CN109867715B

CN109867715B - Application of chloroplast protein and ATPase enzymatic activity mutant in improvement of stress resistance of plants

Info

Publication number: CN109867715B
Application number: CN201910151790.6A
Authority: CN
Inventors: 刘莉; 杨红; 李萍; 袁文雅
Original assignee: Kunming Institute of Botany of CAS
Current assignee: Lishui Runsheng Bryophyta Technology Co ltd
Priority date: 2019-02-28
Filing date: 2019-02-28
Publication date: 2022-06-17
Anticipated expiration: 2039-02-28
Also published as: CN109867715A

Abstract

The invention provides application of chloroplast protein encoded by a moss PpHsp70 gene and a PpHsp70 gene and an ATPase enzyme mutant PpHsp70m thereof in improving comprehensive stress resistance of plants such as high temperature resistance, drought resistance, salt stress resistance and the like. According to the invention, through carrying out molecular identification and stress tests on the PpHsp70 gene and the enzyme activity mutant PpHsp70m thereof in moss and rice overexpression transgenic plants, the expression quantity change, resistance change and the like of the PpHsp70 and PpHsp70m genes are detected, and the results show that compared with wild types, the PpHsp70 and PpHsp70m gene overexpression transgenic plants are more tolerant to high temperature, drought and salt stress respectively. The protein coded by the PpHsp70 gene and the enzyme activity mutant thereof are key factors influencing the comprehensive stress resistance of plants and can be applied to the improvement of the stress resistance quality of the plants.

Description

Application of chloroplast protein and ATPase enzymatic activity mutant in improvement of stress resistance of plants

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a PpHsp70 gene, a chloroplast protein coded by the PpHsp70 gene and application of an ATPase enzyme mutant PpHsp70m of the chloroplast protein in improving comprehensive stress resistance of plants.

Background

Environmental stress causes a large number of protein dysfunctions at the plant cell level, and one of the most effective repair measures widely taken by cells is the binding of heat shock proteins (also called chaperones, Hsps) to denatured proteins, maintaining the soluble state of the proteins, helping the unfolded proteins to reassemble into active conformation ((

2000). Is originally atAccumulation of such specific proteins is found under heat shock conditions, and it is recognized today that the cellular activities in which they are involved are far more than maintaining a stable conformation of the proteins under heat shock treatment. Studies in plants have shown that overexpression of Hsp26 significantly enhances the heat tolerance of arabidopsis and rice (Xue et al, 2010; Kim et al, 2012). The maize chloroplast sHsp26 was significantly elevated under the combined high temperature and drought treatment, and proteome analysis of the intervention experiments showed that sHsp26 was able to stabilize the chloroplast proteome and the protein conformation of PSII to enhance drought tolerance in maize (Hu et al, 2010). Only one report of participation of Hsps in abiotic stress in physcomitrella patens to date comes from pphsp16.4, which responds to abscisic acid (ABA), salt stress and salicylic acid induction, and proteins are usually aggregated around chloroplasts in the form of oligomeric complexes, and studies thereof have demonstrated that the stress tolerance capability of physcomitrella patens derives from a mechanism of repair and restoration after protection of cellular integrity from stress in the adverse environment (Ruibal et al, 2013).

Hsp70 is a widely-occurring class of chaperones in eukaryotes, is highly conserved in evolutionary structure and function, and mainly functions to aid in folding and assembly of other proteins, to prevent protein misconvergence, and to aid in protein transport across membranes (Stetler et al, 2010). Hsp70 can be involved in the homeostasis of protein folding and protein interactions with ATP binding and hydrolytic tight binding, affecting the stability of the whole protein system (Preissler et al, 2017), and also in degradation following misfolding polymerization of the first step enzyme in the MEP pathway, maintaining normal functioning of the cell (Llamas et al, 2017). The discovery of the Hsp70 family in Drosophila has been more than half a century (Ritossa,1962), and in recent years it has become increasingly recognized that the Hsp70 family acts against adversity, in that maize seedlings are treated with 100. mu.M ABA and then H₂O₂The rapid rise in levels resulted in significant accumulation of cytoplasmic Hsp70 leading to enhanced drought and high temperature resistance (Hu et al, 2010). H is found in both animal cells (Guo et al, 2007) or plant cells (Dat et al, 2000; Mittler,2002)₂O₂Accumulation of (a) resulted in the massive expression of Hsp70 family members, suggesting that Hsp70 is involved in cytoprotective efforts. Hsp70 as hydrolase with the ability to hydrolyze ATP substrate, forms a system with Hsp40 and GrpECompleting the precursor protein transport task, Hsp40 is responsible for recruiting the precursor protein to form a complex, binding to Hsp70/ATP completes the hydrolysis reaction, the energy generated drives the substrate into the chloroplast stroma GrpE to assist in releasing ADP, and new ATP enters Hsp70 to start the next cycle (Liu et al, 2014). Altering the activity of Hsp70 hydrolase is an important method for altering the activity and function of proteins.

