and transforming the target fragments recovered in the step (2) and the step (3) with a vector to obtain a transition vector 2 containing a section of target gene;

(5) carrying out enzyme digestion recovery on the transition vector 2 by using corresponding isocaudarner provided with enzyme digestion sites of the same target gene, and carrying out connection transformation on the transition vector and the target fragment recovered in the step (2) to obtain a transition vector 3 with a structure of target fragment-intron-reverse repeated target fragment;

(6) and finally, carrying out enzyme digestion and recovery on the structure of the target fragment-intron-inverted repetitive target fragment and the terminator in the transition vector 3, and then connecting the structure and the terminator into a corresponding final vector to obtain the RNAi vector.

The invention also provides application of the RNAi vector constructed based on the isocaudarner in gene transformation. The method can be used for constructing an RNAi vector for generating hairpin structure RNA, and the RNAi vector is introduced into a plant or animal cell by a transgenic method to realize the silencing of a target gene.

The invention also provides application of the RNAi vector constructed based on the isocaudarner in preparation of transgenic plants. The RNAi vector can be constructed by the method, and is introduced into plant cells by a transgenic method to obtain a transgenic plant with a silenced target gene. The method can be used for the research of gene function, and can also be used for inhibiting and silencing the expression of target genes and improving crop traits.

Compared with the prior art, the invention has the following beneficial effects:

compared with the existing RNAi vector construction method for generating the hpRNA, the method provided by the invention utilizes the characteristics of the isocaudarner, only one section of DNA fragment is obtained through one-time PCR amplification, and the fragment is subjected to enzyme digestion once, so that the construction process can be simplified, and the construction efficiency can be improved. Meanwhile, only two isocaudarner enzyme cutting sites are needed for forming a part of a hairpin structure (a target fragment-intron-inverted repeat target fragment) in the RNAi vector constructed by the method, so that more single cloning sites can be reserved, and the construction flexibility of the vector is improved. The RNAi vector constructed by the method can be widely used for function research, genetic modification, molecular breeding and the like of genes of multiple species, and has very important value in basic research and agricultural production.

(IV) description of the drawings

FIG. 1: schematic diagram of RNAi vector construction based on isocaudarner.

FIG. 2: pGEM-T-LOG-intron-Ter vector structure diagram. LOG-Intron is the second Intron of the rice LOG gene. The 5' end of LOG-Intron is provided with 4 enzyme cutting sites which are respectively EcoRI, HindIII, BamHI and XhoI, wherein the EcoRI and the HindIII are used for constructing a final vector, and the BamHI and the XhoI are respectively one of two groups of isocaudarner enzymes and are used for connecting target fragments; the 3' end is sequentially provided with SalI and BglII enzyme cutting sites, and SalI and BglII are isocaudarner of XhoI and BamHI respectively. Between ApaI and SacI is an artificially synthesized terminator Ter.

FIG. 3: schematic structure of the RNA portion of the RNAi final vector that is ligated to the fragment of interest to generate the hairpin structure. p 35S: a 35S promoter; f: a fragment of interest targeted to a gene of interest; LOG-Intron: the second intron of the rice LOG gene; r: an inverted repeat sequence of a target fragment of a target gene; ter: a synthetic terminator. After the fragment R was ligated into the vector, the cleavage sites SalI and XhoI, BglII and BamHI were ligated and inactivated.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1 RNAi transition vector construction

Acquisition of the 2 nd intron sequence (nucleotide sequence shown in SEQ id No. 1) of rice LOG gene (gene ═ Os01g 0588900): PCR primers LOG-intron-F (5 'GAATTCAAGCTTGGATCCCTCGAGTCAAGGATTTCGGGATGACC) and LOG-intron-R (5' ACATGGGCCCAGATCTGTCGACTGGTCGCCATGTCA TTGG) were designed, and a genome fragment of 0.7kb in size was obtained by PCR amplification using the genome of commercial rice cultivar Xiushui 134 as a template. The PCR reaction conditions are as follows: 3 minutes at 95 ℃; repeating 33 cycles at 95 ℃ for 15 seconds, 66 ℃ for 15 seconds, and 72 ℃ for 1 minute; then 10 minutes at 72 ℃. Then, the fragment was cloned into pGEM-T easy Vector, and stored after sequencing verification for the subsequent transient Vector construction. This vector was named pGEM-T-LOG-intron. EcoRI, HindIII, BamHI and XhoI enzyme cutting sites are sequentially arranged at the 5' end of the fragment obtained by the PCR, wherein the EcoRI and HindIII are used for constructing a final vector, and the BamHI and XhoI are respectively one of two groups of isocaudarner enzymes and are used for connecting a target fragment; the 3' end is sequentially provided with SalI, BglII and ApaI enzyme cutting sites, wherein SalI and BglII are isocaudarner of XhoI and BamHI respectively and are used for connecting a target fragment, and ApaI is used for accessing a terminator.

