CN102952816A - Application of ATPase proteins in stress tolerance of plants - Google Patents
Application of ATPase proteins in stress tolerance of plants Download PDFInfo
- Publication number
- CN102952816A CN102952816A CN2011102429179A CN201110242917A CN102952816A CN 102952816 A CN102952816 A CN 102952816A CN 2011102429179 A CN2011102429179 A CN 2011102429179A CN 201110242917 A CN201110242917 A CN 201110242917A CN 102952816 A CN102952816 A CN 102952816A
- Authority
- CN
- China
- Prior art keywords
- atpase
- recombinant vectors
- encoding gene
- albumen
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an application of ATPase proteins in the stress tolerance of plants. A transgenic plant cultivation method is characterized in that transgenic plants having a higher stress tolerance than target plants is obtained through introducing ATPase protein coding genes into the target plants, and the amino acid sequence of the ATPase proteins is represented by sequence 2 in a sequence table. Experiments in the invention prove that Dissostichus mawsoni which is a special species is treated as a research material and a cDNA library constructing and sequencing technology is utilized to find that the ATPase gene possibly has a cod resistance function, the ATPase gene is transferred to tobacco and Arabidopis thaliana to obtain transgenic plants, and the transgenic plants have the cold resistance function at a low temperature and have a higher cold resistance than wild plants, so a case than the ATPase gene is a cold resistance related gene is confirmed.
Description
Technical field
The present invention relates to biological technical field, relate in particular to the application of a kind of ATPase albumen in plant stress tolerance.
Background technology
Antarctic Fish is the most cold-resistant known fish, its cell can be at-1 ℃--finish all vital movements that comprise ontogeny in 2 ℃ the low temperature, the genome encoding that evolve to form under the cold environment the required all functions molecule of existence under the low temperature, be important genetic resources.The fish that live in the South Pole have shown a series of and cold-resistant relevant physiology and chemistry proterties, evolution, Heat shock response (the heat-shock response such as antifreeze protein, HSR) disappearance, red blood corpuscle is a large amount of in the blood reduces even disappearance, myofibrillar reduced number, diameter but increases etc.Therefore, to living in the comparative analysis of the Antarctic Fish genoid group under the differing temps environment, and the clone identification of genes involved, functional analysis and study on mechanism thereof, help to understand the mechanism that South Pole fish survive under low temperature environment extreme like this below 0 ℃.
The activity of cold and heat air is one of fundamental cause of Changes in weather.Under specific synoptic situation, the strong cold air that accumulates in high latitude area is gone down south rapidly, invasion China, cause on a large scale violent cooling, and with phenomenons such as strong wind, sleet, freeze injuries, this class synoptic process is called cold wave or strong cold air, and the loss that causes thus is called cold wave and freezing disaster.Cold weather can cause a large amount of underproduction of farm crop, in the U.S., cause rural economy loss to reach tens hundred million dollar owing to cold every year, for example in December, 1998, the California is because freezing disaster and oranges and tangerines Large Scale Death, and direct economic loss reaches 500,000,000 9 thousand ten thousand dollars.There are hundred million mu of farmlands of 6-7 to suffer the harm of cold weather, 20,000,000,000 kilograms of the grain reduction of income (sustainable development of China Information Network 2003.10.13) in the every annual of China.
Therefore, how to make farm crop avoid the focus that cold disaster becomes research.
Summary of the invention
An object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention is in the encoding gene importing purpose plant with ATPase albumen, obtains the transgenic plant that resistance of reverse is higher than described purpose plant;
The aminoacid sequence of described ATPase albumen is the sequence 2 in the sequence table.
The nucleotides sequence of the encoding gene of described ATPase albumen is classified the sequence 1 in the sequence table as.
The encoding gene of described ATPase albumen imports in the described purpose plant by following recombinant vectors;
Described recombinant vectors is following A or B:
Recombinant vectors shown in the A is that the encoding gene of described ATPase albumen is inserted in the pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in the B is that the encoding gene of described ATPase albumen is inserted in the pHQSN carrier, expresses the recombinant vectors of described encoding gene.
Described resistance of reverse is winter hardiness.
The described ATPase of turning gene plant winter hardiness embodies by the relatively saturating property of increase plant height, raising survival rate and/or reduction cytoplasmic membrane, mainly embodies by reducing the relatively saturating property of cytoplasmic membrane.
Described purpose plant is dicotyledons or monocotyledons, and described dicotyledons is specially tobacco or Arabidopis thaliana.
Another object of the present invention provides a kind of recombinant vectors.
Recombinant vectors provided by the invention is following A or B:
Recombinant vectors shown in the A is that the encoding gene of described ATPase albumen is inserted in the pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in the B is that the encoding gene of described ATPase albumen is inserted in the pHQSN carrier, expresses the recombinant vectors of described encoding gene.
