CN114752573B - Application of rice OsGA20ox2 protein and coding gene thereof in improving abiotic stress resistance of plants - Google Patents

Abstract

The invention discloses a rice OsGA20ox2 protein and application of a coding gene thereof in improving abiotic stress resistance of plants. The invention adopts overexpression and CRISPR knockout technologies to knock rice outOsGA20ox2The gene is overexpressed or knockout-mutated in rice, and the overexpression in the rice is found according to the phenotypic change of transgenic rice plantsOsGA20ox2The gene can obviously improve the drought or osmotic stress resistance of rice, so that the rice OsGA20ox2 protein and the coding gene thereof can be applied to improving the abiotic stress resistance of plants, including: mixing riceOsGA20ox2The gene is overexpressed in the plant to obtain a transgenic plant, and the resistance of the obtained transgenic plant to drought stress or osmotic stress is obviously enhanced. The invention has application prospect in the aspects of improving and enhancing the stress resistance of rice, accelerating the breeding process of stress-resistant molecules and the like.

Description

Application of rice OsGA20ox2 protein and coding gene thereof in improving abiotic stress resistance of plants

Technical Field

The invention relates to a new application of rice OsGA20ox2 protein and a coding gene thereof, in particular to a new application of rice OsGA20ox2 protein and a coding gene thereof in improving abiotic stress resistance of plants, belonging to the field of new applications of rice OsGA20ox2 protein and a coding gene thereof.

Background

Rice (1)Oryza sativaL) is staple food of one third of the world population, is a main food crop in China and is vital to ensuring the food safety in China. Drought has continued for an increasing length since the 21 st century and seasonal, regional and water quality drought conditions have become more severe. Although a series of great progress is made in the aspects of stress-resistant and salt-tolerant gene function analysis and molecular breeding of rice, and the like, the stress-resistant molecular regulation and control mechanism analysis is still an important subject of the current stress research.

The inventor of the invention discovers that OsGA20ox2 (gibberella 20 oxidase 2, mutant, expressed) can be combined with stress-resistant candidate genes through protein interaction in the earlier stageOsGA2ox8，OsDRAP1Interact with each other, andOsGA2ox8、OsDRAP1are all up-regulated by ABA induction. Studies have shown that the stress tolerance of plants is extremely sensitive to phytohormones, that inhibition of Gibberellin (GAs) biosynthesis by application of chemical Growth inhibitors in agricultural production can significantly reduce the Plant height and improve drought tolerance of various crops, and that application of GA can reverse the enhanced stress tolerance of GA-deficient mutants and their dwarf Growth phenotype (Radiacher W. grown polynucleotides: effects on maize biosyntheses and other metabolic pathways. Annual Review of Plant physiology and Plant Molecular Biology, 2000, 51: 501-. The final step in GA biosynthesis and inactivation is catalyzed by soluble 2-oxoglutarate-dependent dioxygenases (2-ODDs), and GA20 oxidase catalyzes the multi-stage oxidation of GA12 and GA53 to form the C19 backbone. A large body of experimental evidence suggests that The gene encoding dioxygenase is The major site for The regulation of The GA biosynthetic pathway (Lo S. F., Yang S. Y., Chen K. T., et al. A novel class of gibberella 2-oxidases control gene amplification, tillering, and root degradation in rice Cell, 2008, 20(10): 2603-2618) to participate in the regulation of the growth of plants and the response reaction of the external environment stress. The homologous gene of OsGA20ox2 in Arabidopsis is AtGA20ox1 (At 4G 25420), and the existing research shows that after the key amino acid of AtGA20ox1 is mutated, the mutant shows obvious growth and development retardation and obvious reduction of Plant height (Luo Y., Dong X., Yu T., et al. A Single Nucleotide Deletion in Gibberellin 20-oxidase 1 Causes Alpine Dwarfigism in Arabidopsis, Plant Physiology, 2015, 168(3): 930-937.), overexpression of The AtGA20ox1 gene in rice can obviously improve The number of grains per ear and The yield per plant (228. Wu Y., Wang Y., Mi X.F., et al. QTL GNP1 encodes GA20ox1, while in The rice, wheat seeds number and yield by breeding cytokinin activity in rice, PLoS genetics, 2016, 12(10): e 6386). Up to now, any report on The effect of OsGA20ox2 protein or coding gene thereof in improving The drought stress resistance of plants is not seen.

Disclosure of Invention

The invention mainly aims to provide application of rice OsGA20ox2 protein or coding gene thereof in improving abiotic stress resistance of plants.