The terminator is an artificially synthesized sequence Ter (SEQ ID NO.2), the 5 'end is provided with ApaI enzyme cutting sites, and the 3' end is provided with KpnI and SacI enzyme cutting sites.

Construction of a transition vector containing an intron and a terminator: carrying out double enzyme digestion on pGEM-T-LOG-intron by using EcoRI and ApaI, and recovering LOG-intron fragments with the size of about 0.7 kb; carrying out double enzyme digestion on pGEM-T-LOG-intron by using EcoRI and SacI, and recovering a pGEM-T vector with the size of about 3.0 kb; ter, which was artificially synthesized and ligated into pUC57 vector, was digested with ApaI and SacI, and the terminator was recovered. Then, the recovered vector and fragment were ligated in three steps, and the obtained vector was named pGEM-T-LOG-intron-Ter (FIG. 2), and the nucleotide sequence was shown in SEQ ID NO. 3.

Example 2 construction of RNAi vector for silencing OsTEL Gene of Rice

The OsTEL (also named PLASTOCHRON2) gene in rice encodes an RNA-binding protein. Taiji et al found that The rice with OsTEL gene loss mutation has increased leaf initial growth rate, increased leaf maturation and short Plant, indicating that it has The function of regulating leaf initial and maturation (Kawakatsu, (2006) The Plant Cell 18: 612-. However, since the function of the OsTEL gene in the above mutant is completely deleted, the phenotype of the expression downregulation of the OsTEL gene cannot be observed, and the corresponding relationship between the degree of downregulation and the phenotype is not observed. Therefore, constructing an RNAi vector that silences the OsTEL gene can help us to further study the function of the OsTEL gene.

Obtaining of a target fragment (nucleotide sequence shown in SEQ ID NO. 4) in OsTEL gene (gene ═ Os01g0907900 "): PCR primers OsTEL-RNAi-F (5 'GACCTCGAGGGCTTCAGCATCGTCGTCTACC) and OsTEL-RNAi-R (5' CTTGGATCCGTCCGTGAGCAGCT TGCCGT) were designed, and a 0.7kb fragment was obtained by PCR amplification using the total cDNA of commercial rice variety Xiushui-134 as a template. The PCR reaction conditions are as follows: 3 minutes at 95 ℃; repeating 33 cycles at 95 ℃ for 15 seconds, 66 ℃ for 15 seconds, and 72 ℃ for 1 minute; then 10 minutes at 72 ℃. Then, the fragment was cloned into pGEM-T easy vector, and stored after sequencing verification for the next transient vector construction. The 5 'end of the fragment obtained by the PCR is provided with an XhoI restriction site, and the 3' end is provided with a BamHI restriction site.

Construction of a transition vector containing a target fragment of a targeted OsTEL gene:

the first step is as follows: carrying out double enzyme digestion on pGEM-T easy Vector connected with a target fragment of a targeted OsTEL gene by using BamHI and XhoI, and recovering the target fragment;

the second step is that: carrying out double enzyme digestion on the pGEM-T-LOG-intron-Ter vector constructed in the example 1 by BglII and SalI, and recovering a vector fragment;

the third step: connecting the recovered target fragment with a vector, and naming the constructed vector as pGEM-T-LOG-intron-target fragment (inverted repeat) -Ter;

the fourth step: BamHI and XhoI carry out double enzyme digestion on pGEM-T-LOG-intron-target fragment (inverted repeat) -Ter vector, the vector fragment is recovered and is connected with the fragment in the first step, and the constructed transition vector is named as pGEM-T-target fragment-LOG-intron-target fragment (inverted repeat) -Ter.