Recombinant vectors shown in the described A is described gene to be inserted between pCPAE2 carrier MluI and EcoRI restriction enzyme site the recombinant vectors of expressing said gene;
Recombinant vectors shown in the described B is described gene to be inserted in the pHQSN carrier between MluI and EcoRI restriction enzyme site the recombinant vectors of expressing said gene.
The application in cultivating the resistance of reverse transgenic plant of the encoding gene of described ATPase albumen, described ATPase albumen and/or described recombinant vectors also is the scope of protection of the invention.
Described resistance of reverse is winter hardiness; Described purpose plant is dicotyledons or monocotyledons, and described dicotyledons is specially tobacco or Arabidopis thaliana.
Of the present invention experimental results show that, the present invention is take these special species of Antarctic Fish Dissostichus mawsoni as research material, utilize the structure of cDNA library and the technology of order-checking, found to have the ATPase gene of cold-resistant function, and it is changed in tobacco and the Arabidopis thaliana, obtain transgenic plant and really have at low temperatures cold-resistant function, higher than wild-type plant winter hardiness, confirm that this gene is and cold-resistant relevant gene.
Description of drawings
Fig. 1 is the tobacco expressed carrier of improved pCAPE2
Fig. 2 is Arabidopis thaliana expression vector carrier pHQSN
Fig. 3 is the RT-PCR of transgene tobacco
Fig. 4 is the phenotype of transgene tobacco
Fig. 5 is the transgene tobacco membrane permeability
Fig. 6 is the resistance screening of transgenic arabidopsis
Fig. 7 is the RT-PCR of transgenic arabidopsis
Fig. 8 is the phenotype of transgenic arabidopsis
Fig. 9 is the transgenic arabidopsis membrane permeability
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Laboratory apparatus, all ingredients and test kit:
Laboratory apparatus :-20 ℃, 4 ℃ of refrigerators (Haier, AUCMA);-80 ℃ of ULT Freezer (Thermo Forma); PTC-200 PCR instrument (MJ Reaserch); TP-600 PCR instrument (TakaRa); 5417R, 5810R and the freezing desk centrifuge of 5417D high speed (Eppendorf); Sub-Cell GT Agarose Gel Electrophoresis Systems (Bio-Rad); YLN-2000 gel imaging system (Beijing Ya Lien mechanical ﹠ electrical technology institute); DH4000A type electro-heating standing-temperature cultivator (Tianjin Tai Site Instr Ltd.); GXZ intelligent illumination incubator (south of the River instrument); BIO-RAD electrophoresis apparatus (Beijing Bole); Ultra-clean aseptic operating platform; The PB-21PH meter; Homogenizer; Ice-making machine; High-pressure sterilizing pot; Water-bath; Baking box; Microwave oven; Adjustable micropipette rifle (Eppendorf); 25 ℃ of normal temperature culturing room; 4 ℃ of low temperature culturing room; Mortar; Mill; Shaking table; Centrifuge tube.
Reagent: restriction enzyme, RNase A etc. are available from Dalian Bao Bio-Engineering Company; T4 dna ligase, TaqDNA polysaccharase be available from NEB company,
Reagent is available from Invitrogen biotech firm; Tryptones, yeast extract, agar powder, microbiotic is available from ancient cooking vessel state company and Takara company;
Test kit: QIAquick Gel Extraction Kit (QIAGEN, Cat.No.28704); Plasmid mini kit (OMEGA, Cat.D6944-01); RNA Isolation Kit (TIANZE)
Sample: Antarctic Fish (Dissostichus mawsoni; Aspects of body size and gonadal histology in the Antarctic toothfish, Dissostichus mawsoni, from McMurdo Sound, Antarctica.Eastman JT, DeVries AL.Polar Biol. (2000) 23:189-195., the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.)
Bacterial strain: intestinal bacteria XL10-Gold is (available from Stratagene company, Cat.NO.200315); Agrobacterium GV3103 (Chinese plasmid vector strain cell pnca gene preservation center, Biovector Science Lab.Inc, BV93526); Agrobacterium EHA105 (Chinese plasmid vector strain cell pnca gene preservation center, Biovector Science Lab.Inc, BV93526).
Plasmid:
Tobacco expressed carrier: the PEBV-VIGS carrier system is comprised of two T-DNA plasmids (pCAPE1, pCAPE2 (the pCAPE2 structural representation as shown in Figure 1));
PCAPE1, pCAPE2 all is documented in Constantin, G.D., B.N.Krath, S.A.MacFarlane, M.Nicolaisen, I.E.Johansen, and O.S.Lund.2004.Virus-induced gene silencing as a tool for functional genomics in a legume species.Plant J 40:622-631, the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.)。
The Arabidopis thaliana expression vector: (carrier pHQSN is transformed by expression vector pCAMBIA1390 carrier pHQSN, this carrier is awarded transformation by South China Normal University's Li Hong Puritanism, the detailed source of the article of carrier pHQSN: Improvement of Torenia fournieri salinity tolerance by expression of Arabidopsis AtNHX5.Le-Yi Shi, Hong-Qing Li, Xiao-Ping Pan, Guo-Jiang Wu and Mei-Ru Li.Functional Plant Biology, 2008-CSIRO. the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.The detailed source of former expression vector pCAMBIA1390 is: The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation.Hajdukiewicz, P., Svab, Z.and Maliga, P.Plant Mol.Biol.25 (6), 989-994 (1994). have 35S promoter and NOS terminator, as shown in Figure 2.
