KR101040579B1 - Plant transformation vector and marker free transgenic plants using stress inducible site-specific recombination - Google Patents

Abstract

The present invention relates to a vector for producing a plant selection marker removal plant transformant and a method for producing a plant transformant using the same, the composition of which is a stress-inducible promoter for producing a marker-free transformed plant. By using the expression of the site-specific recombinant genes to produce a vector that can remove the selection marker, using the vector transformant spontaneously removed the plant selection marker gene by the stress generated during the transformation process It provides a process for producing, and a method for removing plant selection markers by re-differentiating the transformants obtained by using the selection label.

This method has a higher transformation efficiency than the cotransformation method used to remove the plant selection marker in the plant transformants, the production of the selection marker removal transformants is simple, and can be applied to self and other modified plants.

Stress-inducible promoters, starter removal expression vectors, starter removal plants,

Description

Plant transformation vector and marker free transgenic plants using stress inducible site-specific recombination

The present invention relates to a vector for producing a plant selection marker removal plant transformant and a method for producing a plant transformant using the same, more specifically, a site-specific recombinase by a stress inducible peroxidase promoter. The present invention relates to a vector capable of removing plant selection markers by expressing (site specific recombinase), and a selection marker removal transgenic plant using the same and a method of manufacturing the same.

To date, most genes used as selection markers for plant transformation are very useful as antibiotic or herbicide resistance genes, but there are disadvantages. Selection of transformed cells with antibiotics and herbicides can have adverse effects on proliferation or differentiation, as well as adventitious shoots (Ebinuma H, Sugita K, Matsunaga E and Yamakado M). (1997) Selection of marker-free transgenic plants using the isopentenyl transferase gene.Proc. Natl. Acad. Sci. USA 94: 2117-2121). In addition, there are controversial environmental and human hazards due to the possibility of these genes being expressed continuously transferred to other organisms outside the laboratory.

To date, the removal of selection marker genes from transgenic plants has taken two broad approaches. First, co-transformation is used to insert desired genes and markers into different chromosomes of the plant and then to separate them by hybridization. Another method is site-specific recombination systems. Recombination is used to induce the activity of site-specific recombinase enzymes to cut two recognition sites located on both sides of the selection marker.

A number of site-specific recombinases that function in plants have been reported, typically the bacteriophage P1-derived Cre-lox system (Dale, EC and Ow, DW (1991) Gene transfer with subsequent removal of the selection gene from the host genome.Proc.Natl.Acad.Sci.USA 10: 558-562), FLP-frt system derived from Saccharomyces cerevisiae (O'Gorman S., Fox DT and Wahl GM (1991) Recombinase-mediated gene activation and site-specific integration in mammalian cells.Science. 251: 1351-1355) and R-RS systems derived from Zygosaccharomyces rouxii (Onouchi H, Yokoi K, Machida C, Matsuzaki H, Oshima Y, Matsuoka K, Nakamura K, Machida Y. (1991) Recombinase -mediated gene activation and site-specific integration in mammalian cells.Nucleic Acid Res. 19: 6373-6378).

In case of removing the selection marker of the transformant using a site-specific recombinase, it is very useful to induce the expression of the recombinant gene at the desired time and to remove other unnecessary genes. The promoter is being used together. Attempts to conjugate, for example, heat shock inducible promoters or compounds, dexamethasone inducible promoters, which have been used for biological assays of cytokinins in plants to the induction of site specific recombinant enzymes ( Yong W., Bojun C., Yuanlei H., Jingfu L. and Zhongping L. (2005) Inducible excision of selectable marker gene from transgenic plants by the Cre / lox site-specific recombination system.Transgenic Res. 14: 605-614 Sreekala C., Wu L., Gu K., Wang D., D Tian D. and Yin Z. (2005) Excision of a selectable marker in transgenic rice (Oryza sativa L.) using a chemically regulated Cre / loxP system Plant Cell Rep 24: 86-94) is currently actively attempted. However, there is no systematic method for making selection marker-free plants by using a site-specific recombination system, and it has a weak point to undergo regeneration and agroinfiltration after transformation.

Looking at the current status of domestic and international research, the Korea Advanced Institute of Science and Technology studied the method of removing selection markers by the co-transformation conversion system, and certain companies in Korea used agro-infiltration to insert genes into plants, Plants to be removed and methods of making them have been developed. In addition, Japanese companies have attempted to develop a negative selection marker and a compound inducible self-selection marker removal system. In addition, Chinese universities studied selection marker removal using high temperature inducible promoter expression, and attempted to develop crops using compound induced self-selection marker removal vector in Singapore. In addition, the United States University studied the selection marker removal using recombinant genes, and developed a compound-induced self-selection marker removal system.

On the other hand, if you look at the domestic and international patent applications related to this, in 2003, Nexzen, including Lee Sun-kyo, described a new method for the production of marker-free transgenic plants and applied for a patent (see Korean Patent Application No. 1020030064926 in 2003), Korea Advanced Institute of Science and Technology has filed a patent for a vector for the production of a transgenic plant from which a selection marker gene has been removed and a method for producing a transformant using the same (2003 Korean Patent Application No. 1020030076449). In addition, in 2001, Sagita et al. (Nippon paper Industries Co.) developed and applied for a plant transformation vector that conditionally removes a marker gene (US patent application US6326192). Et al. Have filed patent applications for inducible site-specific recombination by activating and eliminating the transgenes of transgenic plants at Moller et al., Rockefeller University (US Patent Application US6723896; Inducible site-). specific recombination for the activation and removal of transgenes in transgenic plants). In addition, in 2007, Zuo et al. Filed a patent using a compound inducible promoter to produce transgenic plants with markers not expressed at Rockefeller University (US patent application US7230157; Chemical inducible promoter). used to obtain tansgenic plants with a silent marker and organisms and cells and methods of using same for screening for mutations).