In order to achieve the above object, the present invention provides the following technical solutions:

one aspect of the invention is to provide the application of the rice OsGA20ox2 protein or the coding gene thereof in improving the abiotic stress resistance of plants; preferably, the abiotic stress includes drought stress or osmotic stress.

In a second aspect of the present invention, there is provided a method for increasing resistance of a plant to abiotic stress, comprising: carrying out overexpression on the coding gene of the rice OsGA20ox2 protein in a plant to obtain a transgenic plant; the resulting transgenic plants have increased resistance to abiotic stress; such as: connecting the coding gene of the rice OsGA20ox2 protein with an expression regulation element in an operable way to obtain a recombinant plant expression vector for expressing the coding gene in plants; transforming the recombinant plant expression vector into a receptor plant to ensure that the rice chitin coding gene is over-expressed in the plant; preferably, the abiotic stress includes drought stress or osmotic stress.

As a preferred embodiment of the present invention, said specific method for increasing the resistance of a plant to abiotic stress comprises: (1) constructing a recombinant plant expression vector containing the coding gene of the rice OsGA20ox2 protein; (2) transforming the constructed recombinant plant expression vector into a recipient plant tissue or plant cell; (3) and breeding and screening to obtain the transgenic plant with improved abiotic stress resistance.

In a third aspect of the present invention, there is provided a method for breeding a new variety of plants resistant to abiotic stress, comprising: (1) constructing a recombinant plant expression vector containing the coding gene of the rice OsGA20ox2 protein; (2) transforming the constructed recombinant plant expression vector into a recipient plant tissue or plant cell; (3) breeding and screening to obtain a new plant variety with improved abiotic stress resistance; preferably, the abiotic stress includes drought stress or osmotic stress.

The invention further provides a recombinant plant expression vector containing the coding gene of the rice OsGA20ox2 protein and a recombinant host cell containing the recombinant plant expression vector; the coding gene of the rice OsGA20ox2 protein is operably connected with an expression regulation element to obtain a recombinant plant expression vector; the recombinant plant expression vector can consist of a5 'end non-coding region, a coding gene of rice OsGA20ox2 protein and a 3' non-coding region; wherein, the 5' non-coding region can comprise a promoter sequence, an enhancer sequence or/and a translation enhancing sequence; the promoter can be a constitutive promoter, an inducible promoter, an enhanced promoter, a tissue or organ specific promoter; the 3' non-coding region may comprise a terminator sequence, an mRNA cleavage sequence, and the like. Suitable terminator sequences can be taken from the Ti-plasmid of Agrobacterium tumefaciens, for example the octopine synthase and nopaline synthase termination regions.

The recombinant plant expression vector may also contain a selectable marker gene for selection of transformed cells or tissues. The marker gene includes: genes encoding antibiotic resistance, genes conferring resistance to herbicidal compounds, and the like. In addition, the marker gene also comprises phenotypic markers, such as beta-galactosidase, fluorescent protein and the like.

As a specific embodiment of reference, the recombinant plant expression vector construction comprises: the coding gene of rice OsGA20ox2 protein is inserted between attR1 and attR2 at the lower part of GFP of a plant expression vector pMDC 43.

The transformation protocol and the protocol for introducing the gene (or polynucleotide) into a plant may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the gene poly (or nucleotide) into a plant cell include: microinjection, electroporation, agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment, among others. In particular embodiments, the gene (or polynucleotide) can be provided to the plant using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants using conventional methods.

The present invention can be used to transform any plant species, including but not limited to monocots or dicots; more preferably, the plant includes crops, vegetables or ornamental plants, fruit trees, etc., and may be, for example, rice, cotton, corn, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut, sugarcane, etc., preferably rice.

As a preferred embodiment of the present invention, the abiotic stress includes drought stress or osmotic stress.

As a preferred embodiment of the invention, the amino acid sequence of the rice OsGA20ox2 protein is shown in SEQ ID NO. 2; the CDS nucleotide sequence of the coding gene of the rice OsGA20ox2 protein is shown as SEQ ID NO.1, and the nucleotide sequence of the full-length gene of the coding gene of the rice OsGA20ox2 protein is shown as SEQ ID NO. 3. In addition, the polynucleotide shown in SEQ ID NO.1 or SEQ ID NO.3 can be optimized by those skilled in the art to enhance the expression efficiency in plants, particularly rice.