Tobacco (Ben Saimushi tobacco, Nicotiana Benthamiana) is available from Tobacco Institute, Chinese Academy of Agricultural Science.
Hereinafter to be referred as wild-type tobacco;
Arabidopis thaliana (Arabidopsis thaliana (L.) Heynh, Columbia (Col)) is hereinafter to be referred as the wild-type Arabidopis thaliana.
The acquisition of embodiment 1, ATPase gene
1, ATPase full length gene sequence obtains
Consequence devised PCR primer according to library EST order-checking:
Gene_ATPase:MluI/EcoRI (for tobacco expressed carrier pCAPE2)
ATPase1_F:5-AT ACGCGT ATGTCGGCCGAAAGTC-3 (sequence 3)
ATPase1_R:5-CGG GAATTC TTATTTCGTGGAGAGGA-3 (sequence 4)
Gene_ATPase:XbaI/BamHI (for Arabidopis thaliana expression vector pHQSN)
ATPase2_F:5-AT TCTAGA ATGTCGGCCGAAAGTCCCGA-3 (sequence 5)
ATPase2_R:5-AT GGATCC TTATTTCGTGGAGAGGATCAG-3 (sequence 6)
Extract the RNA of the liver of Antarctic Fish Dissostichus mawsoni, reverse transcription obtains cDNA as template, increase with primer pair ATPase 1_F, ATPase 1_R and primer pair ATPase 2_F, ATPase 2_R respectively, obtain PCR product 1 and PCR product 2.
Also but artificial synthesized sequence 1, increases with primer pair ATPase 1_F, ATPase 1_R and primer pair ATPase 2_F, ATPase 2_R respectively, obtains PCR product 1 and PCR product 2.
2, the acquisition of recombinant vectors
Cut PCR product 1 with MluI and EcoRI enzyme, the purpose fragment that obtains is connected with the carrier pCPAE2 that cuts through same enzyme, obtaining connecting product changes in the intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, the result is for the carrier of this plasmid for obtaining between the MluI that the sequence 1 in the sequence table inserted pCPAE2 and EcoRI restriction enzyme site, with this plasmid called after pCPAE2-ATPase.
Cut PCR product 2 with XbaI and BamHI enzyme, the purpose fragment that obtains is connected with the carrier pHQSN that cuts through same enzyme, obtaining connecting product changes in the intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, the result is for the carrier of this plasmid for obtaining between the XbaI that the sequence 1 in the sequence table inserted pHQSN and BamHI restriction enzyme site, with this plasmid called after pHQSN-ATPase.
One, turns acquisition and the functional study of ATPase tobacco
1, turns acquisition and the evaluation of ATPase tobacco
1) preparation of tobacco material:
In between 25 ℃ of cultivations, illumination in 16 hours, 8 hours dark, the wild-type tobacco seedling of growing in the vermiculite, length is launched leaf to the 5-6 sheet and is the acceptor tobacco.
2) preparation of restructuring Agrobacterium
To be changed over to by the recombinant vectors pCPAE2-ATPase that embodiment 1 obtains among the Agrobacterium GV3103, obtain recombinant bacterium, extract the plasmid of recombinant bacterium, send to order-checking, the result contains the recombinant bacterium called after GV3103/pCPAE2-ATPase of this plasmid for this plasmid is pCPAE2-ATPase.
3) turn the acquisition of ATPase tobacco
(1) 28 ℃ of overnight incubation of picking GV3103/pCPAE2-ATPase line;
(2) the above-mentioned bacterium that spends the night of picking is inoculated into 5ml LB (Rif final concentration 50mg/l, Kana final concentration 50mg/l)) 28 ℃ of overnight incubation among the Rif;
(3) the above-mentioned bacterium liquid that spends the night is transferred among the 50ml LB (10mM MES+20 μ M Acetosyringone+Kana) 28 ℃ of overnight incubation;
(4) then the above-mentioned bacterium liquid of centrifugal collection be resuspended in LB (10mM MgCl
2+ 10mM MES+200 μ M Acetosyringone) in, transfers OD
600=2.0, under room temperature (25 ℃), left standstill 3 hours;
(5) change over to respectively pCAPE1 and two carriers of pCAPE2 in the Agrobacterium, the picking positive colony shakes bacterium, the bacterium liquid that contains pCAPE1 and pCAPE2 expression vector that the shakes ratio hybrid injection acceptor tobacco with 1: 1 will be got, to inject the tender leaf of proximal ends during injection, obtain 8 strain T0 for turning the ATPase tobacco.