In this study, we developed a plant transformation vector combining a sweet potato-derived stress-induced promoter induced by various environmental stresses and a location-specific recombination system (FLP-frt), and using the expression vector. In the tobacco plants, heterozygous marker-free plants were obtained by removing markers by expression of recombinant genes under stress of the transformation process, and by using gene separation by seeds. Homozygous marker free plants were obtained. In addition, the transformant of the vector was developed through a recombinant enzyme expression-induced regeneration process using a hydrogen peroxide compound to develop a selection marker-free plant, and the seed marker free state was performed to confirm that the selection marker-free state was stably maintained. Successfully completed.

It is an object of the present invention to provide a self-cleaving plant transformation vector combining a stress inducible promoter and a recombinant system for the production of a selection marker removal plant. Another object of the present invention is to provide a method for producing a transformant from which a selection label and a recombinase gene are removed using a plant transformation vector.

In order to achieve the above object, the present invention provides an expression vector for plant transformation capable of removing a selection marker, including a stress flow promoter, a site-specific recombinase gene, a recombinase recognition site.

The promoter is preferably a stress inducible peroxidase promoter, more preferably a stress flowable peroxidase promoter derived from sweet potato.

The recombinase gene is preferably a site specific recombinase gene expressed from the stress flow peroxidase promoter, and more preferably a site specific recombinase FLP gene. In addition, the recognition site is preferably a nucleotide sequence of the recombinant enzyme recognition site frt.

The present invention provides an expression vector pWHF-P for plant transformation (Accession No .: KACC 95088P). The expression vector for plant transformation was deposited on July 22, 2008 in the microbial deposit institution attached to the Institute of Agricultural Biotechnology.

In addition, the present invention provides a microorganism of the genus Agrobacterium sp . Transformed with the expression vector pWHF-P for plant transformation and used as a plant carrier.

The microorganism is preferably the expression vector pWHF-P transformed Agrobacterium Tome Pacific Enschede LBA4404 (Agrobacterium tumefaciens LBA4404) by.

The present invention also provides a transgenic plant that can be transformed with microorganisms of the genus Agrobacterium to remove the selection marker. The plant includes both a plant that can be self-modified and other fertilized, and preferably includes tobacco.

In addition, the present invention (1) cutting the leaves of the plant; (2) infecting the microorganism of the genus Agrobacterium ; (3) inducing re-differentiation using a selective medium with hydrogen peroxide added; (4) induce and purify roots; And (5) analyzing the transformation of the gene; It provides a method for producing a plant that can remove the selection marker made of a process.

The plant can be prepared using both self-modifying and other-modifiable plants, preferably tobacco.

Hereinafter, the present invention will be described in detail.

The present invention comprises the steps of: i) preparing a plant transformation vector comprising a stress inducible promoter (SWPA2 promoter), a recombinant gene and a recognition site (FLP / frt) and a selectable marker gene (hph); ii) introducing the expression vector into a plant to prepare a transformant; iii) Selected marker-free plant line from which exogenous genes were removed by using the genetic analysis of the transformant, and cultured the selection marker-free plant by separating the seed after incubation. Making step; iv) transforming the transformant into a compound-treated recombinant enzyme expression induction medium to produce a selection marker-free plant from which foreign genes have been removed.

As described above, in the present invention, a vector system capable of selectively self-cutting foreign genes such as antibiotic selection markers by stress-induced expression was prepared and introduced into plants to prepare selection marker-free plants. This vector system is efficient and simple because it is possible to remove the selection marker by the general transformation process without any other treatment or process to remove the selection marker. In addition, since high-efficiency selection marker-free plants can be produced through the regeneration process using compound treatment, there is an advantage that it can be used not only for self-modifying plants but also for the production of selection marker-free transformants for tagase plants.

Hereinafter, the present invention will be described in more detail with reference to Examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example  1. Self-cutting type Selection Marker  Preparation of vector for plant transformation for removal

The plant transformation vector for producing a self-cutting starter marker-free plant according to the present invention is shown in schematic diagrams in FIGS. 1 and 2. The transformation vector was designed to express the positional recombination enzyme FLP by the stress-inducible promoter and to cleave the recombinant enzyme recognition site frt upstream of the hygromycin resistance gene and downstream of the site-specific recombination gene. Hereinafter, the manufacturing process of the detailed vector will be described in detail.

The preparation of the vector involves first the 35S promoter, the frtm recognition site, the vector clone with the hygromycin antibiotic resistance gene and the polyA tail gene, the peroxidase promoter and the FLP to be placed on the right border (RB) of the base vector. Recombinant enzyme gene, clone with Nos terminator site, frt recognition site and clone with bar gene and Nos terminator were respectively made to connect plant transformation vector pBI121 to the basic skeleton and completed (see Table 1, Figures 1 and 2). ).

(1-1) P35S - frtm - HPT - pA  Preparation of Genetic Clone Vectors

PCR was performed using pCAMBIA 1304 as a template DNA in order to obtain 35S promoter and hygromycin resistance gene ( HPT ). The amplified reactants were cloned into pGEM-T easy vectors (promega, USA), respectively, according to the manual provided by the supplier, and the sequencing confirmed that the DNA sequences of interest were correctly amplified. Since primer sequences for cloning the HPT gene and 35S promoter include restriction enzymes ClaI , Hind III sites, and Spe I and Bam HI sites, they were cloned into pBluescript SK after treatment with restriction enzymes. The frt DNA sequence was obtained by linking two primers compatible with the restriction enzyme Hind III and Bam HI, followed by Hind III, BamH I, of the vector to which the 35S promoter and the hygromycin resistance gene ( HPT ) were linked. The restriction enzyme site was linked.