The present inventors previously found OsGA20ox2 (gibberella 20 oxidase 2) by protein interactionPush, expressed) except for the stress-resistant candidate gene which can be verified by the subject group of the present inventorsOsGA2ox8，OsDRAP1Interact with each other, andOsGA2ox8、OsDRAP1are all up-regulated by ABA induction. The invention further carries out gene cloning and function analysis by simulating phenotype change of rice plants with overexpression and CRISPR knockout under drought conditions by 20 percent PEG-6000, analyzes the relation between candidate genes and abiotic stress response of rice, and results show that the overexpression in the rice is carried outOsGA20ox2The gene can obviously improve the drought stress resistance of rice. The invention has very important theoretical and practical significance for improving and enhancing the stress resistance of rice and accelerating the stress-resistant molecular breeding process.

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, the description for a polypeptide applies equally to the description of a peptide and to the description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

The term "operably linked" refers to a functional linkage between two or more elements that may be operably linked and may or may not be contiguous.

The term "recombinant plant expression vector" means one or more DNA vectors used to effect plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, together with vectors with helper plasmids, are most commonly used for agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selectable markers engineered to be capable of expression in plant cells, heterologous DNA sequences to be transcribed, and the like.

The term "transformation" as used herein refers to the genetic transformation of a polynucleotide or polypeptide into a plant in such a manner that a gene encoding the rice OsGA20ox2 protein is introduced into the interior of a plant cell. Methods for introducing such polynucleotides or polypeptides into plants are well known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, virus-mediated methods, and the like. "stably transformed" means that the introduced polynucleotide construct is integrated into the genome of the plant cell and is capable of being inherited by progeny thereof; "transient transformation" refers to a polynucleotide that is introduced into a plant but is only transiently expressed or present in the plant.

Drawings

FIG. 1 shows PCR positive identification of transgenic plants of overexpression materials and knockout materials, wherein lanes 1 and 15 are positive controls of respectively adding an overexpression OE primer and a knockout KO primer to wild type materials, lane 16 is a negative control of added double distilled water, lane 8 is a 2000bp Mark marker, lanes 2 to 7 are identification results of overexpression materials, and lanes 9 to 14 are identification results of knockout materials.

FIG. 2 shows rice plantsOsGA20ox2Knock-out of individual strains of genes.

FIG. 3 shows riceOsGA20ox2The expression level of each strain of the gene-overexpressed material.

FIG. 4 is overexpressionOsGA20ox2The phenotype of the CRISPR knockout transgenic plant and the wild plant under the simulated drought stress of 20 percent PEG-6000 is shown; a is a phenotype picture before stress, and B is a phenotype picture after 20% PEG-6000 is stressed for 7 days and then the recovery culture is carried out for 7 days.

Detailed Description

The invention is further described below in conjunction with specific embodiments, the advantages and features of which will become apparent from the description. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

Example 1 OsGA20ox2Genetic transformation experiment of gene in rice

⒈OsGA20ox2Construction of Gene overexpression vectors

The pGWC vector (which is publicly available from the institute of crop science, national academy of agricultural sciences) was first digested with the restriction enzyme EmaI1051, linearized, and recovered.

Designing a primer according to the total length of a Nipponbare sequence, amplifying to obtain the total length of a gene coding region of the OsGA20ox2 protein by taking Nipponbare cDNA as a template, and adding joints after linearization of pGWC vectors at the 5 'end and the 3' end, wherein the amplification primer is as follows:

f: 5'-gcaggctttgactttATGGGCGGCCTCTCCATGGA-3' (underlined sequence for linker sequence);

r: 5'-gggtctagagactttTTAATTCTTCCTGAAATGC-3' (linker sequence underlined);

the DNA fragment of interest (1089bp) was amplified and recovered by PCR. In-Fusion HD Cloning Kit (Clontech, Code no: 639648) is adopted to carry out homologous recombination of a target fragment and a linearized vector, PCR and sequencing verification are carried out on a positive Cloning plasmid, and the sequencing result shows that the enzyme cutting site of EmaI1051 shown In SEQ ID NO.1 is inserted between two enzyme cutting sites of the vector pGWCOsGA20ox2The gene fragment (the amino acid sequence of the OsGA20ox2 protein coded by the sequence is shown in SEQ ID NO. 2) obtains an entry vector, and the recombinant vector is named as pGWC-OsGA20ox 2.

By using

LR

II enzyme mix (Invitrogen, Code NO: 11791020) for final vector construction, PCR and sequencing verification of the positive cloning plasmid, the sequencing result showed that the GFP downstream of the vector pMDC43 (the vector publicly available from the institute of crop science, national academy of agricultural sciences) was inserted with the sequence shown in SEQ ID NO.1OsGA20ox2The gene segment, the amino acid sequence of the OsGA20ox2 protein coded by the sequence is shown as SEQ ID NO.2, and the recombinant vector is named as pMDC43-OsGA20ox 2.