4), turning ATPase tobacco RT-PCR identifies
Extract T0 for the RNA that turns the ATPase tobacco leaf, reverse transcription obtains cDNA as template, take ATPase 1_F, ATPase 1_R as primer, carry out RT-PCR, with wild-type tobacco as negative control, the result as shown in Figure 3, wherein, 1 is DL2000Marker, 2 positive contrast pCPAE2-ATPase, 3 is that T0 is for turning the ATPase tobacco, 4 negative contrasts (wild-type tobacco), 5 for being the PCR product of template for tobacco RNA without the T0 of reverse transcription, 6 for water be the PCR product of template, can find out, obtain the positive T0 of 462bp for turning the ATPase tobacco.
Adopt and use the same method, empty carrier pCPAE2 is changed in the wild-type tobacco, obtain T0 for turning the empty carrier tobacco, extract T0 for the RNA that turns the empty carrier tobacco leaf, reverse transcription obtains cDNA as template, take ATPase 1_F, ATPase1_R as primer, do not obtain the purpose fragment, illustrate to obtain T0 for turning the empty carrier tobacco.
2, turn the functional study of ATPase tobacco
1) phenotype analytical
In positive T0 generation of 3 all seedling ages, turned lower 23 ℃ of ATPase tobacco normal condition, 16h illumination/8h is dark, grow after 14 days, place 4 ℃, 16h illumination/8h is dark, grows after 20 days, place again 23 ℃, 16h illumination/8h is dark, recovers growth 15 days, turns empty carrier tobacco and wild-type tobacco as contrast take T0 generation.
Observe phenotype, the result as shown in Figure 4, wherein, the positive T0 of A is for turning 23 ℃ under normal operation of ATPase tobacco (ATPase) and wild-type tobaccos (GFP), 16h illumination/8h is dark, the result who grew 14 days, the positive T0 of B is for turning ATPase tobacco (ATPase) and wild-type tobacco (GFP) at 4 ℃, 16h illumination/8h is dark, the result who grow 20 days, and the positive T0 of C is for turning ATPase tobacco (ATPase) and wild-type tobacco (GFP) places 23 ℃ again, 16h illumination/8h is dark, recover 15 days result of growth, can find out, among the A, under normal operation, positive T0 is for turning the growth of ATPase tobacco (ATPase) and wild-type tobacco (GFP) without significant difference, and among the B, wild-type tobacco (GFP) has the phenotype of obvious cold damage, the plant stem is crooked, plant is short and small, and positive T0 then grows after 4 ℃ of subzero treatment still well for turning ATPase tobacco (ATPase), and subzero treatment does not cause it that untoward reaction is arranged.Among the C, behind the renewal cultivation, wild-type tobacco (GFP) places under the normal temps after deepfreeze is subject to injury from low temperature again and cultivates, still can not return to normal growth conditions, illustrate that 4 ℃ subzero treatment is visible to the injury of tobacco, and in positive T0 generation, turn ATPase tobacco (ATPase), 4 ℃ of deepfreezes are after 20 days, place 23 ℃ to recover growth after 15 days, plant can continue normal growth and grow, and does not show the injury proterties that any low temperature causes.
4 ℃ process 20 days after, each strain is got 3 strains and is surveyed its plant height, experiment triplicate results averaged, SPSS-Oneway (Duncan) method is used in statistical study, T0 is 36cm for turning ATPase tobacco plant height mean value, standard is mistaken for 36 ± 0.30551, and wild-type tobacco (GFP) plant height mean value is 28cm, and standard is mistaken for 28 ± 0.34641.
T0 is for turning empty carrier tobacco and wild-type tobacco result without significant difference.
2) mensuration of tobacco physiological indexes
In order further to confirm the cold tolerance of transfer-gen plant, measured relatively thoroughly property (membrane permeability) physical signs of transfer-gen plant cytoplasmic membrane.
When plant tissue is subject to the adverse circumstance injury, because the function of film is impaired or structure deteriorate, and make its saturating property increase, various water-soluble substanceses comprise that ionogen will have exosmosing in various degree in the cell, plant tissue is immersed in the deionized water, and the electricity of water is led and will be strengthened because of electrolytical exosmosing, and injury is heavier, exosmose the more, the increase of conductivity is also larger.Membrane permeability is higher thus, illustrates that plant is hurt heavier, otherwise, be hurt lighter.