(1-2) SWPA2 - FLP - Nost  Preparation of Genetic Clones

The position-specific recombinant gene (FLP) was PCR-reacted using pOG44 carrier DNA as a template DNA to obtain a DNA reaction of about 1.2 Kb having a BamHI at 5 'end and a SacI restriction enzyme site at 3' end. The obtained DNA product was cloned into the pBI121 vector using restriction enzymes BamHI and SacI restriction enzyme cleavage sites, and the P35S-FLP-NosT site was partially cut and purified by restriction enzymes HindIII and EcoRI, and then cloned into pBlueScript vector. In addition, the stress-inducing promoter (peroxidase promoter) was amplified by PCR using a primer synthesized so that the restriction enzyme Cla I, BamHI position is included in the nucleotide sequence after extracting the DNA from the chloroplast of sweet potato. The amplified DNA was cloned into the pGEM-T easy vector, treated with restriction enzymes, and replaced with the 35S promoter region of the pBlueScript-P35S-FLP-NosT vector. The DNA sequence was confirmed to be correct by sequencing. .

(1-3) Preparation of frt-Bar-pA Gene Clones

To obtain Bar gene and PolyA tail region, herbicide resistance gene, primers were synthesized to make restriction enzymes SpeI and XbaI sites at 5 'end and 3' end and PCR reaction was carried out using pCAMBIA3301 carrier as a template. . The PCR amplified DNA reaction of about 750bp was cloned into the pGEM-T easy vector to confirm that the target DNA was electrophoresed after appropriate restriction enzyme cleavage, and cloned into pBlueScript KS. The nucleotide sequence of frt was synthesized by linking a frt DNA fragment having a base end region complementary to the restriction enzyme sites XmaI and SpeI present in pBlueScript KS, and then inserted into a pBlue-BarpA vector. DNA sequence was confirmed to be correct.

(1-4) pWHF -P Manufacture of Plant Vectors

Using the plant transformation vector pBI121 as a base vector, the pBlue-frt-Bar-pA vector replaced the frt-Bar-pA site with pBI121 using restriction enzymes XmaI and SacI, and the replacement of the SWPA2-FLP site was ClaI and SmaI. Restriction enzymes were used. In addition, the substitution of 35S promoter-frt-HPT-pA DNA was performed by complementary conjugation using NheI / SpeI and ApaI restriction enzymes to complete the plant transformation vector pWHF-P (see SEQ ID NO: 1 in Sequence Listing).

Example 2: Preparation of Transgenic Tobacco Using pWHF-P Vector

(2-1) Production of Tobacco Transformant

The pWHF-P plant expression vector prepared in Example 1 was subjected to a freeze-thaw method in Agrobacterium tumefaciens LBA4404 (H, R. and Willmitzer L. (1988) Nucleic Acids Res 16: 9877). After transformation, the cells were co-cultured with the transformed Agrobacterium solution and tobacco ( Nicotiana tabaccum cv Xanthi) leaf sections.

Control wild-type tobacco was co-cultured for 2 days in MS medium supplemented with 1 mg / L NAA, 1 mg / L BA, 10 g / L sucrose and 8 g / L agar. 1 mg / L NAA, 1 mg / L BA, 300 mg / L carbenicillin, 10 mg / l hygromycine, 10 g / L sucrose to obtain transformed regenerated plants , 8 g / L agar was incubated in MS medium and then subcultured every three weeks. Regenerated shoots were transferred to MS medium containing 300 mg / L carbenicillin, 10 mg / L Phosphinothricin (PPT), 10 g / L sucrose, and 8 g / L agar to induce rooting. Cultures were incubated at the conditions of 26 ℃, 16 hours photoperiod / 8 hours dark cycle, rooted individuals were transplanted into pollen after acclimatization and grown in a greenhouse above the average temperature of 26 ℃.

(2-2) Transformant Analysis by PCR

In order to confirm the transfection of the transgenic tobacco prepared in Example 2-1, when the leaves of the re-differentiated publications first selected in the hygromycin medium grew to 4 to 5 leaves, the leaves of the plants were cut to genomic DNA. After isolation, the transformants were analyzed by PCR using the specific promoters of the hygromycin resistance gene (hpt), 35S promoter, and herbicide resistance gene (Bar) described in Table 2 (see FIG. 3). As a result, it was confirmed that 0.8 kb of hygromycin resistance gene was detected and transformed in all the tested plants. In addition, four out of twelve of the 35S promoters and PCR primers specific to the Bar gene detected DNA bands of 0.7 kb and 1.1 kb when autologous cleavage was performed by expression of a position-specific recombinant gene. These results indicate that in some individuals, two or more copies of the vector were inserted, and some of them removed the selection markers.

Example 3: Selection Marker Free Transformant Identification and Transformant Analysis by Seed Separation

(3-1) using base analysis pWHF -P of vector Inside the plant  Cutting verification

In order to confirm whether the PCR reaction product (B1 of FIG. 3) performed using the 35S promoter performed in Example 2-2 and the primer in the nucleotide sequence in the Bar gene is cleavage at the frt site by the action of FLP enzyme, After cloning into a pGEM-easy vector according to the manual, nucleotide sequences were determined using M13 reverse and forward primers. As a result of the sequencing, it was possible to confirm the FRT site present in the rear part of the 35S primer and the front of the bar gene, and it was confirmed that the selection marker was removed at the correct position by sequencing the FRT (see FIG. 4).