⒉OsGA20ox2Construction of Gene CRISPR knock-out vector

According toOsGA20ox2Designing a knockout target site by using a gene cDNA sequence, wherein the used websites are as follows: http:// skl. scau. edu. cn/dsdecode/;

target site 1 sequence: 5'-GGCCCCCGAGCACCGCCCCA-3', and the adhesive tape is used for adhering the film to a substrate,

target site 2 sequence: 5'-CCGAGCACACCAAGAACGTC-3' the flow of the air in the air conditioner,

experimental methods and vectors were obtained from Liu Guang Shi laboratory (Ma X, Zhang Q, Zhu Q, Liu W, ChenY, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, ZHao X, Dong Z, Liu YG. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in monomer and Dicot Plants, Molecular Plant, 2015, 8(8): 1274-.

⒊ Agrobacterium transformation

The expression vector pMDC43-OsGA20ox2 and the knock-out vector pYLCRISPR/Cas9Pubi-OsGA20ox2 were transferred into Agrobacterium EHA105 competent cells (publicly available from the institute of crop science, national academy of agricultural sciences, and non-patent documents describing the materials are Ruifang Yang, Qicai Tang, Huimei Wang, Xiaobo Zhang, Gang Pan, hong Wang and Jumin Tualloys of tworice (OrySativa) cycle-dependent enzyme inhibitors and effects of translational expression of OsiICK6 on growth and depression 2011, antibodies of Botany, 107: 1087), and the methods refer to the molecular cloning guidelines.

⒋ genetic transformation

The agrobacterium-mediated genetic transformation method is adopted, Nipponbare is used as a receptor material for genetic transformation, and the formula of a culture medium is shown in table 1.

TABLE 1 culture media and formulations for genetic transformation

The specific method comprises the following steps:

1) callus induction

Taking appropriate amount of mature rice seeds, shelling, cleaning and sterilizing with 70% alcohol for 1min, shaking continuously, and sterilizing with 15% sodium hypochlorite for 30min (shaking on shaking table); and finally, washing with sterile distilled water for 4-5 times, and inoculating after absorbing the water on the surface of the seeds with sterile filter paper. Inoculating the disinfected seeds into an induction culture medium containing 2, 4-D of 2.0mg/L, and performing dark culture at 28 ℃ for 30-40 days. The callus obtained by culturing is subjected to amplification culture on a subculture medium, and subcultured every 2 weeks until embryogenic callus is formed.

Infection with Agrobacterium

a) Agrobacterium carrying the expression plasmid vectors pMDC43-OsGA20ox2 and pYLCRISPR/Cas9Pubi-OsGA20ox2 were streaked onto the surface of LB solid medium containing antibiotics (50mg/L kanamycin or spectinomycin, 25mg/L rifampicin), cultured at 28 ℃ and 200rpm overnight.

b) A single colony was picked with a sterilized toothpick, inoculated into 5mL of YEB liquid medium containing the corresponding antibiotic, and shake-cultured at 28 ℃ until OD600 became 0.5.

c) The activated fresh bacterial suspension was inoculated into 25mL of the same YEB liquid medium at a ratio of 1:100, and cultured under the same conditions until the OD600 became 0.5.

d) Centrifuging the bacterial liquid at 5000g and 4 ℃ for 10min to collect thalli, and removing supernatant; 25mL of 10mM MgSO was added ₄ Suspending the thallus, gently sucking and beating with a pipette to fully suspend the thallus, centrifuging at 5000g and 4 ℃ for 10min to collect the thallus again, and discarding the supernatant.

e) Resuspend with 25mL AA-AS staining medium containing 200. mu.M Acetosyringone (AS).

f) Transferring the embryogenic callus with good growth state from the subculture medium to a culture dish (the callus is cut into 0.3-0.4 mm), and air-drying on an ultra-clean workbench for 10-20 min.

g) Immersing the dried embryogenic callus into a 50mL centrifuge tube containing the bacterial liquid for 20min, and shaking once every 5 min; then, the bacterial liquid is poured off, the callus is taken out and placed on sterile filter paper to be air-dried for 10-20 min, and then the callus is transferred to a CC culture medium with the surface paved with the sterile filter paper and containing 200 mu M Acetosyringone (AS) and is cultured for 3 days in the dark at the temperature of 25 ℃.

h) Callus without obvious agrobacterium on the surface was collected, washed 3 times with sterile water containing 600mg/L cefamycin, and excess water was aspirated.

i) Transferring the callus to a screening culture medium (N6 culture medium containing 500mg/L of cefuroxime axetil and 50mg/L of hygromycin) to continue screening for 2-3 times, and every time for two weeks. Finally, the bright yellow hygromycin resistant callus with good growth is obtained.