The mensuration of the relatively saturating property of cytoplasmic membrane is with reference to the method (Li Jinshu of Li Jinshu; Wang Hongchun; Wang Wenying; Zhu Yafang Effect of drought on the permeability and membrane lipid composition from maiz e leaves plant physiology journal the 09th phase of nineteen eighty-three), get second climax leaves with DDS-11C conductivity meter type conductivity meter mensuration, wash T0 for turning the ATPase tobacco leaf with distillation first, using deionized water rinsing, then get 5 of disks with the punch tool of diameter 0.5cm, be placed in the test tube of containing the 10ml distilled water, leave standstill 2h under the room temperature, then survey transudate electric conductivity value S1 with conductivity meter, then test tube is placed boiling water bath 20min, kill tissues, survey its electric conductivity value S2 with aforesaid method again after being cooled to room temperature, with the relatively saturating property (S1/S2) of relative conductivity (%) expression blade cell plasma membrane, measure and repeat 5 times.Turn empty carrier tobacco and wild-type tobacco as contrast take T0 generation.Each strain 3 strain, experiment triplicate results averaged.
The result as shown in Figure 5, wherein, in the positive T0 of ATPase11 generation, turn the ATPase tobacco, GFP turns the empty carrier tobacco at T0 generation, as seen from the figure,
Before 4 ℃ of processing, the value of the membrane permeability of ATPase11 is 23.54%; The membrane permeability value of GFP is 25.25%.
Process after 20 days for 4 ℃, the value of the membrane permeability of ATPase11 is 53.98%; The membrane permeability value of GFP is 66.59%.
After recovering 7 days after 4 ℃ of processing, the value of the membrane permeability of ATPase11 is 44.58%; The membrane permeability value of GFP is 62.99%.
As seen from the figure, the membrane permeability that T0 generation turns the empty carrier tobacco is before deepfreeze and to turn ATPase tobacco (T0 is for turning the ATPase tobacco) be the same basically positive T0 generation, and along with the lengthening of freezing time, T0 begins to have obvious difference for turning empty carrier tobacco and positive T0 for the membrane permeability that turns ATPase tobacco (T0 is for turning the ATPase tobacco), and along with the lengthening of deepfreeze time, the difference of two groups of tobaccos is larger, and this illustrative experiment group turns the tobacco plant of ATPase and organizes effective to the resistance of low temperature than empty carrier tobacco.
T0 is for turning empty carrier tobacco and wild-type tobacco result without significant difference.
Can determine thus, this new gene of the ATPase that finds in the Antarctic Fish body has certain function that keeps out the cold really.
Two, turn acquisition and the functional study of ATPase Arabidopis thaliana
1, turns acquisition and the evaluation of ATPase Arabidopis thaliana
1) preparation of Arabidopis thaliana material:
With the wild-type Arabidopis thaliana (day temperature is 22～24 ℃, and night, Wen Biriwen was low 2 ℃, and humidity is 60%～70%, and light intensity is 150 μ mols/m
-2) give birth on the antibiotic substratum of type WEI Totomycin and cultivate, every fruit pod that 20-30 inflorescence is arranged and also have some maturations, the inflorescence of cutting ripe fruit pod before the conversion and having opened, only the white petal of lulu is the Arabidopis thaliana for conversion.
2) preparation of restructuring Agrobacterium
To be changed over to by the recombinant vectors pHQSN-ATPase that embodiment 1 obtains among the Agrobacterium EHA105, obtain recombinant bacterium, extract the plasmid of recombinant bacterium, send to order-checking, the result contains the recombinant bacterium called after EHA105/pHQSN-ATPase of this plasmid for this plasmid is pHQSN-ATPase.
3) turn the acquisition of ATPase Arabidopis thaliana
(1) get EHA105/pHQSN-ATPase bacterium liquid 100ul and contain in kantlex (75mg/L) and the antibiotic LB liquid nutrient medium of Rifampin (60mg/L) test tube in 5ml, 200rpm, 28 ℃ activate 2 days.
(2) add Silwet-77 in the good bacterium liquid that suspends, concentration is 0.02% (vol/vol).The Arabidopis thaliana that is used for transforming is fallen to immerse the beaker 2min that fills bacterium liquid, put afterwards preservative film, then lodging, shading recovered normal cultivation in one day afterwards, and (day temperature is 22～24 ℃, night, Wen Biriwen was low 2 ℃, and humidity is 60%～70%, and light intensity is 150 μ mols/m
-2), obtain 20 strain T1 for turning the ATPase Arabidopis thaliana.
3) turn ATPase Arabidopis thaliana resistance screening
Totomycin antibiotic-screening positive plant: because expression vector pHQSN has hygromycin resistance in plant, so positive transfer-gen plant add on the antibiotic substratum of Totomycin can normal growth, the wildness plant then can not normal growth.