The transgenic tobacco prepared in Example 2-1 was first selected in hygromycin medium and transferred to a pollen, and then analyzed by Trait LL test kit (SDI, USA) and 0.1% Bastar (to determine the expression of bar gene). Basta) herbicide (Kyung-Nong, Korea) suspension was sprayed on the foliar surface. When PCR was performed using the 35F and barR primers of Example 2-2, the plants in which the expected DNA bands were detected when the FRT region was cut (Fig. 5B) were determined to be positive in the trait LL test kit, and were treated with Bastar. Resistance to the suspension was also demonstrated, indicating that the bar gene was expressed by accurate cleavage of the FRT site (see FIG. 5).

(3-3) Antibiotic and Herbicide Resistance Substance Assay of Seeds of Transformants

T1 seeds obtained by self-modifying tobacco plants transformed through Example 2 and confirmed gene introduction and expression were surface sterilized in 70% (v / v) ethanol for 2 minutes, and then 2.5% (v / v) sodium hypo Sterilized in chlorite (sodium hypochlorite) solution for 10 minutes and washed three times with sterile water. The sterilized seeds were sown in medium prepared by adding 40 mg / l hygromycine and 15 mg / l PPT (phosphinothricin) to 1/2 MS basal medium (Murashige and Skoog, 1962), respectively. The seeded seeds were incubated for 2 weeks in a 16L / 8D photoperiod at 26 ° C to estimate the separation ratio of the resistant and susceptible individuals. The seed seed separation ratio in hygromycin medium and PPT medium of the tobacco transformant is shown in FIG. 3B. As for the resistance to hygromycin, genes were inserted into plants in all subjects, so that the genes were resistant to the seed according to the separation ratio. In Example 2-2, DNA sequences specific for the hygromycine gene were identified. When PCR was performed with primers prepared using DNA, the amplification of the seed was separated in the PPT medium at a ratio of about 3: 1, resulting in the presence of an insertion gene having an autologous cleavage of the selection marker. It could be confirmed.

(3-4) Screening for selection marker removal transformant and gene analysis by gene generation separation

The seed of Example 3-3 showing both antibiotic hygromycin and PPT resistance was seeded in MSO medium containing 15 mM PPT, and then germinated plants were transferred to an herbicide-free medium, and some of the plants were extracted to extract DNA. PCR was performed using a hygromycin resistance gene specific primer and a 35S promoter-bar gene specific primer to select only individuals from which the hygromycin resistance gene was removed. As shown in FIG. 6, the plant from which the antibiotic selection marker was removed was selected. Completed.

Example 4 Identification and Analysis of Selective Marker-Free Transformants by Induction of Compounds During Regeneration

(4-1) Analysis of Gene Expression According to Treatment by Hydrogen Peroxide Concentration in Transformant Kalos

The leaves of the transformant lines 3 and 10 of FIG. 5 were cut and injured in MSBN medium to which 0, 1, and 5 mM hydrogen peroxide were added. Then, callus was induced, and the prepared callus was pulverized to extract total RNA. . The isolated total RNA was synthesized cDNA using Superscriptase II (Life Technologies, USA), and PCR repeats were produced by primers with gene-specific DNA sequences of FLP, Bar, Hyg, and Ubi. RT-PCR was performed in cycles and is shown in FIG. 8. The gene expression for FLP and Bar was found to be high in Kalos in medium treated with high hydrogen peroxide concentration. These results indicated that as the concentration of hydrogen peroxide increased, SWAP2, a stress-inducible promoter, was activated, resulting in high FLP expression, and many FRT sites were cleaved by FLP site-specific recombinase. Seems to have increased (see Figure 8)

(4-2) Selection and verification of selection marker removal plants using compound treatment regeneration process The expression of the FLP gene in Example 4-1 using the fragments of transformants 9 and 10 of FIG. 3B of Example 3-3 The leaf was cut into the MSBN medium containing the highest 5 mM hydrogen peroxide to induce callos. Shoots from regenerated callus were transferred to MS medium supplemented with 10 g / L sucrose and 8 g / L agar to induce rooting. PCR was performed using a fry with 35S promoter and a nucleotide sequence of Bar gene to extract the total DNA extracted from the regenerated plant leaves and to examine the hygromycin gene and cleavage (Table 2). As shown in Figure 9, although the difference in efficiency, it was possible to obtain a redifferentiated individual in which no hygromycin gene was detected in both lines 9 and 10. In addition, PCR was carried out using primers of the 35S and bar gene portions of the individual from which the hygromycin gene was removed, and the DNA product was amplified very strongly. These results confirm that the cleavage of the hygromycin selection marker gene was correct.

Among the regenerated plants, PCR assays were used to select Southern plants for which no hygromycin resistance genes were amplified (Sambrook J and Russell D.W., 2001, Molecular Cloning: A Laboratory Manual, cold spring harbor laboratory press).

As shown in Figure 10, the transgenic plant of line 9 showing the hygromycin resistance fragments were detected (P of Fig. 10), but the fragments were not found in the plant removed from the selection marker completely hygromycin resistance gene It was confirmed that was removed in the plant (1 to 4 in Fig. 10).

