CN117947026A - OsGMS4pro 4 promoter and application thereof - Google Patents

Abstract

The invention relates to the technical field of agricultural biology, in particular to OsGMS pro 4 promoter and application thereof. OsGMS4 the promoter sequence of the pro-gene is shown in SEQ ID NO. 1. The promoter can drive the gene to be expressed in the callus of rice, corn and other crops in a specific, efficient and stable manner. Through GUS staining identification, the promoter is specifically expressed in callus, has important significance in the field of plant genetic engineering, and can effectively reduce the potential safety risk of transgenic plants caused by exogenous DNA.

Description

OsGMS4pro 4 promoter and application thereof

Technical Field

The invention relates to the technical field of agricultural biology, in particular to OsGMS pro 4 promoter and application thereof.

Background

Transgenic technology has become one of the essential research and application research fields for researching gene functions, and promoters, which are important cis-acting elements for driving gene expression, play an important role in transgenic technology. Promoters can be classified into three types, i.e., constitutive promoters, inducible promoters and space-time specific promoters, according to their expression patterns. Constitutive promoters are capable of promoting gene transcription in all or most tissues, giving temporal and spatial persistence and constancy of gene expression. Inducible promoters, which are capable of initiating or greatly increasing gene expression under the stimulation of certain physical or chemical signals, have sequence structures of enhancers, silencers, or similar functions and exhibit significant specificity. Spatiotemporal specific promoters only initiate gene expression in a particular growth stage or site. The expression mode of the promoter is studied deeply, so that the expression regulation mechanism and biological function of the gene can be understood, and the expression of the exogenous gene can be regulated effectively.

Under the action of the tissue specific promoter, the gene expression has the advantages of specific space-time expression, strong stage property and high sensitivity. The callus specific promoter can drive the strong expression of exogenous genes in the callus stage in the plant development process, and can obviously reduce the negative effects of the callus specific promoter on the possible interference and the like of the plant growth and development, so the callus specific promoter has important significance in the research of plant gene functions and genetic engineering.

Therefore, it is particularly important to develop new efficient tissue-specific promoters, especially plant-derived, biosafety low-risk promoters.

Disclosure of Invention

In a first aspect, the present invention provides a OsGMS pro 4 promoter comprising at least one of the following nucleotide sequences:

i) A nucleotide sequence shown as SEQ ID NO. 1;

ii) a nucleotide sequence that is fully complementary to i);

iii) The nucleotide sequence with the same promoter function is obtained by substituting, deleting and adding one or more nucleotide sequences in the nucleotide sequence shown in the i).

OsGMS4pro promoter is rice source, is a constitutive promoter with good biological safety, and can drive the specific expression of genes in plant callus.

In a second aspect, the invention provides a primer pair for amplifying the promoter.

Preferably, the primer pair is a primer pair as shown in SEQ ID NO. 2-3.

The primer pair shown in SEQ ID NO.2-3 can be used for amplifying the nucleotide sequence shown in SEQ ID NO. 1.

In a third aspect, the present invention provides a biological material comprising the promoter; the biological material is at least one of an expression cassette, a vector and a host cell.

In some embodiments, the host cell is unable to develop into an intact plant individual.

Preferably, when the biological material is an expression cassette, the expression cassette comprises the OsGMS pro promoter, functional gene and terminator functionally linked to each other in the direction of transcription;

Preferably, the functional genes comprise selectable marker genes and/or genes associated with agronomic traits in plants.

The screening marker gene is preferably one or more of beta-glucuronidase gene GUS, hygromycin phosphotransferase gene Hn, acetolactate synthase mutant gene ALS, bar gene, resistance EPSPS gene or nptII gene.

Agronomic traits of plants, i.e., traits related to crop growth, plant height, leaf area, fruit weight, quality, herbicide resistance, pest resistance, etc., may represent crop variety characteristics. Accordingly, genes related to agronomic traits of plants are genes related to these traits.

In a fourth aspect, the invention provides a reagent or kit comprising said promoter, or said primer pair, or said biological material.