The moss is one of the oldest terrestrial plants, is a transition plant from aquatic to terrestrial, is differentiated 4 hundred million to 5 million years ago, is located behind algae, in front of ferns and seed plants in the evolution position, and belongs to sister clades on a unigenic system with microtubular plants, and has an extremely important research position. There are about 21200 bryophytes all over the world, which are located in every corner of the earth except the ocean, even in desert, frozen source and rock, drought-resistant, cold-resistant, barren-resistant, and highly adaptable, and are pioneers and migrators of nature (Kidron, 2014; Cao is equivalent, 2014). Stress adaptation studies with moss have become one of the hot spots for stress tolerance studies (Doherty et al, 2017), and stress tolerance improvement and studies of other higher plants using moss-derived genes are also in progress (Liu et al, 2017). Genomics and molecular biology researches carried out by taking physcomitrella patens as objects show that physcomitrella patens can obtain drought-resistant genes, high-temperature-resistant genes, photosensitive genes, ultraviolet repair genes and other land stress response genes (Rabara et al, 2013; Rensing et al, 2008) in order to adapt to land life. According to the investigation on plant resources in the regions with serious damage to the ecological environment of large copper ores and gold ores in various provinces of China, moss is found to grow as pioneer plants in places where vascular plants cannot survive. Therefore, the moss is used as a gene donor, so that the moss has universal adaptability, and meanwhile, the symbiotic non-influence of the moss and other higher plants lays a foundation for the application of the moss in crop improvement.

Unfortunately, there are very few cases of genetic improvement of stress resistance by using moss chaperone gene, and no report is available on the improvement of comprehensive stress resistance. The invention firstly utilizes the chloroplast chaperonin and the enzyme activity change mutant thereof to obtain the comprehensive resistance materials of various plants, and provides theoretical and practical basis for the abiotic stress resistance of the plants and the environmental diversity change and genetic engineering improvement.

Disclosure of Invention

The invention aims to develop and utilize a chloroplast heat shock protein gene of physcomitrella patens, and provides application of a PpHsp70 gene or an ATPase enzyme activity change mutant in improvement of plant stress resistance.

In order to achieve the above purpose of the present invention, the present invention provides the following technical solutions:

the application of the chloroplast protein coded by the PpHsp70 gene or the PpHsp70 gene and the ATPase enzymatic activity mutant thereof in improving the stress resistance of plants.

The PpHsp70 gene or the chloroplast protein coded by the PpHsp70 gene and the ATPase enzyme activity mutant thereof are applied to the improvement of high temperature resistance, drought resistance and salt stress resistance of plants.

According to the application, the nucleotide sequence of the PpHsp70 gene is shown as SEQ ID No. 1.

According to the application, the amino acid sequence of the protein encoded by the PpHsp70 gene is shown as SEQ ID No. 2.

According to the application, the ATPase enzyme mutant of the PpHsp70 gene generates mutation from threonine to alanine T271A at the 271 th amino acid site of the original PpHsp 70.

The use according to any one of the preceding claims, wherein the improvement of the high temperature, drought and salt stress tolerance of plants is achieved by the following method steps:

(1) connecting the coding sequence to plant expression regulating sequence to form plant expression vector;

(2) introducing the plant expression vector into physcomitrella patens by a PEG-mediated protoplast method, transferring the physcomitrella patens into rice plant cells by an agrobacterium infection method, and screening to obtain transformed cells;

(3) carrying out plant regeneration on the transformed cells, and identifying to obtain a transgenic positive plant;

(4) and (3) screening and evaluating the stress resistance of the transgenic positive plant.

According to the use, wherein the plant is Physcomitrella patens and rice.

According to the use, wherein the stress resistance is high temperature resistance, drought resistance and high salt resistance.

The invention also provides a method for improving the stress resistance of plants, which comprises the following steps:

(1) PpHsp70m is obtained after the 271 th base point mutation of the ATP binding region of the gene PpHsp70, and ATPase enzyme activity is tested;

(2) connecting PpHsp70 and PpHsp70m to a plant expression regulation sequence to form a plant recombinant expression vector which is a physcomitrella patens expression vector and a rice expression vector respectively;

(3) introducing the plant recombinant expression vector into physcomitrella patens cells by a PEG-mediated protoplast transformation method, and screening to obtain transformed plants;

(4) transferring the plant recombinant expression vector into rice plant callus by an agrobacterium-mediated method, and screening to obtain a transformed plant;

(5) stress resistance screening is carried out on physcomitrella patens plants with the obtained PpHsp70 and PpHsp70m genes overexpressed to obtain a resistance index;

(6) rice plant T with the obtained PpHsp70 and PpHsp70m genes over-expressed₀And (4) carrying out stress resistance screening on the seeds obtained by harvest in the seedling stage after germination to obtain resistance indexes.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides application of PpHsp70 and ATPase enzyme-activated mutant PpHsp70m genes or protein coded by the genes in improvement of plant stress resistance. The invention detects the gene expression quantity, resistance change and the like of PpHsp70 overexpression transgenic plants by carrying out molecular identification and abiotic stress tests on the plants. As a result, it was found that: compared with wild plants, the physcomitrella patens overexpression transgenic plants have stronger recovery capability after high-temperature, drought and high-salt treatment, and the tolerance of rice overexpression plants to the stress is improved to different degrees. The gene PpHsp70 and PpHsp70m or the protein coded by the gene can be used for improving the stress resistance of various plants.