(4-3) Subsequent Assay of Compound Treatment-Redifferentiated Selection Marker-free Plants

Seeds of plants from which the selection marker was removed through the procedure of Example 4-2 were discriminated for hygromycin resistance, and a subsequent assay was performed to confirm that the antibiotic selection marker was completely removed. Seeds germinated by self-pollinating seeds in 1/2 MS basal medium (Murashige and Skoog, 1962) supplemented with hygromycin antibiotic and PPT herbicide according to the conditions described in Example 3-3. Was observed. As shown in FIG. 7, seeds of transgenic tobacco prior to re-differentiation germinate in Hyg (hygromycine) medium and are not germinated in PPT-mediated medium, but in contrast to seeds of individuals whose antibiotic selection markers were removed by compound hydrogen peroxide treatment regeneration. The germination could not be completely germinated in the medium, and the selection marker was removed to induce the expression of the bar gene.
(Sequence list)
SEQ ID NO: 1
actagtgtccccagattagccttttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatca
agacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaact
gcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaa
ggcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaa
cagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtgg
agcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaa
tatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaat
gccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagca
tcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaat
cccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacggggggactctagaggatccgatc
attccgaagttcctattctctagaaagtataggaacttcagcttggggggcaatgagatatgatatgaaaaagcctgaactcaccgc
gacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcggagggcgaagaatctcgtgcttt
cagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggca
ctttgcatcggccgcgctcccgattccggaagtgcttgacattggggagtttagcgagagcctgacctattgcatctcccgccgtgc
acagggtgtcacgttgcaagacctgcctgaaaccgaactgcccgctgttctacaaccggtcgcggaggctatggatgcgatcgctgc
ggccgatcttagccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgc
gattgctgatccccatgtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgcgcaggctctcgatgagctgat
gctttgggccgaggactgccccgaagtccggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaatggccgcat
aacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctggaggccgtggttggc
ttgtatggagcagcagacgcgctacttcgagcggaggcatccggagcttgcaggatcgccacgactccgggcgtatatgctccgcat
tggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcgcagggtcgatgcgacgcaatcgtccg
atccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccgtctggaccgatggctgtgtagaagtactcgccga
tagtggaaaccgacgccccagcactcgtccgagggcaaagaaatagagtagatgccgaccggatctgtcgatcgacaagctcgagtt
tctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttgagcatataagaaacc
cttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatcc
cccgaattaaatcgataataccaatcgataataccaaatggtaccacctaactaggtgatatatattatgtatgtcattattttaaa
ctgtattacaaagactattttttcattaattggtacaaagaaaaattaaacagaaaagaaaggaaaaaatgactcaccacctagcac
ctagacacctagacaccaagtacccaaaccctctattttcaacatctattttcagatgtaaatatgagttggacgaagaaggtgtta
gcaattatttgattaatcttgctacgataattatgatccactcacttagtcatttttttcagaccaagacaactagcttgagttttt
tattgtatgtggtcggaacgttttttgtaattaaaaaaataaaagttgcatcattatatatggtagattaagtaattgatcaatcaa
cgtttaattttgcatttatcggcaaggtggaggttcnaacttccagtcgaacttagagagtcattggagaccttgaccagttaacta
gcggtgtcgaaaacctgcacaacttgagatttaattgcataccttttatatatgacgcgttttatttttttttcctagaaaataatt
tggaagaaaataagaatatgtattctgtgaaagctaggccaaaacgaatgtcttttcgtcgttttcgttaaaggtttagatcatatt
tcatctggtccaacactcaaacttgtataatggacgaattattagtcattttagacctaccggctagcgcgacttttttgttttcca
taaagattcgataattgcatggccagatgcaaagtttgaaatttaatgtttgccaaatcctatcatacaccacaacacatgtctcag
ggccaagtggcaccagcaaacattcctgtcataattaatttttttaatgagaaggaggaaactcacagctattactcgaaggtatat
aatattgagtaaatcttactttgtgattctagttgacaaaacaccgcaagataaactatactaagttcaaatcacctcaccgggttg
gctcagattggttttttcaatacaagagggggtgtgaactcccgtgccgacctcttttgagggacaataatgtacggtcacgccaac
caagcttgattttttctgacaaatatattactacatatattacacggtcaaataattaatcaaaaaataaaaaaagaccccaattaa
agtccccaaccactctcaaatattctatttaagggaaaccttagaggcaattcatgcatcctcaaccccttcttcttcattttctta
atcttaatcttacattttcctttgaccggatccccaccatgccacaatttgatccaccatgccacaatttgatatattatgtaaaac
accacctaaggtgcttgttcgtcagtttgtggaaaggtttgaaagaccttcaggtgagaaaatagcattatgtgctgctgaactaac
ctatttatgttggatgattacacataacggaacagcaatcaagagagccacattcatgagctataatactatcataagcaattcgct
gagtttggatattgtcaacaagtcactgcagtttaaatacaagacgcaaaaagcaacaattctggaagcctcattaaagaaattgat
tcctgcttgggaatttacaattattccttactatggacaaaaacatcaatctgatatcactgatattgtaagtagtttgcaattaca
gttcgaatcatcggaagaagcagataagggaaatagccacagtaaaaaaatgcttaaagcacttctaagtgagggtgaaagcatctg
ggagatcactgagaaaatactaaattcgtttgagtatacttcgagatttacaaaaacaaaaactttataccaattcctcttcctagc
tactttcatcaattgtggaagattcagcgatattaagaacgttgatccgaaatcatttaaattagtccaaaataagtatctgggagt
aataatccagtgtttagtgacagagacaaagacaagcgttagtaggcacatatacttctttagcgcaaggggtaggatcgatccact
tgtatatttggatgaatttttgaggaattctgaaccagtcctaaaacgagtaaataggaccggcaattcttcaagcaacaagcagga
ataccaattattaaaagataacttagtcagatcgtacaacaaagctttgaagaaaaatgcgccttattcaatctttgctataaaaaa
tggcccaaaatctcacattggaagacatttgatgacctcatttctttcaatgaagggcctaacggagttgactaatgttgtgggaaa
ttggagcgataagcgtgcttctgccgtggccaggacaacgtatactcatcagataacagcaatacctgatcactacttcgcactagt
ttctcggtactatgcatatgatccaatatcaaaggaaatgatagcattgaaggatgagactaatccaattgaggagtggcagcatat
agaacagctaaagggtagtgctgaaggaagcatacgataccccgcatggaatgggataatatcacaggaggtactagactacctttc
atcctacataaatagacgcatataagtacgcatttaagcataaacacgcatttaagcataaacacgcgagctcgaatttccccgatc
gttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacg
ttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaat
acgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggaattcaccg
ggaagttcctattccgaagttcctattctctagaaagtataggaacttcctagtccatgggcccagaacgacgcccggccgacatcc
gccgtgccaccgaggcggacatgccggcggtctgcaccatcgtcaaccactacatcgagacaagcacggtcaacttccgtaccgagc
cgcaggaaccgcaggagtggacggacgacctcgtccgtctgcgggagcgctatccctggctcgtcgccgaggtggacggcgaggtcg
ccggcatcgcctacgcgggcccctggaaggcacgcaacgcctacgactggacggccgagtcgaccgtgtacgtctccccccgccacc
agcggacgggactgggctccacgctctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtcatcg
ggctgcccaacgacccgagcgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccggcttcaagcacg
ggaactggcatgacgtgggtttctggcagctggacttcagcctgccggtaccgccccgtccggtcctgcccgtcacgatctgtcgat
cgacaagctcgagtttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttg
agcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagta
ctaaaatccagatcccccgaattaacggcg