In a fifth aspect, the invention provides the use of said promoter, or said primer pair, or said biological material, or said reagent or kit in at least one of the following:

1) Preparing a transgenic plant;

2) Driving expression of the gene in the plant;

3) Genetic breeding or germplasm improvement of plants;

4) And (5) plant hybridization seed production.

Preferably, the application comprises: constructing the OsGMS pro 4 promoter on a vector and then transforming into a plant;

Or introducing the biological material into a plant.

Preferably, the application further comprises: after transformation or introduction into plants, selection is performed by selecting marker genes.

Preferably, the gene is a functional gene, an antisense gene to a functional gene, or a microrna gene;

Preferably, the functional gene is a plant agronomic trait related gene or a selectable marker gene;

preferably, the small RNA gene is a small RNA gene capable of interfering with the expression of the functional gene.

Preferably, expression of the driver gene in the plant specifically includes expression of the driver gene in plant callus.

Preferably, the plant comprises at least one of rice, maize, wheat, barley, soybean, cotton, canola, sorghum, millet.

As a preferred embodiment, the present invention provides a method for preparing transgenic rice comprising:

Transforming a vector comprising the OsGMS pro promoter into rice callus by agrobacterium transformation;

the rice callus is subjected to resistance screening and differentiation to obtain rice seedlings;

and carrying out rooting culture on the rice seedlings to obtain transgenic rice.

Preferably, the rice callus is prepared by the following method:

after the rice seeds are shelled and disinfected, the mature embryo is inoculated into an induction culture medium to induce embryogenic callus, and the embryo is dark-cultured for 30 to 50 days at the temperature of between 28 and 30 ℃.

Preferably, after transformation of the OsGMS.sup.4pro promoter into rice callus, co-cultivation is also included, which is a dark cultivation until the surface of the callus is populated with thalli.

Preferably, the resistance screening is to inoculate the co-cultured callus into a screening culture medium added with hygromycin, and perform the resistance screening after dark culture for 30-50 days at 28-30 ℃;

preferably, the differentiation is carried out by adding the calli subjected to resistance screening to a differentiation medium added with hygromycin, and culturing at 28-30 ℃ for 25-40 days by illumination.

Preferably, the rooting culture is to inoculate rice seedlings to a rooting culture medium added with hygromycin for rooting, and the rooting culture is carried out for 5-20 days at the temperature of 30-32 ℃.

Preferably, after rooting culture, including PCR detection, plants that detected positive are selected for planting.

Compared with the prior art, the invention has the beneficial effects that:

The OsGMS pro promoter is a callus specific promoter which is obtained by screening and derived from rice and can drive genes to be expressed in callus of plants such as rice, corn or wheat with high efficiency.

The OsGMS pro 4 promoter provided by the invention can form a plant transgenic screening expression cassette with a plant endogenous or exogenous screening marker gene, or a plant genetic transformation screening vector, and other functional elements are added for plant tissue culture or plant genetic transformation, so that an effective tool and method are provided for screening plant genetic transformation.

The OsGMS pro promoter provided by the invention is a plant endogenous promoter, and is free from introducing bacterial sources and other exogenous gene segments in the transgenic process, so that not only are plant transgenic promoter resources enriched, but also potential safety risks of transgenic plants caused by exogenous genes and public worry about the safety of the transgenic plants can be effectively reduced, the commercialized application of the transgenic plants is facilitated, and good market value and social benefit are realized.

Drawings

FIG. 1 shows the result of agarose gel electrophoresis provided in example 2 of the present invention; the left panel shows the amplified fragment of promoter OsGMS.sup.4pro, and the right panel shows the cleaved fragment of vector 1300.sup. 1300 gusplus.

Fig. 2 is a vector map of 1300gusplus vector provided in example 2 of the present invention.

FIG. 3 is a diagram showing the double digestion electrophoresis of 1300gusplus-OsGMS pro vector according to example 2 of the present invention with two sets of enzymes BcuI/MssI and Eco 147I/MssI; wherein M is Marker,4-1, 4-2 and 4-3 are 1300gusplus-OsGMS pro recombinant plasmids which are digested, and 1 and 2 are 1300gusplus-OsGMS pro recombinant plasmids which are digested by two groups of enzyme, namely BcuI/MssI and Eco147I/MssI respectively.