Drawings

FIG. 1 shows the ATPase activity of PpHsp70 and PpHsp70m proteins described in example 1 of the present invention. Results of ATPase activity assays of PpHsp70 and PpHsp70m proteins showed a 20% increase in PpHsp70m (TA) activity. The abscissa represents the concentration of ATP substrate used in the reaction solution. Data were derived from three biological replicates. "x" indicates P value less than 0.05 for t test, significant difference; ". indicates that the P value of the t test was less than 0.01, and the difference was very significant. Differential analysis of the data was compared to enzymatic activity at the same substrate concentration as PpHsp 70.

FIG. 2 shows the identification results of the PpHsp70 and PpHsp70m genes over-expressed physcomitrella patens plants in the example 1 of the present invention at DNA and RNA levels. Identification result of overexpression physcomitrella patens. A, a PCR detection result of the DNA level of the transgenic plant is shown, wherein the first lane from the left is a DNA Marker, and the second lane is a positive plasmid control. The third lane is a negative control. The other lanes are 4 independent transformants. B, qPCR detection result of transgenic plant RNA level. Data were derived from three biological replicates.

FIG. 3 shows that PpHsp70 and PpHsp70m genes expressed in example 1 of the present invention respond to the change of chlorophyll fluorescence parameter Fv/Fm under stress (high temperature, drought and 0.5mM high salt) treatment of Physcomitrella patens plants, and compared with wild type control, the photosynthetic parameter of the over-expressed plants is higher, which indicates that the recovery ability is improved to different degrees under various stress conditions. The PpHsp70 and PpHsp70m genes over-express the change of chlorophyll fluorescence parameter Fv/Fm under stress (high temperature, drought and 0.5mM high salt) treatment response of physcomitrella patens plants, compared with wild type control, the photosynthetic parameter of the over-expressed plants is higher, which shows that the recovery capability is improved to different degrees under various stresses. Data were derived from three biological replicates. "x" indicates P value less than 0.05 for t test, significant difference; ". indicates that the P value of the t test was less than 0.01, and the difference was very significant. The differential analysis of the data was compared to the control parameters under the same treatment conditions.

FIG. 4 shows the identification results of rice plants with over-expressed PpHsp70 and PpHsp70m genes at DNA and RNA levels according to example 1 of the present invention. Identification results of over-expressed rice plants. And A, performing PCR detection on the DNA level of the transgenic plant, wherein the first lane from the left is a DNA Marker, and the second lane is a negative control. The third lane is a positive plasmid control. The other lanes are 3 independent transformants. B, a transgenic plant RNA level qPCR detection result. Data were derived from three biological replicates.

FIG. 5 shows the phenotypic changes of plants under the stress treatment response of the rice plants overexpressing PpHsp70 and PpHsp70m genes in example 1, compared with wild type control, the tolerance of the overexpressing plants to different stresses is improved. A, counting the survival rate of plants under high-temperature and drought treatment; b, counting the plant height under the 0.2mM high-salt treatment. The phenotype of the plants is changed under the stress treatment response of the rice plants overexpressed by the PpHsp70 and PpHsp70m genes, and compared with wild type control, the tolerance of the overexpressed plants to different stresses is improved. A, counting the survival rate of plants under high-temperature and drought treatment; b, counting the plant height under the 0.2mM high-salt treatment. Data were derived from three biological replicates. "x" indicates P value less than 0.05 for t test, significant difference; "x" indicates that the P value for the t test was less than 0.01, and the difference was very significant. The differential analysis of the data was compared to the control parameters under the same treatment conditions.

FIG. 6 is the vector diagram of pPOG1 and pCAMBIA2300 for plant expression regulation.

Detailed Description

The invention provides application of PpHsp70 and 271 th mutant PpHsp70m genes or protein encoded by the genes in improving the stress resistance of plants. In the invention, the PpHsp70 gene is a heat shock protein encoding gene universally existing in organisms and is derived from physcomitrella patens chloroplast. The nucleotide sequence of the PpHsp70 gene is preferably shown as SEQ ID No. 1. The amino acid sequence of the protein coded by the PpHsp70 gene is preferably shown as SEQ ID No. 2. The expression protein shown in SEQ ID No.2 comprises a segment of adenosine triphosphate (ATPase) functional domain with 400 amino acids at the N-terminal. The invention detects the gene expression quantity condition, resistance change and the like of PpHsp70 and ATPase enzyme mutant PpHsp70m through carrying out molecular identification and stress test on transgenic plants overexpressed. It was found that over-expressed transgenic plants are more tolerant to high temperature, drought, salt stress than wild type. The gene PpHsp70 and PpHsp70m or the protein coded by the gene can be used for improving the stress resistance variety of plants.

The application of the PpHsp70 and PpHsp70m genes and the proteins coded by the genes in improving the stress resistance of plants preferably comprises the following steps:

(1) the vectors pCAMBIA2300 and pPOG1 containing the PpHsp70 and PpHsp70m genes were designed and constructed.