Figure 1 schematically shows the manufacturing process of the plant transformation vector to remove the selection marker of the present invention.

LB: left border; 35S ^P : Cauliflower mosaic virus promoter; pA: Nopaline synthase (nos) termination sequence; Bar: herbicide resistance genes; FRT: site specific recombinase (FLP) recognition site; POD ^P : peroxidase promoter of sweet potato chloroplasts; FLP: location specific recombinase gene; HPT: hygromycin resistance gene; RB: right border.

Figure 2 schematically shows a carrier for plant transformation to remove the selection marker of the present invention.

Figure 3 shows the results of analyzing the polymerase chain reaction (PCR) by the transformed plant of the present invention.

Figure 4 shows the results of confirming the removal of the selection marker by sequencing the PCR product of the transgenic plant of the present invention.

Figure 5 shows a photograph of a tobacco transformant confirming the removal of the selection marker by treating the transformed tobacco of the present invention the herbicide Vasta.

A: transgenic tobacco without selection marker removed; B: Transgenic tobacco with the selection marker removed.

Figure 6 shows the results of the treatment of the herbicide Basta in the transgenic tobacco of the present invention and the antibiotic resistance and herbicide resistance of later seeds.

Figure 7 shows the results of PCR analysis of the aspect that the selection marker gene is removed according to the progress of generation of seed in the transgenic tobacco of the present invention.

Figure 8 shows the results of treatment of hydrogen peroxide (hydrogen peroxide (H ₂ O ₂ )) by concentration in the re-differentiated callus of the transformed tobacco of the present invention and the gene expression pattern by RT-PCR.

Ubi: The ubiquitin gene of tobacco.

Figure 9 shows the analysis by PCR to remove the selection marker gene according to the treatment of hydrogen peroxide in the reclassified tobacco of the present invention.

Figure 10 shows the analysis of Southern blot to remove the selection marker gene according to the treatment of hydrogen peroxide in the re-differentiated tobacco of the present invention.

PC: positive control; p: transgenic plant; 1 to 4: plants with the selection marker removed; NC: negative control.