FIG. 4 is a vector map of the 1300gusplus-OsGMS pro vector provided in example 2 of the present invention.

FIG. 5 shows the result of PCR detection electrophoresis of transformed Agrobacterium provided in example 3 of the present invention; wherein M is Marker, H ₂ O is blank control, ck+ is 1300gusplus-OsGMS pro recombinant plasmid positive control, 1-5 is 1300gusplus-OsGMS pro recombinant plasmid agrobacterium monoclonal bacterial liquid sample.

FIG. 6 is a PCR detection electrophoresis chart of transgenic sample plants provided in example 3 of the present invention; wherein M is Marker, H ₂ O is blank control, ck-is ZH11 non-transgenic plant genome DNA, ck+ is 1300gusplus-OsGMS4 recombinant plasmid positive control, the number 1-18 is plant genome DNA obtained by screening, 6 strains such as number 1, 2, 7, 8, 9, 10 and the like are non-transgenic strains, and the rest 12 strains are transgenic strains.

FIG. 7 shows GUS staining results of calli, differentiated seedlings, roots, leaves and seeds of the T0 generation strain transgenic with the 1300gusplus-OsGMS pro vector provided in experimental examples of the present invention; wherein ck-is the result of staining of each developmental stage of the negative control (ZH 11), ck+ is the result of staining of each developmental stage of the positive control (pC 1301), and GMS4pro is the result of staining of the 1300gusplus-OsGMS pro transgenic line.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The test methods described in the examples below are conventional, unless otherwise specified. The materials and reagents described in the examples below are commercially available unless otherwise specified.

Example 1

The bioinformatics analysis of the sequence upstream of LOC_Os05g35266 gene by the start function prediction software PLANTCARE and PlantPAN shows that the sequence is rich in various cis-acting elements related to the promoter, such as TATA-box, CAAT-box and the like, and the sequence has the structural characteristics of the plant cell promoter. Meanwhile, plantPAN analysis results show that the sequence of 1085bp to 1667bp of the gene is rich in CpG islands, and CpG islands are also one of sequence characteristics of eukaryotic promoters, so that the invention speculates that the sequence has promoter activity.

In the embodiment, the upstream sequence of about 2000bp before the start codon ATG of LOC_Os05g35266 gene is further intercepted for carrying out promoter activity identification, and the sequence shown in SEQ ID NO.1 is finally determined as a promoter sequence through continuous screening, and is named as OsGMS pro, osGMS pro promoter, so that the gene can be driven to be expressed in the callus of rice efficiently.

Example 2

In this example, osGMS pro 4 promoter was constructed into expression cassette and vector as follows:

1. Preparation of plant transgenic expression cassette containing OsGMS pro 4 promoter

The construction method of the plant transgenic expression cassette OsGMS pro-GUS-nosT (the sequence is shown as SEQ ID NO. 4) comprises the following steps:

The primer 1300-GMS4pro-F/1300-GMS4pro-RV was designed to amplify OsGMS pro-promoter fragment from the rice 9311 genome. Wherein, the 5' end of the primer 1300-GMS4pro-F has 24 nucleotide sequences which are repeated with the corresponding connection positions of the carrier; the 5' end of the primer 1300-GMS4pro-RV has 28 nucleotide sequences which are repeated with the corresponding connection positions of the vector; for subsequent recombination ligation using Gibson Assembly.

The primer sequences are as follows:

1300-GMS4pro-F：(SEQ ID NO.2)

5’-TCAGATCTACCATGGTACCGTGgatccTGCAGTGGACGTTTCAAGC-3’；

1300-GMS4pro-RV：(SEQ ID NO.3)

5’-TAAAACGACGGCCAGTGCCAagcttCATATTGAGCTCCAGGGAAGAAC-3’。

The PCR amplification reaction system is shown in Table 1.

TABLE 1PCR amplification reaction System

The PCR amplification procedure was as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55-65℃for 30s, extension at 68℃for 3min,35 cycles; extending at 68 ℃ for 10min and ending at 16 ℃.