(2) Enzyme digestion step: the pCAMBIA2300 and pPOG1 in (1) are subjected to enzyme digestion to obtain pCAMBIA2300 and pPOG1 gene fragments;

(3) connecting gene fragments of PpHsp70 and PpHsp70m with gene fragments of the vectors pCAMBIA2300 and pPOG1 obtained in the step (2) to obtain expression vectors pCAMBIA2300-PpHsp70, pCAMBIA2300-PpHsp70m, pPOG1-PpHsp70 and pPOG1-PpHsp70 m;

(4) transforming expression vectors pPOG1-PpHsp70 and pPOG1-PpHsp70m into cells of physcomitrella patens by using a PEG-mediated protoplast transformation method, and screening to obtain regeneration plants over-expressing PpHsp70 and PpHsp70 m; by utilizing an agrobacterium-mediated method, the expression vectors pCAMBIA2300-PpHsp70 and pCAMBIA2300-PpHsp70m are respectively infected into rice callus by an agrobacterium-soaking method, and resistant callus is obtained by cleaning and screening, and then regeneration plants of over-expressed PpHsp70 and PpHsp70m are obtained.

(5) And identifying the DNA level and the RNA level after obtaining the resistant plants to obtain positive plants.

(6) The method for identifying the stress resistance after obtaining the positive plant is to test the high-temperature, drought and high-salt tolerance of the obtained over-expressed regenerated plant.

The invention provides a method for improving plant stress resistance by using PpHsp70 and PpHsp70m genes and proteins encoded by the genes, which is not to be construed as a limitation of the scope of the invention.

Example 1

The target gene PpHsp70 is a heat shock protein coding gene derived from physcomitrella patens, the coding sequence of the gene is shown as SEQ ID No.1, and the amino acid sequence of the protein coded by the gene PpHsp70 is shown as SEQ ID No. 2. PpHsp70m was derived from a site-directed mutation of threonine (Thr) to alanine (Ala) at amino acid position 271 with PpHsp 70.

Example 2

Production of ATPase enzyme T271A mutant PpHsp70 m.

The cDNA sequence of PpHsp70 was amplified from the cDNA fragment obtained by reverse transcription of physcomitrella patens RNA, and then linked to the T vector by TA kit (Dalibao bioengineering Co., Ltd.) to become T-Hsp 70. An amplification primer: PpHsp70m-F: ATGGCATCCGCGGTGGGATC (SEQ ID No.3) PpHsp70m-R: CGTTGAATCAGTGAAGTCTG (SEQ ID No. 4). The PpHsp70m was finally obtained by PCR using QuikChange kit (Stratagene, USA) kit to generate site-directed mutation of T-Hsp70 from threonine (Thr) to alanine (Ala) at amino acid position 271. The PCR amplification primer sequences are as follows: QCTAF CTTGGCGGGGGCGCCTTTGATGTTTC; QCTAR: GAAACATCAAAGGCGCCCCCGCCAAG.

Example 3

ATPase activity assay and results.

The physcomitrella patens PpHsp70 and PpHsp70m genes were constructed on pTYB12 vector using SpeI and BamHI endonuclease, and the expression vector was transformed into BL21(DE3) competent cells (TransGen Biotech, a Beijing holotype gold organism). Hsp70 protein was purified after induction with 1mM isopropyl beta-D-1-thiogalactoside using chitin powder from New England Biolabs according to the protocol. Purified protein was concentrated using an Amicon Ultra-4 centrifugal filtration unit and then the protein concentration was tested by Bradford assay using BSA as a standard. ATPase activity was determined by the modified malachite green method (Chang et al, 2008). The method comprises the following specific steps: a reaction system containing gradient ATP concentrations (0to 10mM), DnaK, Hsp70(0.3mM), DnaJ (1mM), GrpE (1mM), prSSU (100nM), and NR synthesis substrate (NRLLLTG, 200 nM; synthesized by Shanghai Czeri bioengineering, Inc.) was prepared in a total volume of 25. mu.l of reaction buffer. This reaction buffer contained 40mM HEPES-KOH (pH 7.0), 75mM KCl, and 4.5mM Mg (CH)₃COO)₂. After incubation at 37 ℃ for 1h, 80. mu.l of malachite green was addedTest solution (malachite green (0.081% [ w/v%)]): polyethylene ethanol (2.3% [ w/v ]]): ammonium paramolybdate tetrahydrate (5.7% [ w/v ]]Using 6M HCl): water 2:1:1:2) to the reaction system. The non-enzymatic hydrolysis was then stopped by the addition of 10. mu.l of 34% sodium citrate. All reaction systems were mixed and incubated at 37 ℃ for 15min before absorbance measurements were performed, with a wavelength of 620nm being chosen. The assay results are shown in fig. 1, where PpHsp70m activity was increased by 20% compared to the original protein.

Example 4

And (4) constructing an expression vector.

(1) Cloning a nucleotide sequence fragment encoding the gene PpHsp 70:

physcomitrella patens vector construction primers: PpHsp70-PpF: gcggccgc ATGGCATCCGCGGTGGGATCTGTGG, PpHsp70-PpR: gtcgac TCACGTTGAATCAGTGAAGTCTGCA.