The contemporary plant that transforms is designated as T0 generation, results T0 is for the seed that turns the ATPase Arabidopis thaliana, obtain T1 for turning ATPase Arabidopis thaliana seed, (the MS substratum is available from the biological company limited of the neat cloud in Guangzhou, and the Totomycin final concentration that uses is 50mg/l being added with the antibiotic MS substratum of Totomycin in sowing.) the upper cultivation, it all is positive plant that length has true leaf and the long green seedling of root, etiolated seedling and dead seedling all are the wild-type plant.The seed of gathering in the crops for individual plant on the plant from T1 is designated as T2 generation.It is generally acknowledged that target gene is heterozygosis at T1 in for transfer-gen plant, T2 3: 1 separation phenomenons should occur for plant.Therefore T2 will screen being added with the antibiotic substratum of Totomycin equally for seedling, should be 1: 1 with the plant of homozygous gene and the ratio of heterozygous plant in the green seedling.The seed of individual plant results is designated as T3 generation from the T2 generation green seedling, and T3 cultivates being added with the antibiotic substratum of Totomycin for plant, every occur separating then be the positive plant that isozygotys, what separation occurs then is the heterozygosis positive plant.The mixed seed of receiving homozygous plants is designated as T4 for homozygous lines, has obtained the positive T4 of two overexpressions for turning ATPase Arabidopis thaliana strain, is respectively ATP8 and ATPase11.
Concrete outcome as shown in Figure 6, wherein, a is that T1 is for the growing state of seedling on the antibiotic MS substratum of interpolation Totomycin, b1, b2 is that T2 is for the growing state of seedling on the antibiotic MS substratum of interpolation Totomycin, separate than being 3: 1, c1, c2 is that T3 is for the growing state of seedling on the antibiotic MS substratum of interpolation Totomycin, obtain two homozygote strains, col is Colombia's wild-type Arabidopis thaliana, and ATPase is for turning the ATPase Arabidopis thaliana, as seen from the figure, T3 cultivates being added with the antibiotic substratum of Totomycin for plant, that occur to separate then be the positive plant overexpression strain of isozygotying, and has namely obtained the positive T3 of two overexpressions for turning ATPase Arabidopis thaliana strain, is respectively ATP8 and ATPase11.
5) turning ATPase Arabidopis thaliana sxemiquantitative RT-PCR identifies
Extract respectively wild-type (col) and be numbered ATP8 and the positive T3 of ATPase11 generation turn ATPase Arabidopis thaliana homozygote (take the whole plant of 7 days wild-type of MS substratum growth and two homozygous lines as material, take by weighing respectively 0.15g and extract RNA) RNA, reverse transcription obtains cDNA as template, take ATPase 2_F, ATPase 2_R as primer, take the actin of Arabidopis thaliana as confidential reference items, the confidential reference items primer is ActinF CTACGAGCAGGAACTCGAGA; ActinR GATGGACCTGACTCGTCATAC, carry out RT-PCR, with the wild-type Arabidopis thaliana as negative control, the result as shown in Figure 7, wherein, col is the wild-type Arabidopis thaliana, can find out, be numbered the positive T3 of ATP8 and ATPase11 for turning the fragment that 462bp is all arranged in the ATPase Arabidopis thaliana, further proof, ATPase is expressed, and the positive T3 that obtains is for turning the ATPase Arabidopis thaliana.
Adopt and use the same method, empty carrier pCPAE2 is changed in the wild-type tobacco, obtain T0 for turning the empty carrier Arabidopis thaliana, extract T0 for the RNA that turns the empty carrier Arabidopis thaliana, reverse transcription obtains cDNA as template, take ATPase 2_F, ATPase 2_R as primer, do not obtain the purpose fragment, illustrate to obtain T0 for turning the empty carrier Arabidopis thaliana, results T0 is for the seed that turns the empty carrier Arabidopis thaliana, sowing continues to go down to posterity, and obtains T4 for turning the empty carrier Arabidopis thaliana.
2, turn the functional study of ATPase Arabidopis thaliana
1) phenotype analytical
3 all seedling ages are numbered the positive T4 of ATP8 and ATPase11 for turning ATPase (homozygote) and wild-type Arabidopis thaliana at 22 ℃, under the normal culture condition of 16h/8h the growth 3 weeks after, place 4 ℃, 16h illumination/8h dark condition, grow after 28 days, place 22 ℃ again, 16h illumination/8h is dark, recover growth 7 days, turn empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana as contrast take T4 generation.