Figure 11 shows the antibiotic resistance and herbicide resistance of the seed of the transgenic tobacco from which the selection marker of the present invention is removed as a photograph of the result of the subtest.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION <120> Plant transformation vector and marker free transgenic plants          using stress inducible site-specific recombination <130> PA080056 <160> 1 <170> KopatentIn 1.71 <210> 1 <211> 5946 <212> DNA <213> Agrobacterium tumefaciens <400> 1 actagtgtcc ccagattagc cttttcaatt tcagaaagaa tgctaaccca cagatggtta 60 gagaggctta cgcagcaggt ctcatcaaga cgatctaccc gagcaataat ctccaggaaa 120 tcaaatacct tcccaagaag gttaaagatg cagtcaaaag attcaggact aactgcatca 180 agaacacaga gaaagatata tttctcaaga tcagaagtac tattccagta tggacgattc 240 aaggcttgct tcacaaacca aggcaagtaa tagagattgg agtctctaaa aaggtagttc 300 ccactgaatc aaaggccatg gagtcaaaga ttcaaataga ggacctaaca gaactcgccg 360 taaagactgg cgaacagttc atacagagtc tcttacgact caatgacaag aagaaaatct 420 tcgtcaacat ggtggagcac gacacacttg tctactccaa aaatatcaaa gatacagtct 480 cagaagacca aagggcaatt gagacttttc aacaaagggt aatatccgga aacctcctcg 540 gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag gaaggtggct 600 cctacaaatg ccatcattgc gataaaggaa aggccatcgt tgaagatgcc tctgccgaca 660 gtggtcccaa agatggaccc ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa 720 ccacgtcttc aaagcaagtg gattgatgtg atatctccac tgacgtaagg gatgacgcac 780 aatcccacta tccttcgcaa gacccttcct ctatataagg aagttcattt catttggaga 840 gaacacgggg ggactctaga ggatccgatc attccgaagt tcctattctc tagaaagtat 900 aggaacttca gcttgggggg caatgagata tgatatgaaa aagcctgaac tcaccgcgac 960 gtctgtcgag aagtttctga tcgaaaagtt cgacagcgtc tccgacctga tgcagctctc 1020 ggagggcgaa gaatctcgtg ctttcagctt cgatgtagga gggcgtggat atgtcctgcg 1080 ggtaaatagc tgcgccgatg gtttctacaa agatcgttat gtttatcggc actttgcatc 1140 ggccgcgctc ccgattccgg aagtgcttga cattggggag tttagcgaga gcctgaccta 1200 ttgcatctcc cgccgtgcac agggtgtcac gttgcaagac ctgcctgaaa ccgaactgcc 1260 cgctgttcta caaccggtcg cggaggctat ggatgcgatc gctgcggccg atcttagcca 1320 gacgagcggg ttcggcccat tcggaccgca aggaatcggt caatacacta catggcgtga 1380 tttcatatgc gcgattgctg atccccatgt gtatcactgg caaactgtga tggacgacac 1440 cgtcagtgcg tccgtcgcgc aggctctcga tgagctgatg ctttgggccg aggactgccc 1500 cgaagtccgg cacctcgtgc acgcggattt cggctccaac aatgtcctga cggacaatgg 1560 ccgcataaca gcggtcattg actggagcga ggcgatgttc ggggattccc aatacgaggt 1620 cgccaacatc ttcttctgga ggccgtggtt ggcttgtatg gagcagcaga cgcgctactt 1680 cgagcggagg catccggagc ttgcaggatc gccacgactc cgggcgtata tgctccgcat 1740 tggtcttgac caactctatc agagcttggt tgacggcaat ttcgatgatg cagcttgggc 1800 gcagggtcga tgcgacgcaa tcgtccgatc cggagccggg actgtcgggc gtacacaaat 1860 cgcccgcaga agcgcggccg tctggaccga tggctgtgta gaagtactcg ccgatagtgg 1920 aaaccgacgc cccagcactc gtccgagggc aaagaaatag agtagatgcc gaccggatct 1980 gtcgatcgac aagctcgagt ttctccataa taatgtgtga gtagttccca gataagggaa 2040 ttagggttcc tatagggttt cgctcatgtg ttgagcatat aagaaaccct tagtatgtat 2100 ttgtatttgt aaaatacttc tatcaataaa atttctaatt cctaaaacca aaatccagta 2160 ctaaaatcca gatcccccga attaaatcga taataccaat cgataatacc aaatggtacc 2220 acctaactag gtgatatata ttatgtatgt cattatttta aactgtatta caaagactat 2280 tttttcatta attggtacaa agaaaaatta aacagaaaag aaaggaaaaa atgactcacc 2340 acctagcacc tagacaccta gacaccaagt acccaaaccc tctattttca acatctattt 2400 tcagatgtaa atatgagttg gacgaagaag gtgttagcaa ttatttgatt aatcttgcta 2460 cgataattat gatccactca cttagtcatt tttttcagac caagacaact agcttgagtt 2520 ttttattgta tgtggtcgga acgttttttg taattaaaaa aataaaagtt gcatcattat 2580 atatggtaga ttaagtaatt gatcaatcaa cgtttaattt tgcatttatc ggcaaggtgg 2640 aggttcnaac ttccagtcga acttagagag tcattggaga ccttgaccag ttaactagcg 2700 gtgtcgaaaa cctgcacaac ttgagattta attgcatacc ttttatatat gacgcgtttt 2760 attttttttt cctagaaaat aatttggaag aaaataagaa tatgtattct gtgaaagcta 2820 ggccaaaacg aatgtctttt cgtcgttttc gttaaaggtt tagatcatat ttcatctggt 2880 ccaacactca aacttgtata atggacgaat tattagtcat tttagaccta ccggctagcg 2940 cgactttttt gttttccata aagattcgat aattgcatgg ccagatgcaa agtttgaaat 3000 ttaatgtttg ccaaatccta tcatacacca caacacatgt ctcagggcca agtggcacca 3060 gcaaacattc ctgtcataat taattttttt aatgagaagg aggaaactca cagctattac 3120 tcgaaggtat ataatattga gtaaatctta ctttgtgatt ctagttgaca aaacaccgca 3180 agataaacta tactaagttc aaatcacctc accgggttgg ctcagattgg ttttttcaat 3240 acaagagggg gtgtgaactc ccgtgccgac ctcttttgag ggacaataat gtacggtcac 3300 gccaaccaag cttgattttt tctgacaaat atattactac atatattaca cggtcaaata 3360 attaatcaaa aaataaaaaa agaccccaat taaagtcccc aaccactctc aaatattcta 3420 tttaagggaa accttagagg caattcatgc atcctcaacc ccttcttctt cattttctta 3480 atcttaatct tacattttcc tttgaccgga tccccaccat gccacaattt gatccaccat 3540 gccacaattt gatatattat gtaaaacacc acctaaggtg cttgttcgtc agtttgtgga 3600 aaggtttgaa agaccttcag gtgagaaaat agcattatgt gctgctgaac taacctattt 3660 atgttggatg attacacata acggaacagc aatcaagaga gccacattca tgagctataa 3720 tactatcata agcaattcgc tgagtttgga tattgtcaac aagtcactgc agtttaaata 3780 caagacgcaa aaagcaacaa ttctggaagc ctcattaaag aaattgattc ctgcttggga 3840 atttacaatt attccttact atggacaaaa acatcaatct gatatcactg atattgtaag 3900 tagtttgcaa ttacagttcg aatcatcgga agaagcagat aagggaaata gccacagtaa 3960 aaaaatgctt aaagcacttc taagtgaggg tgaaagcatc tgggagatca ctgagaaaat 4020 actaaattcg tttgagtata cttcgagatt tacaaaaaca aaaactttat accaattcct 4080 cttcctagct actttcatca attgtggaag attcagcgat attaagaacg ttgatccgaa 4140 atcatttaaa ttagtccaaa ataagtatct gggagtaata atccagtgtt tagtgacaga 4200 gacaaagaca agcgttagta ggcacatata cttctttagc gcaaggggta ggatcgatcc 4260 acttgtatat ttggatgaat ttttgaggaa ttctgaacca gtcctaaaac gagtaaatag 4320 gaccggcaat tcttcaagca acaagcagga ataccaatta ttaaaagata acttagtcag 4380 atcgtacaac aaagctttga agaaaaatgc gccttattca atctttgcta taaaaaatgg 4440 cccaaaatct cacattggaa gacatttgat gacctcattt ctttcaatga agggcctaac 4500 ggagttgact aatgttgtgg gaaattggag cgataagcgt gcttctgccg tggccaggac 4560 aacgtatact catcagataa cagcaatacc tgatcactac ttcgcactag tttctcggta 4620 ctatgcatat gatccaatat caaaggaaat gatagcattg aaggatgaga ctaatccaat 4680 tgaggagtgg cagcatatag aacagctaaa gggtagtgct gaaggaagca tacgataccc 4740 cgcatggaat gggataatat cacaggaggt actagactac ctttcatcct acataaatag 4800 acgcatataa gtacgcattt aagcataaac acgcatttaa gcataaacac gcgagctcga 4860 atttccccga tcgttcaaac atttggcaat aaagtttctt aagattgaat cctgttgccg 4920 gtcttgcgat gattatcata taatttctgt tgaattacgt taagcatgta ataattaaca 4980 tgtaatgcat gacgttattt atgagatggg tttttatgat tagagtcccg caattataca 5040 tttaatacgc gatagaaaac aaaatatagc gcgcaaacta ggataaatta tcgcgcgcgg 5100 tgtcatctat gttactagat cgggaattca ccgggaagtt cctattccga agttcctatt 5160 ctctagaaag tataggaact tcctagtcca tgggcccaga acgacgcccg gccgacatcc 5220 gccgtgccac cgaggcggac atgccggcgg tctgcaccat cgtcaaccac tacatcgaga 5280 caagcacggt caacttccgt accgagccgc aggaaccgca ggagtggacg gacgacctcg 5340 tccgtctgcg ggagcgctat ccctggctcg tcgccgaggt ggacggcgag gtcgccggca 5400 tcgcctacgc gggcccctgg aaggcacgca acgcctacga ctggacggcc gagtcgaccg 5460 tgtacgtctc cccccgccac cagcggacgg gactgggctc cacgctctac acccacctgc 5520 tgaagtccct ggaggcacag ggcttcaaga gcgtggtcgc tgtcatcggg ctgcccaacg 5580 acccgagcgt gcgcatgcac gaggcgctcg gatatgcccc ccgcggcatg ctgcgggcgg 5640 ccggcttcaa gcacgggaac tggcatgacg tgggtttctg gcagctggac ttcagcctgc 5700 cggtaccgcc ccgtccggtc ctgcccgtca cgatctgtcg atcgacaagc tcgagtttct 5760 ccataataat gtgtgagtag ttcccagata agggaattag ggttcctata gggtttcgct 5820 catgtgttga gcatataaga aacccttagt atgtatttgt atttgtaaaa tacttctatc 5880 aataaaattt ctaattccta aaaccaaaat ccagtactaa aatccagatc ccccgaatta 5940 acggcg 5946  