The rice vector construction primer: PpHsp70-F ggtaccatggCATCCGCGGTGGGGATCPpHsp 70-R tctaga CGTTGAATCAGTGAAGTCTG.

Template: extracting the physcomitrella patens genome DNA by adopting a CTAB method.

Amplification system and procedure: high fidelity polymerase from Nanjing Novozam was used: phata Master (p505), system (50. mu.l): f (10. mu.M) 1. mu.l, R (10. mu.M) 1. mu.l, Phata Master 1. mu.l, 2. mu.buffer 25. mu.l, dNTP 1. mu.l, H2O 21. mu.l. Using Eppendorf Master PCR instrument, program: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 20s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2.5min (amplification efficiency of 1kb/min), 35 cycles, extension at 72 ℃ for 5min after the cycles, and heat preservation at 4 ℃. After the amplification is finished, the target fragment is recovered by electrophoresis.

(2) The cloned DNA fragment of PpHsp70 gene was ligated to the pCAMBIA2300 and pPOG1 vectors obtained by double digestion with 37 ℃ KpnI and XbaI and NotI and SalI endonucleases by digestion ligation, using T4 ligase from Thermo, ligation was performed overnight at 4 ℃, and the post-transformation of e.coli and screening of positive clones were performed using a general method.

Example 5

Physcomitrella patens was stably transformed.

The Physcomitrella patens is transformed by a PEG-mediated protoplast transformation method, a Physcomitrella patens protonema material growing for about 5 days is cracked into protoplasts by 2 percent of collapse enzyme, then heat shock is carried out at 45 ℃ under the PEG-mediated condition, and the obtained transformed cells are screened by two resistance screens of alternate one-time recovery culture to obtain a transformant material to be selected. The whole process of the transgene generally requires 2-4 months from transformation to the obtainment of transformant material.

Example 5

And (5) stably transforming the rice.

The method for infecting the rice callus by agrobacterium tumefaciens mediation is adopted for transformation, the research adopts an agrobacterium tumefaciens EHA mediation high-efficiency transformation system, and mature seeds are subjected to shelling and disinfection and then are subjected to dark culture for 30-40 days at 26 ℃ on an induction culture medium; the induced callus is enlarged and cultured for 3 times on a subculture medium, and each subculture is about 15 days; selecting fresh yellow and hard callus, pre-culturing at 26 ℃ for 3-5 days, soaking the callus in agrobacterium EHA105 bacterial liquid for 30 minutes for dip dyeing, co-culturing at 19 ℃ for 2 days, washing the callus with sterile water for several times, and transferring the callus to a screening culture medium added with screening marker antibiotics, wherein the resistance of a carrier used in the method is neomycin (NptII), an MS culture medium with the resistance concentration of 20mg/L is used, and the callus is screened for 2-3 times, and each time lasts for about 15 days to obtain resistant callus; transferring the resistant callus to a pre-differentiation culture medium for culturing for 7 days, and differentiating a regeneration plant on a differentiation culture medium under the illumination condition; the regenerated plant is cultured on a rooting culture medium for 7 days by illumination to induce rooting; and finally, hardening off the seedlings for 3 days and transplanting. The whole transgenic process from seeds to transgenic seedlings is generally carried out for 4-5 months. The transgenic method is a published mature method (Hiei et al, Plant J,1994,6: 271-282). The results are shown in fig. 4, and the expression level of the gene in the positive plants is significantly higher than that of the wild type control.

Example 6

DNA and RNA level screening method.

Extracting total DNA of the obtained regeneration plant by adopting a CTAB method, and identifying a primer at the DNA level

PpHsp70-DF:ATGGCATCCGCGGTGGGATC,

PpHsp70-DR:ACATCAAAGGTGCCCCCGCC。

Using TrThe obtained regenerated plant is extracted by the izol method, and a reverse transcription kit of Beijing Quanji bioengineering GmbH is used

One-Step gDNA Removal and cDNA Synthesis SuperMix for cDNA Synthesis followed by semi-quantitative PCR assay. The RNA level identification primer is PpHsp70-RF: GTTGTTGCGTACACGAAGAA, PpHsp70-RR: AGAAACTTGCTTGGACTCAT.

PCR amplification system and procedure: amplification was performed using TransStart Tip Green qPCR SuperMix from Transgen, preferably in the system (50. mu.l) cDNA template 1. mu.l, F (10. mu.M) 0.4. mu.l, R (10. mu.M) 0.4. mu.l, 2 XStart Tip Green qPCR SuperMix 10. mu.l, H₂O was added to 20. mu.l. Using Eppendorf Master PCR instrument, program: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, 40 cycles, extension at 72 ℃ for 5min after cycles, and heat preservation at 4 ℃. The results are shown in fig. 2 and 4, and the expression level of the gene in the positive plant is significantly higher than that of the wild-type control.

Example 7

And (3) the positive plants show various adversity stresses.