Observe phenotype, the result as shown in Figure 8, wherein, A turns 22 ℃ under normal operation of ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thalianas (col) positive T4 generation of ATPase11, the result in 3 weeks of growth under the 16h/8h illumination condition, B turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) positive T4 generation of ATPase11 at 4 ℃, 16h illumination/3 days result of 8h dark condition growth, C turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) positive T4 generation of ATPase11 at 4 ℃, 16h illumination/7 days result of 8h dark condition growth, D turns ATPase (ATPase overexpression isozygoty drag for be 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) positive T4 generation of ATPase11 at 4 ℃, 16h illumination/14 days result of 8h dark condition growth, E is that positive T4 generation of ATPase11 turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) places 22 ℃ again, 16h illumination/8h is dark, recover 7 days result of growth, can find out, among the A, under normal operation, the positive T4 of ATPase11 is for turning the growth of ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) without significant difference, among the B, wild-type Arabidopis thaliana (col) and overexpression strain subzero treatment after 3 days difference not too remarkable, but wild-type is short and small than the overexpression strain.Among C and the D, wild-type Arabidopis thaliana (col) is along with the deepfreeze time increases, the phenotype of cold damage is also aggravated, blade is dispirited, plant is short and small, and the positive T4 of ATPase11 then grows still good after 4 ℃ of subzero treatment for turning ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP).Among the E, behind the renewal cultivation, wild-type Arabidopis thaliana (col) places under the normal temps after deepfreeze is subject to injury from low temperature again and cultivates, still can not return to normal growth conditions, the subzero treatment that illustrates 4 ℃ is visible to the injury of tobacco, and after the positive T4 of ATPase11 generation turned ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP) and recover growth, plant can continue normal growth and grow, and does not show the injury proterties that any low temperature causes.
Process after 7 days for 4 ℃, each strain is got 20 strains and is surveyed its survival rate, experiment triplicate results averaged, SPSS-Oneway (Duncan) method is used in statistical study, ATPase overexpression homozygous lines 11 survival rates are 72%, standard is mistaken for 0.72 ± 0.009866, and the survival rate of wild-type Arabidopis thaliana (col) is 15%, and standard is mistaken for 0.15 ± 0.006083.
T4 is for turning the result of empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana without significant difference.
2) mensuration of Arabidopis thaliana physical signs
In order further to confirm the cold tolerance of transfer-gen plant, measured relatively thoroughly property physical signs of transfer-gen plant cytoplasmic membrane.
In detect ATPase11 positive T4 generation, turn ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP) membrane permeability, turns the empty carrier Arabidopis thaliana as contrast take wild-type Arabidopis thaliana and T4 generation.Each strain 10 strain, experiment triplicate results averaged.
The mensuration of the relatively saturating property of cytoplasmic membrane is with reference to the method (Li Jinshu of Li Jinshu; Wang Hongchun; Wang Wenying; Zhu Yafang Effect of drought on the permeability and membrane lipid composition from maiz e leaves plant physiology journal the 09th phase of nineteen eighty-three), get second climax leaves with DDS-11C conductivity meter type conductivity meter mensuration, first with distillation washing blade, using deionized water rinsing, then get 5 of disks with the punch tool of diameter 0.cm, be placed in the test tube of containing the 10ml distilled water, leave standstill 2h under the room temperature, then survey transudate electric conductivity value S1 with conductivity meter, then test tube is placed boiling water bath 20min, kill tissues, survey its electric conductivity value S2 with aforesaid method again after being cooled to room temperature, with the relatively saturating property (S1/S2) of relative conductivity (%) expression blade cell plasma membrane, measure and repeat 5 times.
The result as shown in Figure 9,
Before 4 ℃ of processing, the positive T4 of ATPase11 is 12.27% for the value that turns the membrane permeability of ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines), and the value of the membrane permeability of wild-type Arabidopis thaliana is 13.66%
Process after 28 days for 4 ℃, the positive T4 of ATPase11 is 38.19% for the value that turns ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines) membrane permeability, and the value of wild-type Arabidopis thaliana membrane permeability is 62.08%
After recovering 7 days after 4 ℃ of processing, the positive T4 of ATPase11 is that 25.78%, T4 is 55.42% for the value that turns the membrane permeability of empty carrier Arabidopis thaliana for the value that turns the membrane permeability of ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines).
As seen from the figure, the membrane permeability of wild-type Arabidopis thaliana turns ATPase Arabidopis thaliana (ATPase overexpression homozygous lines) with positive T4 generation of ATPase11 before deepfreeze be the same basically, and along with the lengthening of freezing time, the positive T4 of wild-type Arabidopis thaliana and ATPase11 begins to have obvious difference for the membrane permeability that turns ATPase Arabidopis thaliana (overexpression homozygous lines), and along with the lengthening of deepfreeze time, the difference of two groups of Arabidopis thalianas is larger, and the positive T4 of this illustrative experiment group ATPase11 is more effective than wild-type Arabidopis thaliana to the resistance of low temperature for turning ATPase Arabidopis thaliana (overexpression homozygous lines) plant.
Wild-type Arabidopis thaliana and T4 are for turning empty carrier Arabidopis thaliana result without significant difference.
Can determine thus, this new gene of the ATPase that finds in the Antarctic Fish body has certain function that keeps out the cold really, and to improving the cold-resistant quality of plant, there is important realistic meaning the aspect that improves its opposing natural low temperature disaster.
Claims (10)
1. a method of cultivating transgenic plant is in the encoding gene importing purpose plant with ATPase albumen, obtains the transgenic plant that resistance of reverse is higher than described purpose plant;
The aminoacid sequence of described ATPase albumen is the sequence 2 in the sequence table.