Regeneration of transformant plants

Fresh hygromycin-resistant callus is taken, the callus is divided into 2mm small blocks, the small blocks are inoculated into a pre-differentiation culture medium, dark culture is carried out for 7 days at the temperature of 28 ℃, then the small blocks are placed in a light culture room (12h light/12 h dark) for continuous culture for 8-9 days, the callus with the adventitious buds separated out is transferred to a regeneration culture medium (250mL tissue culture bottle), and light culture is carried out continuously. And transferring the seedlings to a rooting culture medium after adventitious buds grow into plantlets with the height of 4-6 cm, culturing for about 15 days in a 28 ℃ illumination culture room (12h illumination/12 h darkness) to obtain transformant plants, transferring the transformant plants to a greenhouse for planting (T0 generation), taking leaves after one month for PCR positive identification (Hpt-F: 5'-CTATTTCTTTGCCCTCGGAC-3', Hpt-R: 5'-CCTGACCTATTGCATCTCCC-3'), and harvesting the positive plant seeds of the transgenic plants (T1 generation) which are identified as positive.

The following OE and KO primers are identifying primers used for subsequent material identification whether homozygous or not:

OE primer

F：GTCCACACAATCTGCCCTTT

R：GTCCCTGACGTTCTTGGTGT

KO primer

F：GCCACCAGCTACTGATCGAC

R：CTGGTCGTCCTTGAAGAAGC

FIG. 1 shows the PCR identification results of transgenic plants of overexpression material and knockout material

FIG. 2 shows the comparison of different knockout types with wild type, A and B are 2 different types of targets, respectively.

⒌ molecular identification and stress resistance identification of transgenic plant

Selecting T2 generationOsGA20ox2Transgenic overexpression,OsGA20ox2Seeds of the gene CRISPR and wild Nipponbare germinate and are sown in a box filled with turfy soil, the culture condition is 16/8h under light/dark conditions, the light condition is 26 ℃, the dark condition is 22 ℃, and the light intensity is 30000 lx. The expression level of the transgenic rice at the RNA level is detected by using a fluorescent quantitative PCR (method as above) and a sequencing method.

FIG. 3 is a drawing showingOsGA20ox2Gene overexpression MaterialThe expression level of each strain. As can be seen from fig. 3, compared to the wild-type material,OsGA20ox2gene overexpression Material in strains other than Strain 3OsGA20ox2The expression level of the gene is improved to different degrees.

The following are knock-outs of knock-out material, two types of 3 lines being knocked-out:

type 1:

position 1 CCGAGCACCGCCC-AAGGCGTCC

Type 2:

position 1 CCGAGCACCGCCC-AAGGCGTCC

Position 2 ATGGGGTACTACGCGTC- -GGGACTGGAAG

Type 1:

ATGGGCGGCCTCTCCATGGACCAGGCGTTCGTGCAGGCCCCCGAGCACCGCCC-AAGGCGTCCGTCGCCGAGGCCGACGGCATCCCGGTCATCGACCTCTCCCCTCTCCTCGCCGCCGGCGATGGCGACGCCGACGGGGTGGACGCGCTCGCGGCGGAGGTCGGGAGGGCGAGCCGGGACTGGGGCTTCTTCGTGGTGGTGCGCCACGGTGTGCCCGCGGAGGCGGTGGCGCGCGCGGCGGAGGCGCAGAGGACGTTCTTCGCGCTGCCGCCGGAGCGGAGGGCGGCCGTGGCGCGGAGCGAGGCGGCGCCGATGGGGTACTACGCGTCCGAGCACACCAAGAACGTCAGGGACTGGAAGGAGGTGTTCGACCTCGTCCCGCGCCAGACGCCGCCGCCGCCGACGACCGCCGTGGCCGACGGCGACCTGGTGTTCGACAACAAGTGGCCCGACGACCTGCCGGGATTCAGGGAGGCAATGGAGGAGTACGGCGAAGCGGTGGAGGAGCTGGCGTTCAAGCTGCTGGAGCTGATCGCCAGGAGCCTCGGCCTGAGACCCGACCGCCTCCATGGCTTCTTCAAGGACGACCAGACCACCTTCATCCGGCTCAACCACTACCCTCCCTGCCCGAGCCCCGACCTCGCCCTCGGCGTCGGCCGCCACAAGGACGCCGGCGCGCTCACCGTGCTCTACCAGGACGATGTCGGCGGCCTCGACGTCCGCCGCCGATCCGACGGCGAGTGGGTGCGCGTCAGGCCCGTCCCTCACTCCTTCATCATCAACGTCGGCGACATCATCCAGGTGTGGAGCAATGACAGGTACGAGAGCGCGGAGCACCGGGTGGCGGTGAACGTGGAGAAGGAGAGGTTCTCCATCCCTTTCTTCTTCAACCCGGCGGGCCACACCATGGTGGAGCCACTGGAGGAGGTCGTGAGCGACGAGAGCCCGGCCAGGTACAACCCCTACAACTGGGGCGAATTCTTCAGCACCAGGAAGAACAGCAACTTCAAGAAGCTGGACGTGGAGAACGTCCAGATCACGCATTTCAGGAAGAATTAA