After a physcomitrella patens positive plant is obtained, culturing the obtained positive material until the positive material grows to a gametophyte stage of 40 days, and performing resistance test, wherein the high-temperature stress treatment comprises the steps of putting a culture dish of the growing material into a 45 ℃ incubator, observing the growth state of the plant when the plant recovers to grow for 2 days after treatment for 6 hours, and testing chlorophyll fluorescence Fv/Fm parameters; the drought treatment is to directly pick up the gametophyte material growing to 40 days and expose the gametophyte material to the air for air drying, recover the growth for 2 days after 1 hour of treatment, observe the growth state of the plant, and test the chlorophyll fluorescence Fv/Fm parameter; salt stress is to transfer the gametophyte material growing for 40 days into a hydroponic liquid containing 0.5mM NaCl, recover the growth for 2 days after 5 hours of treatment, observe the growth state of the plant, and test the chlorophyll fluorescence Fv/Fm parameter. Chlorophyll fluorescence parameters of plants were measured using IMAGING-PAM FluorImager and IMAGING Win software. Plants should dark adapt for a minimum of 30min before Fv/Fm is measured.

The results are shown in FIG. 3, where the recovery capacity of the over-expressed plants after different stress treatments is improved compared to the wild type control.

The method for testing the resistance capability after obtaining the positive plants of the rice comprises the following specific steps: harvesting the regenerated plants after obtaining their T₀Carrying out seed generation, after accelerating germination of seeds, carrying out various adversity treatments when the seeds grow to a four-leaf stage under normal conditions, carrying out high-temperature stress, namely putting a seedling growth pot at 42 ℃, recovering and culturing for 7 days after 1 day of treatment, observing the growth state of the plants and detecting the survival rate; the drought treatment is to carry out the drought treatment on a seedling growth pot for 7 days, carry out rehydration for 7 days, observe the growth state of the plants and detect the survival rate; the salt stress is to add 0.2mM NaCl solution to the seedling growth pot, observe the growth state of the plant after 7 days and detect the plant height. The results are shown in FIG. 5, where only about 21% of the control plants were recovered, while about 42% of the over-expressed plants were recovered, significantly higher than the control (t-test, P) under high temperature and drought treatment<0.05). Under high-salt treatment, the growth vigor of the over-expressed plants is obviously stronger than that of the control plants, and the plant height is obviously higher than 45 percent of that of the control plants (t test, P)<0.05)。

Therefore, the method for improving the stress resistance of the plant provided by the invention is to obtain a plant which stably expresses the PpHsp70 gene and codes the PpHsp70 protein, and the stress resistance of the plant is improved through the action of the PpHsp 70.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Kunming plant institute of Chinese academy of sciences

<120> application of chloroplast protein and ATPase enzymatic activity mutant in improving stress resistance of plants

<170> China State intellectual Property office

<160> 2

<210> 1

<211> 2124

<212> DNA

<213> Physcomitrella patens (Physcomitrella patents)