The PCR products amplified by the primers 1300-GMS4pro-F and 1300-GMS4pro-RV were OsGMS pieces and the products of 1667bp in size were recovered by 1.2% agarose gel electrophoresis (results are shown in the left panel of FIG. 1).

3. Construction of plant genetic transformation vectors

The amplification product of step 1 was inserted between BamHI and HindIII double cleavage sites of the 1300gusplus vector (see FIG. 2 for vector map) using the Gibson Assembly method, as follows:

(1) Vector plasmid 1300gusplus was double digested with BamHI+HindIII and subjected to agarose gel electrophoresis using E.Z.N.A. The Extraction kit (Omega, supra) recovered a band of about 10kb in size, yielding a linear fragment of 1300 gusplus.

The BamHI+HindIII double cleavage reaction is shown in Table 2.

TABLE 2 cleavage reaction System

The results of the digestion are shown in the right panel of FIG. 1.

(2) 2X LIGHTENING CLONING KIT ligation kit (Gene)) The OsGMS pro 4 promoter fragment was ligated into the 1300gusplus vector and the ligation system is shown in Table 3.

Table 3 connection system

And (3) connection procedure: 50℃for 35min.

(3) Conversion: adding 3 mu L of the connection product obtained in the step (2) into competent cells of escherichia coli, slightly and uniformly mixing, and carrying out ice bath for half an hour; e.coli competent cells are transformed by 1.8KV electric shock through an electrotransformation instrument; 1mL of SOC medium was added, the culture was performed at 37℃and 220rpm, the mixture was centrifuged at 5000rpm for 30s, 800. Mu.L of the supernatant was discarded, and the remaining cells were mixed with the medium and plated on LB plates containing kanamycin. After culturing at 37℃for about 16 hours, single colonies were picked up, specific primers (1300-GMS 4pro-test-F and 1300-GMS4 pro-test-R) were used for colony PCR verification, positive colonies were picked up, shaking was performed at 37℃and 220rpm overnight, plasmids were extracted by using a high purity plasmid miniextraction kit (Zhongkeritai), after enzyme digestion detection was correct (the results are shown in FIG. 3, wherein M is Marker,4-1, 4-2 and 4-3 are respectively 1300gusplus-OsGMS pro recombinant plasmids selected, 1 and 2 are respectively BcuI/MssI and 1300gusplus-OsGMS pro recombinant plasmids digested by Eco147I/MssI, bcuI/MssI can be digested 2114bp, eco147I/MssI can be digested 2624bp, and the results show that 4-2 is positive recombinant plasmid), the strains were preserved and sequenced. The obtained vector is named 1300gusplus-OsGMS pro, and the map of the vector is shown in FIG. 4.

Primer sequence:

1300-GMS4pro-test-F：(SEQ ID NO.5)

TCTTCCAGTCCTTTCCCGTAGT；

1300-GMS4pro-test-R：(SEQ ID NO.6)

ATGGAAGAGTCGGGAGTCAAAC。

Example 3

The present example converts OsGMS pro 4 promoter into plants to prepare the corresponding transgenic plants, and the specific procedure is as follows:

1. Agrobacterium transformation and identification

1. Mu.L of the correctly sequenced 1300gusplus-OsGMS pro plasmid obtained in example 2 was added to Agrobacterium EHA105 competent cells stored at-80℃and transformed with a 2.5KV electric shock. Spread on YEP culture plate containing kanamycin, rifampicin and streptomycin, culture at 28deg.C for about 48H, picking single colony shake fungus overnight, PCR verifying with specific primer (1300-GMS 4pro-test-F and 1300-GMS4 pro-test-R) fungus liquid (result is shown in figure 5, wherein M is Marker, H ₂ O is blank control, ck+ is 1300gusplus-GMS4pro recombinant plasmid positive control, 1-5 is 1300gusplus-OsGMS pro recombinant plasmid agrobacterium monoclonal fungus liquid sample, its amplified band size is 691bp, size is correct), can amplify to obtain target fragment of about 691bp, select positive clone (engineering agrobacterium), shake fungus 36-48H, preserve fungus liquid for infection.