type 2:

ATGGGCGGCCTCTCCATGGACCAGGCGTTCGTGCAGGCCCCCGAGCACCGCCC-AAGGCGTCCGTCGCCGAGGCCGACGGCATCCCGGTCATCGACCTCTCCCCTCTCCTCGCCGCCGGCGATGGCGACGCCGACGGGGTGGACGCGCTCGCGGCGGAGGTCGGGAGGGCGAGCCGGGACTGGGGCTTCTTCGTGGTGGTGCGCCACGGTGTGCCCGCGGAGGCGGTGGCGCGCGCGGCGGAGGCGCAGAGGACGTTCTTCGCGCTGCCGCCGGAGCGGAGGGCGGCCGTGGCGCGGAGCGAGGCGGCGCCGATGGGGTACTACGCGTC--------------------GGGACTGGAAGGAGGTGTTCGACCTCGTCCCGCGCCAGACGCCGCCGCCGCCGACGACCGCCGTGGCCGACGGCGACCTGGTGTTCGACAACAAGTGGCCCGACGACCTGCCGGGATTCAGGGAGGCAATGGAGGAGTACGGCGAAGCGGTGGAGGAGCTGGCGTTCAAGCTGCTGGAGCTGATCGCCAGGAGCCTCGGCCTGAGACCCGACCGCCTCCATGGCTTCTTCAAGGACGACCAGACCACCTTCATCCGGCTCAACCACTACCCTCCCTGCCCGAGCCCCGACCTCGCCCTCGGCGTCGGCCGCCACAAGGACGCCGGCGCGCTCACCGTGCTCTACCAGGACGATGTCGGCGGCCTCGACGTCCGCCGCCGATCCGACGGCGAGTGGGTGCGCGTCAGGCCCGTCCCTCACTCCTTCATCATCAACGTCGGCGACATCATCCAGGTGTGGAGCAATGACAGGTACGAGAGCGCGGAGCACCGGGTGGCGGTGAACGTGGAGAAGGAGAGGTTCTCCATCCCTTTCTTCTTCAACCCGGCGGGCCACACCATGGTGGAGCCACTGGAGGAGGTCGTGAGCGACGAGAGCCCGGCCAGGTACAACCCCTACAACTGGGGCGAATTCTTCAGCACCAGGAAGAACAGCAACTTCAAGAAGCTGGACGTGGAGAACGTCCAGATCACGCATTTCAGGAAGAATTAA。

drought stress was simulated by treatment with PEG (20%) at the four-leaf stage of rice growth, with 6 random replicates per stress treatment, and 3 replicates for the experiment, with the results shown in figure 4. In FIG. 4, the left part isOsGA20ox2The phenotype of the transgenic line and the wild type plant before stress, and the phenotype of the transgenic line and the wild type line after 7 days of treatment and 7 days of recovery period respectively by 20 percent PEG-6000 at the right part.

As can be seen from the test results in FIG. 4, rice was overexpressed in riceOsGA20ox2The gene can obviously improve the drought stress resistance of rice and can improve the drought stress resistance of riceOsGA20ox2The gene can obviously reduce the drought stress resistance of rice after mutation or knockout, so that the rice OsGA20ox2 protein, the coding gene and the recombinant vector thereof can be applied to enhancing the abiotic stress resistance of crops.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> rice OsGA20ox2 protein and application of coding gene thereof in improving abiotic stress resistance of plants