Constructing RNAi final vector targeting OsTEL gene:

the binary vector pCambia1300-pZmUbi-G10 (International Pat. No. PCT/CN2012/087069: SEQ ID NO.49) was modified based on pCambia1300 and contained a glyphosate-tolerant gene (EPSPS) as a marker gene for transformation. The pGEM-T-target fragment-LOG-intron-target fragment (inverted repeat) -Ter vector is subjected to double enzyme digestion by BamHI and KpnI to obtain a fragment containing a structure of 'target fragment-LOG-intron-target fragment (inverted repeat) -Ter'. The 35S promoter p35S (SEQ ID NO.5, HindIII and BamHI) was synthesized to drive transcription of the above fragment. The final vector is constructed by three-section connection of the pCambia1300-pZmUbi-G10 vector which is subjected to double enzyme digestion by BamHI and KpnI, a target fragment-LOG-intron-target fragment (inverted repeat) -Ter structural fragment which is recovered by enzyme digestion and p 35S. The vector T-DNA comprises the following gene structure: "p 35S-fragment of interest-LOG-intron-fragment of interest (inverted repeat) -Ter-promoter-glyphosate-tolerant gene". This vector was named: pCambia1300-G10-OsTEL-RNAi (FIG. 3).

Example 3 construction of RNAi vectors for silencing maize Ms45 Gene

The Ms45 gene from maize is specifically expressed in the acrossociated flower, and maize plants with loss-of-function mutations in this gene are male sterile (Cigan et al, 2001). Only by constructing an efficient RNAi vector and completely silencing the Ms45 gene can the standard of production and use be achieved.

Obtaining a target fragment (the nucleotide sequence is shown as SEQ ID NO. 6) in Ms45 gene (GenBank: AF 360356.1): PCR primers MS45-RNAi-F (5 'GGTGCTCGAGCTCTAGATTAGTAAAAAGGGAGAGAGAGAG) and MS45-RNAi-R (5' TGGATCCTGCAGGTTCCTCTTCTCCATGCTGGTGGAC) were designed, and a fragment of 0.4kb in size was obtained by PCR amplification using the genome of Zhengdan 958, a commercial maize variety. The PCR reaction conditions are as follows: 3 minutes at 95 ℃; repeating 33 cycles at 95 ℃ for 15 seconds, 66 ℃ for 15 seconds, and 72 ℃ for 30 seconds; then 10 minutes at 72 ℃. Then, the fragment was cloned into pGEM-Teasy Vector, and stored after sequencing verification for the next transient Vector construction. The 5 'end of the fragment obtained by the PCR is provided with an XhoI restriction site, and the 3' end is provided with a BamHI restriction site.

Construction of a transition vector containing a fragment of interest targeting the Ms45 gene:

the first step is as follows: carrying out double enzyme digestion on pGEM-T easy Vector connected with a target fragment of the targeting Ms45 gene by using BamHI and XhoI, and recovering the target fragment;

the second step is that: carrying out double enzyme digestion on the pGEM-T-LOG-intron-Ter vector constructed in the example 1 by BglII and SalI, and recovering a vector fragment;

the third step: connecting the recovered target fragment with a vector, and naming the constructed vector as pGEM-T-LOG-intron-target fragment (inverted repeat) -Ter;

the fourth step: BamHI and XhoI carry out double enzyme digestion on pGEM-T-LOG-intron-target fragment (inverted repeat) -Ter vector, the vector fragment is recovered and is connected with the fragment in the first step, and the constructed transition vector is named as pGEM-T-target fragment-LOG-intron-target fragment (inverted repeat) -Ter.

Construction of RNAi final vector targeting Ms45 gene:

the binary vector pCambia1300-pZmUbi-G10 (International Pat. No. PCT/CN2012/087069: SEQ ID NO.49) was modified based on pCambia1300 and contained a glyphosate-tolerant gene (EPSPS) as a marker gene for transformation. And (3) carrying out enzyme digestion on the pGEM-T-target fragment-LOG-intron-target fragment (inverted repeat) -Ter vector to obtain a fragment containing a structure of 'target fragment-LOG-intron-target fragment (inverted repeat) -Ter'. The 35S promoter p35S (SEQ ID NO.5, HindIII and BamHI) was synthesized to drive transcription of the above fragment. The final vector is constructed by three-section connection of the pCambia1300-pZmUbi-G10 vector which is subjected to double enzyme digestion by BamHI and KpnI, a target fragment-LOG-intron-target fragment (inverted repeat) -Ter structural fragment which is recovered by enzyme digestion and p 35S. The vector T-DNA comprises the following gene structure: "p 35S-fragment of interest-LOG-intron-fragment of interest (inverted repeat) -Ter-promoter-glyphosate-tolerant gene". This vector was named: pCambia1300-G10-Ms45-RNAi (FIG. 3).