2. Agrobacterium-mediated genetic transformation

(1) Induction: sterilizing seeds of Zhonghua 11 (ZH 11) by sodium hypochlorite, placing the seeds on an induction culture medium (N6+2.4-D3 mg/L+CH 0.6g/L+Pro 0.5 g/L+sucrose 30g/L+Phytagel 3 g/L), and performing dark culture at the normal temperature of 28 ℃ for 30-40D to obtain induced callus subculture for 30-40D;

(2) Screening: transforming the engineering agrobacterium obtained in the step 1 into the callus obtained in the step 1 by an agrobacterium-mediated genetic transformation method, co-culturing for 3d, washing for 5-6 times, transferring to a screening culture medium containing 50mg/L hygromycin, and carrying out dark culture at 30 ℃ for 30-50d, wherein the callus screened after infection of the agrobacterium with 1300gusplus-OsGMS pro can be screened to obtain a resistant callus;

(3) Differentiation: transferring the selected resistant callus to a differentiation medium containing 50mg/L hygromycin, and culturing and differentiating at 30 ℃ for 25-30d by illumination to obtain positive seedlings;

(4) Rooting: transferring the positive seedlings obtained through differentiation to a rooting culture medium containing 50mg/L hygromycin, and carrying out light culture at 30 ℃ to root for 7-15d to obtain positive transgenic plants;

(5) Hardening seedlings and transplanting: opening a bottle mouth sealing film of a transformant line with vigorous root growth, adding sterile water to cover a culture medium for 1-2cm thick, placing the transformant line at room temperature, contacting with air to smelt seedlings for 2-3d, and transplanting the transformant line to a greenhouse for cultivation.

3. Identification of transgenic lines

In order to identify whether the strain obtained in step 2 is a transgenic strain, the present example performs PCR verification on a part of positive transgenic plants obtained by screening culture, differentiation culture and rooting culture.

Firstly, extracting sample DNA, wherein the DNA extraction steps are as follows: taking rice leaves with the length of about 2cm, and placing the rice leaves into a 2mL centrifuge tube; 800. Mu.L of 1.5 XCTAB was added to a mortar, the leaves were ground to homogenize and poured back into a centrifuge tube; water bath at 65 ℃ for 20-30min, and mixing for 1 time after reversing every 5min; centrifuging at 12000rpm for 10min; sucking 400 mu L of supernatant to a new centrifuge tube, adding 2 times of absolute ethyl alcohol precooled by ice, and placing the mixture on ice at-20 ℃ for 20min; centrifuging at 12000rpm for 10min; discarding the supernatant, adding 500 μL of 75% ethanol, rinsing upside down, centrifuging at 8000rpm for 5min; the supernatant was discarded, and the mixture was placed on a super clean bench for drying or naturally airing, and 100. Mu.L of ddH ₂ O was added to dissolve DNA.

PCR amplification detection is carried out on the genome DNA sample of the transgenic strain by using hygromycin primer (Hn-F/Hn-R), the primer pair takes the endogenous rice genome as a template and cannot be amplified to obtain fragments, and the fragment size obtained by amplification of the transgenic seedling is 561bp.

The primer sequences were as follows:

Hn-F:5’-CTTAGCCAGACGAGCGGGTTC-3’(SEQ ID NO.7)；

Hn-R:5’-GCTTCTGCGGGCGATTTGT-3’(SEQ ID NO.8)。

ZH11 genomic DNA was used as a negative control and water was used as a blank control. The PCR reaction procedure was as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 45s, annealing at 55-65℃for 45s; extending at 72 ℃ for 1.5min;30-35 cycles; extending at 72 ℃ for 10min; ending at 16 ℃.

The PCR reaction system is shown in Table 4.

TABLE 4PCR reaction System

The PCR products are subjected to agarose gel electrophoresis, the result is shown in figure 6 (wherein M is Marker, H ₂ O is blank control, ck-is ZH11 non-transgenic plant genome DNA, ck+ is 1300gusplus-OsGMS4 recombinant plasmid positive control, the number 1-18 is plant genome DNA obtained by screening, 6 strains such as number 1,2, 7, 8, 9, 10 and the like are non-transgenic strains, and the other 12 strains are transgenic strains), and the result shows that most of transgenic samples contain 561bp transgenic strips, and the size of the transgenic strips is the same as that of vector control; whereas the blank and negative control ZH11 failed to spread out the band.