<400> 1

atggcatccg cggtgggatc tgtggcattc ttgccctgtt cagttgcagg acaggggagt 60

gtcgtctaca aagttcgctt ttcaaagcat cggaaatgca cattgcgtgg tcagaagcct 120

tcggatagag ccttcttcgg aggggatttt tctatttcaa gaagtactca ggaatgcaat 180

tcaaagcatg aaaggagctc aaggcctctt cgtgtaactg ccgaaaaagt tgtcggcatt 240

gatcttggaa caacaaactc tgcaatggca gctatggaag gtggacagcc tacaataatt 300

actaattctg agggccagag gacaacccct tcggttgttg cgtacacgaa gaaaggtgat 360

cgattagtgg ggcagattgc taagcgccaa gctgtagtga accctgcgaa cacattttac 420

tcagtcaagc gattcattgg acggaaaatg aacgaagtgg aagatgagtc caagcaagtt 480

tcttaccaag tcattcgaga ctccaatggt aatgtgaaac tcgattgtcc agcaatcaac 540

aagcagtttg ctgctgaaga aatatccgcg caggttctaa gaaaattggt agacgatgcc 600

agcaagtttc taagcgacaa agttgacaag gctgttataa cagtgcctgc ttacttcaac 660

gacagtcaac gccaggctac taaagatgct ggtcgaattg ctggaattga tgtactgaga 720

atcatcaacg aacccactgc ggcatcgttg gcatatggtt tcgacaagaa gaaaaacgaa 780

actatcttgg tctttgacct tggcgggggc acctttgatg tttcagtctt ggaagttgga 840

gatggggttt ttgaagtact ttccacagcg ggagacaccc atctcggtgg tgacgacttt 900

gacaagagaa tagtggattg gctggcgaaa gaattcaaag ccgctgaagg cattgacctc 960

ttaaaggatg ctcaagcact tcagaggctg actgaaagtg ctgaaaaagc taagattgaa 1020

ttatcctccc tcactcagac aactatcagt cttcctttta ttacagcgac tgcggaggga 1080

cctaagcaca ttgatacaac acttacacgt gccaagtttg aggagttgtg ttcggatctc 1140

ttagacagat gtcgtgagcc agtaaagaga gctttagacg atgccaagtt gagtctcaag 1200

gatttgcagg aagttgtctt ggtgggaggg tcgactcgaa ttcctagtgt gcagcaattg 1260

gtcaagcaga tgacaggaaa agatccaaat gttactgtta atcctgatga agttgttgct 1320

cttggtgcag cagttcaggc tggagttcta tctggtgagg ttggtaatat tgtgcttctg 1380

gatgtttcgc ctctatcgct aggactggaa actttggggg gtgtcatgac aaagatcatt 1440

cctcgaaata cgacactgcc gacttccaag aaagaggtct tctctactgc ggctgatggt 1500

caaacaagcg tcgagattaa tgtgctccag ggagaacgtg agtttgtaag ggataataaa 1560

tcgctcggaa gcttcaggtt ggatgggatt gtacctgcac cacgtggagt tccacaaatc 1620

gaggtgacct ttgatattga tgccaatggc attttatcgg tcacagctat ggacaaagga 1680

tcaggaaaga agcaggacat ccagataact ggtgcctcca ccctcaacaa agatgatgtg 1740

gagagaatgg tccaagaagc agaaagaaat gcagaagaag ataagaaacg cagggaggtt 1800

attgatttaa aaaatcagag tgatagtatg atttatcagg cagagaagca gttgaaggaa 1860

ctgagtgaca aagttccagc agacctgaag agtcgtgtgg aaacgaaggt ggtcgatctc 1920

aaggaagccg cgaagacaga ggatgtggaa aaaatgaaaa gagctcaaga agcgttacaa 1980

caagaagtaa tgcaaattgg acaagcaata tatggaagcg gcgctgcaca cgcaggccct 2040

gcacaacctg gttccggagc tgcttcatca cctcctggag atgatgctga ggtgattgat 2100

gcagacttca ctgattcaac gtga 2124

<210> 2

<211> 707

<212> PRT

<213> Physcomitrella patens (Physcomitrella patents)