Claims (12)

Expression markers for plant transformation, including stress flow peroxidase promoter, site-specific recombinase gene, recombinase recognition site can be removed and the expression vector is pWHF-P (Accession Number: KACC 95088P). The method of claim 1, The promoter is a plant transformation expression vector, characterized in that the stress inducible peroxidase promoter (stress inducible peroxidase promoter) derived from sweet potatoes. The method of claim 1, The recombinase gene is a plant transformation expression vector, characterized in that the site-specific recombinase FLP (LPL) gene expressed from the stress flow peroxidase promoter. The method of claim 1, The recognition site is a plant transformation expression vector, characterized in that the nucleotide sequence of the recombinant enzyme recognition site frt. delete Claim 1 transgenic plants are transformed with the expression vector pWHF-P in Agrobacterium is used as a plant carriers (Agrobacterium sp.) For microorganisms. The method of claim 6, Wherein the microorganism is Agrobacterium spp, characterized in that Agrobacterium Tome Pacific Enschede LBA4404 (Agrobacterium tumefaciens LBA4404) transformed with the expression vector pWHF-P. A transformed plant that is transformed with the microorganism of the genus Agrobacterium of claim 6 to remove the selection marker. The method of claim 8, The plant is a transgenic plant, characterized in that it includes both self-modifying and other plants that can be modified. The method according to claim 8 or 9, The plant is a transgenic plant, characterized in that it comprises tobacco. (1) cutting the leaves of the plant; (2) infecting the microorganism of genus Agrobacterium of paragraph 6; (3) inducing re-differentiation using a selective medium with hydrogen peroxide added; (4) induce and purify roots; And (5) analyzing the transformation of the gene; The method of manufacturing a plant of claim 8, which can remove the selection marker made of a process. The method of claim 11, The plant is a manufacturing method characterized in that it comprises tobacco.

Images