Example 4 transformation of Rice

The transgenic rice is obtained by adopting the prior art (Luzhong, Gong ancestor Xun (1998) Life sciences 10: 125-. Mature and full 'Xishui 134' seeds are selected to be hulled, and callus is generated by induction and is used as a transformation material. The vectors constructed in example 2 were used for agrobacterium-directed plating. A single colony is selected and inoculated, and agrobacterium for transformation is prepared. The callus to be transformed is put into the recombinant agrobacterium liquid with OD about 0.6 (preparation of the recombinant agrobacterium liquid, namely, the recombinant agrobacterium is inoculated into a culture medium and cultured at 28 ℃ until the OD is about 0.6, and the culture medium comprises 3g/L K₂HPO₄、1g/L NaH₂PO₄、1g/L NH₄Cl、0.3g/L MgSO₄·7H₂O、0.15g/L KCl、0.01g/LCaCl₂、0.0025g/L FeSO₄·7H₂O, 5g/L sucrose, 20mg/L acetosyringone, water as solvent, pH 5.8), combining the recombinant agrobacterium to the surface of the callus, and transferring the callus to a co-culture medium (MS +2mg/L2,4-D +30g/L glucose +)30g/L sucrose +3g/L agar (sigma 7921) +20mg/L acetosyringone), and co-culturing at 28 deg.C for 2-3 days. The transformed calli were rinsed with sterile water, transferred to selection medium (MS +2mg/L2,4-D +30g/L sucrose +3g/L agar (Sigma 7921) +20mg/L acetosyringone +2mM glyphosate (Sigma)), and selected for two months at 28 ℃ (subculture). Transferring the screened callus with good growth activity to a pre-differentiation culture medium (MS +0.1g/L inositol +5mg/L ABA +1mg/L NAA +5 mg/L6-BA +20g/L sorbitol +30g/L sucrose +2.5g/L gelrite), culturing at 28 ℃ for about 20 days, transferring the pre-differentiated callus to the differentiation culture medium, and irradiating 14 hours per day for differentiation and germination. After 2-3 weeks, transferring the resistant regenerated plants to a rooting culture medium (1/2MS +0.2mg/L NAA +20g/L sucrose +2.5g/L gelrite), strengthening and rooting the strong seedlings, finally washing the regenerated plants and removing agar, transplanting the washed regenerated plants to a greenhouse, selecting transgenic lines with high yield, large seeds or high biomass and the like which can improve the rice yield, and culturing new varieties. Obtaining the transgenic rice plant containing the transformation vector.

Example 5 identification of transgenic Rice

The rice is an inbred line, and the obtained homozygotes of the transgenic rice line with the target gene and the empty vector control line are used for phenotype analysis and comparison.

The transgenic rice line obtained in example 4 and the non-transgenic recipient line were compared for leaf number and plant height.

45 of the 60 transgenic lines (named OsTEL-i) transformed with pCambia1300-G10-OsTEL-RNAi vector obtained by us had higher initial development rate of leaf and leaf maturation and shorter plant height than the non-transgenic control.

The variation in leaf number and plant height for two of the representative lines is shown in the table below.

Table 1: comparison of two typical lines with non-transgenic control lines

	OsTEL-i-20	OsTEL-i-55
			Number of blades	21％	32％
Plant height	-32％	-49％

The parameters in the table were all tested in F-Test (P.ltoreq.0.05) and were all more than 5% different from the control. OsTEL-i is a T-DNA transformed plant of the vector pCambia1300-G10-OsTEL-RNAi, wherein the number (20, 55) following OsTEL-i is a random number for different lines, and is used for distinguishing different transformation events.

Example 6 transformation of maize

The transformation technology of corn is mature. For example, Vladimir Sidorov & David Duncan (in M.Paul Scott (ed.), Methods in molecular biology: Transgenic Maize, vol: 526; Yuji Ishida, Yukoh Hiei & Toshihiko Komari (2007) Agrobacterium-media transformation of mail. Nature Protoc ols 2:1614 and 1622. the basic method is as follows:

collecting Hi-II corn ear 8-10 days after pollination, and collecting all immature embryos (with size of 1.0-1.5 mm). The recombinant Agrobacterium obtained by transforming Agrobacterium with the T-DNA-containing vector constructed in example 3 was co-cultured with immature embryos on co-culture medium (MS +2mg/L2,4-D +30g/L sucrose +3g/L agar (sigma 7921) +40mg/L acetosyringone) for 2-3 days (22 ℃). Transfer immature embryos onto callus Induction Medium (MS +2mg/L2,4-D +30g/L sucrose +2.5g/L gelrite +5mg/L AgNO)₃+200mg/L acetosyringone), dark culture at 28 ℃ for 10-14 days. All calli were transferred to selection cultures with 2mM glyphosateOn the medium (same as callus induction medium), dark culture is carried out at 28 ℃ for 2-3 weeks. All tissues were transferred to fresh 2mM glyphosate in selection medium and incubated at 28 ℃ for 2-3 weeks in the dark. Then, all the screened viable embryonic tissues were transferred to a regeneration medium (MS +30g/L sucrose +0.5mg/L kinetin +2.5g/L gelrite +200mg/L acetosyringone) and cultured in the dark at 28 ℃ for 10-14 days, one strain per dish. Transferring the embryonic tissue to a fresh regeneration medium, and culturing for 10-14 days at 26 ℃ by illumination. All fully developed plants were transferred to rooting medium (1/2MS +20g/L sucrose +2.5g/L gelrite +200mg/L acetosyringone) and cultivated with light at 26 ℃ until the roots were fully developed. Obtaining the transgenic corn plant containing the transformation vector.