<400> 2

Met Ala Ser Ala Val Gly Ser Val Ala Phe Leu Pro Cys Ser Val

1 5 10 15

Ala Gly Gln Gly Ser Val Val Tyr Lys Val Arg Phe Ser Lys His

20 25 30

Arg Lys Cys Thr Leu Arg Gly Gln Lys Pro Ser Asp Arg Ala Phe

35 40 45

Phe Gly Gly Asp Phe Ser Ile Ser Arg Ser Thr Gln Glu Cys Asn

50 55 60

Ser Lys His Glu Arg Ser Ser Arg Pro Leu Arg Val Thr Ala Glu

65 70 75

Lys Val Val Gly Ile Asp Leu Gly Thr Thr Asn Ser Ala Met Ala

80 85 90

Ala Met Glu Gly Gly Gln Pro Thr Ile Ile Thr Asn Ser Glu Gly

95 100 105

Gln Arg Thr Thr Pro Ser Val Val Ala Tyr Thr Lys Lys Gly Asp

110 115 120

Arg Leu Val Gly Gln Ile Ala Lys Arg Gln Ala Val Val Asn Pro

125 130 135

Ala Asn Thr Phe Tyr Ser Val Lys Arg Phe Ile Gly Arg Lys Met

140 145 150

Asn Glu Val Glu Asp Glu Ser Lys Gln Val Ser Tyr Gln Val Ile

155 160 165

Arg Asp Ser Asn Gly Asn Val Lys Leu Asp Cys Pro Ala Ile Asn

170 175 180

Lys Gln Phe Ala Ala Glu Glu Ile Ser Ala Gln Val Leu Arg Lys

185 190 195

Leu Val Asp Asp Ala Ser Lys Phe Leu Ser Asp Lys Val Asp Lys

200 205 210

Ala Val Ile Thr Val Pro Ala Tyr Phe Asn Asp Ser Gln Arg Gln

215 220 225

Ala Thr Lys Asp Ala Gly Arg Ile Ala Gly Ile Asp Val Leu Arg

230 235 240

Ile Ile Asn Glu Pro Thr Ala Ala Ser Leu Ala Tyr Gly Phe Asp

245 250 255

Lys Lys Lys Asn Glu Thr Ile Leu Val Phe Asp Leu Gly Gly Gly

260 265 270

Thr Phe Asp Val Ser Val Leu Glu Val Gly Asp Gly Val Phe Glu

275 280 285

Val Leu Ser Thr Ala Gly Asp Thr His Leu Gly Gly Asp Asp Phe

290 295 300

Asp Lys Arg Ile Val Asp Trp Leu Ala Lys Glu Phe Lys Ala Ala

305 310 315

Glu Gly Ile Asp Leu Leu Lys Asp Ala Gln Ala Leu Gln Arg Leu

320 325 330

Thr Glu Ser Ala Glu Lys Ala Lys Ile Glu Leu Ser Ser Leu Thr

335 340 345

Gln Thr Thr Ile Ser Leu Pro Phe Ile Thr Ala Thr Ala Glu Gly

350 355 360

Pro Lys His Ile Asp Thr Thr Leu Thr Arg Ala Lys Phe Glu Glu

365 370 375

Leu Cys Ser Asp Leu Leu Asp Arg Cys Arg Glu Pro Val Lys Arg

380 385 390

Ala Leu Asp Asp Ala Lys Leu Ser Leu Lys Asp Leu Gln Glu Val

395 400 405

Val Leu Val Gly Gly Ser Thr Arg Ile Pro Ser Val Gln Gln Leu

410 415 420

Val Lys Gln Met Thr Gly Lys Asp Pro Asn Val Thr Val Asn Pro

425 430 435

Asp Glu Val Val Ala Leu Gly Ala Ala Val Gln Ala Gly Val Leu

440 445 450

Ser Gly Glu Val Gly Asn Ile Val Leu Leu Asp Val Ser Pro Leu

455 460 465

Ser Leu Gly Leu Glu Thr Leu Gly Gly Val Met Thr Lys Ile Ile

470 475 480

Pro Arg Asn Thr Thr Leu Pro Thr Ser Lys Lys Glu Val Phe Ser

485 490 495

Thr Ala Ala Asp Gly Gln Thr Ser Val Glu Ile Asn Val Leu Gln

500 505 510

Gly Glu Arg Glu Phe Val Arg Asp Asn Lys Ser Leu Gly Ser Phe

515 520 525

Arg Leu Asp Gly Ile Val Pro Ala Pro Arg Gly Val Pro Gln Ile

530 535 540

Glu Val Thr Phe Asp Ile Asp Ala Asn Gly Ile Leu Ser Val Thr

545 550 555

Ala Met Asp Lys Gly Ser Gly Lys Lys Gln Asp Ile Gln Ile Thr

560 565 570

Gly Ala Ser Thr Leu Asn Lys Asp Asp Val Glu Arg Met Val Gln

575 580 585

Glu Ala Glu Arg Asn Ala Glu Glu Asp Lys Lys Arg Arg Glu Val

590 595 600

Ile Asp Leu Lys Asn Gln Ser Asp Ser Met Ile Tyr Gln Ala Glu

605 610 615

Lys Gln Leu Lys Glu Leu Ser Asp Lys Val Pro Ala Asp Leu Lys

620 625 630

Ser Arg Val Glu Thr Lys Val Val Asp Leu Lys Glu Ala Ala Lys

635 640 645

Thr Glu Asp Val Glu Lys Met Lys Arg Ala Gln Glu Ala Leu Gln

650 655 660

Gln Glu Val Met Gln Ile Gly Gln Ala Ile Tyr Gly Ser Gly Ala

665 670 675

Ala His Ala Gly Pro Ala Gln Pro Gly Ser Gly Ala Ala Ser Ser

680 685 690

Pro Pro Gly Asp Asp Ala Glu Val Ile Asp Ala Asp Phe Thr Asp

695 700 705

Ser Thr

707

Claims

The application of the ATPase enzymatic activity mutant of the PpHsp70 gene in improving the stress resistance of plants is characterized in that the application in the stress resistance of the plants refers to the application in high temperature resistance, drought resistance and salt stress resistance;

characterized in that the nucleotide sequence of the PpHsp70 gene is shown in SEQ ID No. 1;

the amino acid sequence of the protein coded by the PpHsp70 gene is shown as SEQ ID No. 2;

the sequence of the ATPase enzyme activity mutant of the PpHsp70 gene is that the 271 st amino acid site of the amino acid sequence of the protein coded by the PpHsp70 gene is mutated from threonine to alanine T271A;

the plants are Physcomitrella patens and rice.
2. The use of claim 1, wherein the improvement of the high temperature, drought and salt stress tolerance of the plant is achieved by the following method steps:

(1) linking the coding sequence of claim 1 to a plant expression control sequence to form a plant expression vector;

(2) introducing the plant expression vector into physcomitrella patens by a PEG-mediated protoplast method, transferring the physcomitrella patens into rice plant cells by an agrobacterium infection method, and screening to obtain transformed cells;

(3) carrying out plant regeneration on the transformed cell, and identifying to obtain a transgenic positive plant;

(4) and (3) screening and evaluating the stress resistance of the transgenic positive plant.
3. Use according to claim 2, wherein the stress resistance is high temperature resistance, drought resistance and high salt resistance.
4. A method for improving the stress resistance of plants is characterized by comprising the following steps:

(1) carrying out threonine-to-alanine T271A mutation on the 271 th amino acid site of the amino acid sequence of the protein encoded by the PpHsp70 gene disclosed in claim 1 to obtain PpHsp70m gene, and testing the ATPase enzyme activity;

(2) connecting PpHsp70m to a plant expression regulatory sequence to form a plant recombinant expression vector which is a physcomitrella patens expression vector and a rice expression vector respectively;

(3) introducing the plant recombinant expression vector into physcomitrella patens cells by a PEG-mediated protoplast transformation method, and screening to obtain transformed plants;

(4) transferring the plant recombinant expression vector into rice plant callus by an agrobacterium-mediated method, and screening to obtain a transformed plant;

(5) carrying out stress resistance screening on the physcomitrella patens with the obtained PpHsp70m gene overexpression to obtain a resistance index;

(6) rice plant T with the obtained PpHsp70m gene over-expressed₀After the seeds obtained by harvest germinate, stress resistance screening is carried out in the seedling stage to obtain resistance indexes;

the stress resistance refers to high temperature resistance, drought resistance and salt stress resistance.