Experimental example

This experimental example further analyses were carried out on the transgenic lines obtained in example 3, as follows:

1. GUS staining analysis of plant tissues

The GUS staining kit (Zhongkeruitai, cat# RTU 4032) is used for staining analysis, positive callus staining is screened to be obvious, the obtained differentiated seedling leaves and roots are not stained, the seedling leaves and seeds are not stained, the GUS staining is carried out on the seedling leaves and seeds, the result is shown in FIG. 7, and FIG. 7 shows that the GUS gene driven by OsGMS promoter has higher expression level in the callus. Wherein, the tissues of each stage of the negative control (ZH 11, ck-) leaf are not dyed, and the positive control (the transformation pC1301 vector positive strain, ck+) is dyed.

2. Analysis of tissue expression in maize

By using a similar method to rice in example 3, maize transgenic plants were obtained, and GUS staining of each tissue was found to be obvious in positive callus staining of maize screening, and GUS staining of the obtained differentiated seedling leaves, roots, seedling stage leaves, and seeds was not stained. As can be seen, osGMS.sup.4pro promoter only drives GUS gene to stably express in maize callus, and is a high-efficiency callus specific promoter.

3. Analysis of tissue expression in wheat

By using a similar method to rice in example 3, wheat transgenic plants were obtained, and GUS staining of each tissue was found to be obvious in positive callus staining of wheat screening, and GUS staining of the obtained differentiated seedling leaves, roots, seedling stage leaves and seeds was not stained. As can be seen, osGMS.sup.4pro promoter only drives GUS gene to stably express in wheat callus, and is a high-efficiency callus specific promoter.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. OsGMS 4a promoter of pro 4, characterized in that it comprises at least one of the following nucleotide sequences:

i) A nucleotide sequence shown as SEQ ID NO. 1;

ii) a nucleotide sequence that is fully complementary to i);

iii) The nucleotide sequence with the same promoter function is obtained by substituting, deleting and adding one or more nucleotide sequences in the nucleotide sequence shown in the i).

2. A primer pair for amplifying the promoter of claim 1.

3. The primer pair of claim 2, which is a primer pair as shown in SEQ ID NO. 2-3.

4. A biological material comprising the OsGMS, 4pro promoter of claim 1; the biological material is at least one of an expression cassette, a vector and a host cell.

5. The biomaterial according to claim 4, wherein when the biomaterial is an expression cassette, the expression cassette comprises the OsGMS pro promoter, functional gene and terminator functionally linked to each other in a transcription direction;

Preferably, the functional genes comprise selectable marker genes and/or genes associated with agronomic traits in plants.

6. A reagent or kit comprising the OsGMS pro 4 promoter of claim 1, or the primer pair of claim 2 or 3, or the biomaterial of claim 4 or 5.

7. Use of OsGMS a 4pro promoter according to claim 1, a primer pair according to claim 2 or 3, a biological material according to claim 4 or 5, or a reagent or kit according to claim 6 in at least one of the following:

1) Preparing a transgenic plant;

2) Driving expression of the gene in the plant;

3) Genetic breeding or germplasm improvement of plants;

4) And (5) plant hybridization seed production.

8. The use according to claim 7, characterized in that it comprises: constructing the OsGMS pro 4 promoter on a vector and then transforming into a plant;

Or introducing the biological material into a plant.

9. The use according to claim 7, wherein the gene is a functional gene, an antisense gene to a functional gene, or a microrna gene;

Preferably, the functional gene is a plant agronomic trait related gene or a selectable marker gene;

preferably, the small RNA gene is a small RNA gene capable of interfering with the expression of the functional gene.

10. The use according to any one of claims 7 to 9, wherein the plant comprises at least one of rice, maize, wheat, barley, soybean, cotton, canola, sorghum, millet.