Example 7 identification of transgenic maize

We pollinated and harvested the transgenic maize obtained in example 6 using the method of artificial pollination, and then planted the harvested T1 generation seeds for observation and statistical analysis.

Of the 58 transgenic lines we obtained transformed with pCambia1300-G10-Ms45-RNAi vector (designated Ms45-i), 28 lines were completely male sterile, 20 were partially male sterile, and 10 were fertile comparable to the non-transgenic controls.

Claims (5)

1. An RNAi vector constructed based on isocaudarner, which is characterized in that the construction method of the vector is as follows: introducing a target fragment of the targeted gene into a transition vector to construct an RNAi vector capable of generating hairpin-structure RNA;

an intron and a terminator are preset in the transition vector, isocaudarner enzyme cutting sites A1 and B1 are sequentially arranged at the 5 'end of the intron, isocaudarner enzyme cutting sites B2 and A2 are sequentially arranged at the 3' end of the intron, wherein A1 and A2 are a group of isocaudarner enzyme cutting sites, and B1 and B2 are the other group of isocaudarner enzyme cutting sites; the 5 'end and the 3' end of the target fragment are respectively provided with an A1 enzyme cutting site, a B1 enzyme cutting site, an A2 enzyme cutting site and a B2 enzyme cutting site; respectively connecting a target fragment to the 5 'end and the 3' end of an intron through two times of enzyme digestion, connection and transformation reactions to form a DNA fragment with a structure of 'target fragment-intron-inverted repetitive target fragment-terminator', and connecting the DNA fragment to a terminal vector with a preset promoter through one time of enzyme digestion, connection and transformation reactions, or connecting the DNA fragment to the terminal vector through three sections of connection with the designed promoter to obtain an RNAi vector; the intron nucleotide sequence is shown in SEQ ID NO. 1; the isocaudarner is one of the following: (1) BglII and BamHI, (2) NheI and XbaI, (3) SalI and XhoI; the final vector is a binary vector pCambia 1300-pZmUbi-G10; the target gene is rice OsTEL gene or maize Ms45 gene.

2. The RNAi vector constructed based on a isocaudarner of claim 1 wherein the terminator nucleotide sequence is represented by SEQ ID No. 2.

3. The RNAi vector of claim 1, constructed based on the isocaudarner, wherein the construction method comprises:

(1) taking pGEM-T easy Vector as a framework, connecting an intron and a terminator into the Vector, and simultaneously sequentially arranging enzyme cutting sites A1, B1, B2 and A2 at two ends of the intron to form a transition Vector 1;

(2) carrying out enzyme digestion recovery on target genes of which two ends obtained by PCR amplification are respectively provided with enzyme digestion sites A1 and B1 or A2 and B2 to obtain target fragments;

(3) then, carrying out enzyme digestion and recovery on the transition vector 1 by using two isocaudarner enzymes arranged on a target gene to obtain a vector;

(4) connecting and transforming the target fragments recovered in the step (2) and the step (3) with a vector to obtain a transition vector 2 containing a section of target gene;

(5) carrying out enzyme digestion recovery on the transition vector 2 by using corresponding isocaudarner provided with enzyme digestion sites of the same target gene, and carrying out connection transformation on the transition vector and the target fragment recovered in the step (2) to obtain a transition vector 3 with a structure of target fragment-intron-reverse repeated target fragment;

(6) and finally, carrying out enzyme digestion and recovery on the structure of the target fragment-intron-inverted repetitive target fragment and the terminator in the transition vector 3, and then connecting the structure and the terminator into a corresponding final vector to obtain the RNAi vector.

4. Use of the isocaudarner-based RNAi vector of claim 1 for gene transformation.

5. Use of the RNAi vector constructed based on the isocaudarner of claim 1 in the preparation of transgenic plants.

Images