<130> BJ-2011-220214A-L

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1059

<212> DNA

<213> Oryza sativa L

<400> 1

atgggcggcc tctccatgga ccaggcgttc gtgcaggccc ccgagcaccg ccccaaggcg 60

tccgtcgccg aggccgacgg catcccggtc atcgacctct cccctctcct cgccgccggc 120

gatggcgacg ccgacggggt ggacgcgctc gcggcggagg tcgggagggc gagccgggac 180

tggggcttct tcgtggtggt gcgccacggt gtgcccgcgg aggcggtggc gcgcgcggcg 240

gaggcgcaga ggacgttctt cgcgctgccg ccggagcgga gggcggccgt ggcgcggagc 300

gaggcggcgc cgatggggta ctacgcgtcc gagcacacca agaacgtcag ggactggaag 360

gaggtgttcg acctcgtccc gcgccagacg ccgccgccgc cgacgaccgc cgtggccgac 420

ggcgacctgg tgttcgacaa caagtggccc gacgacctgc cgggattcag ggaggcaatg 480

gaggagtacg gcgaagcggt ggaggagctg gcgttcaagc tgctggagct gatcgccagg 540

agcctcggcc tgagacccga ccgcctccat ggcttcttca aggacgacca gaccaccttc 600

atccggctca accactaccc tccctgcccg agccccgacc tcgccctcgg cgtcggccgc 660

cacaaggacg ccggcgcgct caccgtgctc taccaggacg atgtcggcgg cctcgacgtc 720

cgccgccgat ccgacggcga gtgggtgcgc gtcaggcccg tccctcactc cttcatcatc 780

aacgtcggcg acatcatcca ggtgtggagc aatgacaggt acgagagcgc ggagcaccgg 840

gtggcggtga acgtggagaa ggagaggttc tccatccctt tcttcttcaa cccggcgggc 900

cacaccatgg tggagccact ggaggaggtc gtgagcgacg agagcccggc caggtacaac 960

ccctacaact ggggcgaatt cttcagcacc aggaagaaca gcaacttcaa gaagctggac 1020

gtggagaacg tccagatcac gcatttcagg aagaattaa 1059

<210> 2

<211> 352

<212> PRT

<213> Oryza sativa L

<400> 2

Met Gly Gly Leu Ser Met Asp Gln Ala Phe Val Gln Ala Pro Glu His

1 5 10 15

Arg Pro Lys Ala Ser Val Ala Glu Ala Asp Gly Ile Pro Val Ile Asp

20 25 30

Leu Ser Pro Leu Leu Ala Ala Gly Asp Gly Asp Ala Asp Gly Val Asp

35 40 45

Ala Leu Ala Ala Glu Val Gly Arg Ala Ser Arg Asp Trp Gly Phe Phe

50 55 60

Val Val Val Arg His Gly Val Pro Ala Glu Ala Val Ala Arg Ala Ala

65 70 75 80

Glu Ala Gln Arg Thr Phe Phe Ala Leu Pro Pro Glu Arg Arg Ala Ala

85 90 95

Val Ala Arg Ser Glu Ala Ala Pro Met Gly Tyr Tyr Ala Ser Glu His

100 105 110

Thr Lys Asn Val Arg Asp Trp Lys Glu Val Phe Asp Leu Val Pro Arg

115 120 125

Gln Thr Pro Pro Pro Pro Thr Thr Ala Val Ala Asp Gly Asp Leu Val

130 135 140

Phe Asp Asn Lys Trp Pro Asp Asp Leu Pro Gly Phe Arg Glu Ala Met

145 150 155 160

Glu Glu Tyr Gly Glu Ala Val Glu Glu Leu Ala Phe Lys Leu Leu Glu

165 170 175

Leu Ile Ala Arg Ser Leu Gly Leu Arg Pro Asp Arg Leu His Gly Phe

180 185 190

Phe Lys Asp Asp Gln Thr Thr Phe Ile Arg Leu Asn His Tyr Pro Pro

195 200 205

Cys Pro Ser Pro Asp Leu Ala Leu Gly Val Gly Arg His Lys Asp Ala

210 215 220

Gly Ala Leu Thr Val Leu Tyr Gln Asp Asp Val Gly Gly Leu Asp Val

225 230 235 240

Arg Arg Arg Ser Asp Gly Glu Trp Val Arg Val Arg Pro Val Pro His

245 250 255

Ser Phe Ile Ile Asn Val Gly Asp Ile Ile Gln Val Trp Ser Asn Asp

260 265 270

Arg Tyr Glu Ser Ala Glu His Arg Val Ala Val Asn Val Glu Lys Glu

275 280 285

Arg Phe Ser Ile Pro Phe Phe Phe Asn Pro Ala Gly His Thr Met Val

290 295 300

Glu Pro Leu Glu Glu Val Val Ser Asp Glu Ser Pro Ala Arg Tyr Asn

305 310 315 320

Pro Tyr Asn Trp Gly Glu Phe Phe Ser Thr Arg Lys Asn Ser Asn Phe

325 330 335

Lys Lys Leu Asp Val Glu Asn Val Gln Ile Thr His Phe Arg Lys Asn

340 345 350

<210> 3

<211> 1336

<212> DNA

<213> Oryza sativa L

<400> 3

acacacgctg acacacgaga cgaacacttg tgctacagct tctcgccacc agctactgat 60

cgaccatggg cggcctctcc atggaccagg cgttcgtgca ggcccccgag caccgcccca 120

aggcgtccgt cgccgaggcc gacggcatcc cggtcatcga cctctcccct ctcctcgccg 180

ccggcgatgg cgacgccgac ggggtggacg cgctcgcggc ggaggtcggg agggcgagcc 240

gggactgggg cttcttcgtg gtggtgcgcc acggtgtgcc cgcggaggcg gtggcgcgcg 300

cggcggaggc gcagaggacg ttcttcgcgc tgccgccgga gcggagggcg gccgtggcgc 360

ggagcgaggc ggcgccgatg gggtactacg cgtccgagca caccaagaac gtcagggact 420

ggaaggaggt gttcgacctc gtcccgcgcc agacgccgcc gccgccgacg accgccgtgg 480

ccgacggcga cctggtgttc gacaacaagt ggcccgacga cctgccggga ttcagggagg 540

caatggagga gtacggcgaa gcggtggagg agctggcgtt caagctgctg gagctgatcg 600

ccaggagcct cggcctgaga cccgaccgcc tccatggctt cttcaaggac gaccagacca 660

ccttcatccg gctcaaccac taccctccct gcccgagccc cgacctcgcc ctcggcgtcg 720

gccgccacaa ggacgccggc gcgctcaccg tgctctacca ggacgatgtc ggcggcctcg 780

acgtccgccg ccgatccgac ggcgagtggg tgcgcgtcag gcccgtccct cactccttca 840

tcatcaacgt cggcgacatc atccaggtgt ggagcaatga caggtacgag agcgcggagc 900

accgggtggc ggtgaacgtg gagaaggaga ggttctccat ccctttcttc ttcaacccgg 960

cgggccacac catggtggag ccactggagg aggtcgtgag cgacgagagc ccggccaggt 1020

acaaccccta caactggggc gaattcttca gcaccaggaa gaacagcaac ttcaagaagc 1080

tggacgtgga gaacgtccag atcacgcatt tcaggaagaa ttaacgcgcc ggctagatca 1140

tgttcagtaa attttcagat gatgatgcgt ggacaaccat atagcctttg cgtcataagt 1200

taataatgtc tgtgacagta tatcatgtaa acaatcgtat gatgtggctt ctctatctgc 1260

cggtgatggt aatgtgacat tgtagaagag ggtttgtgag atacttcctt cacttaactt 1320

ttacgaatga atatag 1336

Claims (4)

1. Use of rice OsGA20ox2 protein or CDS of coding gene of rice OsGA20ox2 protein for improving abiotic stress resistance of plants; the abiotic stress comprises drought stress or osmotic stress; the plant is rice; the amino acid sequence of the rice OsGA20ox2 protein is shown in SEQ ID NO. 2; the nucleotide sequence of CDS of the encoding gene of the rice OsGA20ox2 protein is shown in SEQ ID NO. 1.

2. A method of increasing resistance of a plant to abiotic stress comprising: mixing riceOsGA20ox2Carrying out overexpression on CDS of the coding gene in a plant to obtain a transgenic plant; the resulting transgenic plants have increased resistance to abiotic stress; the rice isOsGA20ox2The nucleotide sequence of CDS of the coding gene is shown as SEQ ID NO. 1; the abiotic stress includes drought stress or osmotic stress; the plant is rice.

3. The method of claim 2, comprising: (1) construction of a Rice containingOsGA20ox2A recombinant plant expression vector encoding the CDS of a gene; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) cultivation methodAnd breeding and screening to obtain the transgenic plant with improved abiotic stress resistance.

4. A method for breeding a new variety of plants resistant to abiotic stress, comprising: (1) construction of a Rice containingOsGA20ox2Recombinant plant expression vector encoding CDS of gene, wherein said rice plantOsGA20ox2The nucleotide sequence of CDS of the coding gene is shown as SEQ ID NO. 1; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; (3) breeding and screening to obtain a new plant variety with improved abiotic stress resistance; the abiotic stress includes drought stress and osmotic stress; the plant is rice.

Images