2. the method for claim 1 is characterized in that:
The nucleotides sequence of the encoding gene of described ATPase albumen is classified the sequence 1 in the sequence table as.
3. method as claimed in claim 1 or 2 is characterized in that:
The encoding gene of described ATPase albumen imports in the described purpose plant by following recombinant vectors;
Described recombinant vectors is following A or B:
Recombinant vectors shown in the A is that the encoding gene of described ATPase albumen is inserted in the pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in the B is that the encoding gene of described ATPase albumen is inserted in the pHQSN carrier, expresses the recombinant vectors of described encoding gene.
4. such as arbitrary described method among the claim 1-3, it is characterized in that: described resistance of reverse is winter hardiness.
5. such as arbitrary described method among the claim 1-4, it is characterized in that: the described ATPase of turning gene plant winter hardiness is by increasing plant height, raising survival rate and/or reducing the relatively saturating property of cytoplasmic membrane and embody.
6. such as arbitrary described method among the claim 1-5, it is characterized in that: described purpose plant is dicotyledons or monocotyledons.
7. recombinant vectors is following A or B:
Recombinant vectors shown in the A is that the encoding gene of described ATPase albumen is inserted in the pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in the B is that the encoding gene of described ATPase albumen is inserted in the pHQSN carrier, expresses the recombinant vectors of described encoding gene.
8. recombinant vectors as claimed in claim 7 is characterized in that:
Recombinant vectors shown in the described A is for inserting the encoding gene of described ATPase albumen the recombinant vectors of the described encoding gene of expression that obtains between the multiple clone site of pCPAE2 carrier;
Recombinant vectors shown in the described B is for inserting the encoding gene of described ATPase albumen the recombinant vectors of the described encoding gene of expression that obtains between the multiple clone site of pHQSN carrier.
9. the encoding gene of described ATPase albumen, described ATPase albumen and/or claim 7 or the 8 described recombinant vectorss application in cultivating the resistance of reverse transgenic plant.
10. application according to claim 9 is characterized in that: described resistance of reverse is winter hardiness; Described purpose plant is dicotyledons or monocotyledons.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110242917.9A CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110242917.9A CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952816A true CN102952816A (en) | 2013-03-06 |
| CN102952816B CN102952816B (en) | 2014-05-14 |
Family
ID=47762202
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110242917.9A Expired - Fee Related CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952816B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382476A (en) * | 2013-06-06 | 2013-11-06 | 江苏省农业科学院 | Application of cotton P-type ATPase gene Gbpatp capable of endowing plants with cold tolerance |
| WO2014205595A1 (en) * | 2013-06-24 | 2014-12-31 | 创世纪转基因技术有限公司 | Atp hydrolase atpase-1 derived from cotton, and coding gene and use thereof |
| WO2014205596A1 (en) * | 2013-06-24 | 2014-12-31 | 创世纪转基因技术有限公司 | Atp hydrolase atpase-2 from cotton and coding gene and use thereof |
| CN106397559A (en) * | 2016-09-05 | 2017-02-15 | 黑龙江八农垦大学 | Vegetable carbonate stress tolerance related protein GsHA16, as well as coding gene and application thereof |
| WO2017076305A1 (en) * | 2015-11-03 | 2017-05-11 | 西南大学 | Method for improving plant resistance to verticillium wilt using beauveria bassiana bbp4-atpase gene |
| WO2017076306A1 (en) * | 2015-11-03 | 2017-05-11 | 西南大学 | Method for improving plant resistance to verticillium wilt using verticillium-wilt bacteria vdp4-atpase gene |
| CN109867715A (en) * | 2019-02-28 | 2019-06-11 | 中国科学院昆明植物研究所 | A kind of chloroplast protein and ATPase enzymatic activity mutant are improving the application in stress resistance of plant |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030233670A1 (en) * | 2001-12-04 | 2003-12-18 | Edgerton Michael D. | Gene sequences and uses thereof in plants |
| CN101402679A (en) * | 2008-11-13 | 2009-04-08 | 中国科学院遗传与发育生物学研究所 | Coldproof protein, encoding gene and uses thereof |
-
2011
- 2011-08-23 CN CN201110242917.9A patent/CN102952816B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030233670A1 (en) * | 2001-12-04 | 2003-12-18 | Edgerton Michael D. | Gene sequences and uses thereof in plants |
| CN101402679A (en) * | 2008-11-13 | 2009-04-08 | 中国科学院遗传与发育生物学研究所 | Coldproof protein, encoding gene and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| CHEN SL ET AL.: "登录号：AAP20161", 《GENBANK》, 20 September 2004 (2004-09-20) * |
| GEORG STROMPEN ET AL.: "Arabidopsis vacuolar H+-ATPase subunit E isoform 1 is required for Golgi organization and vacuole function in embryogenesis", 《THE PLANT JOURNAL》, vol. 41, no. 1, 31 January 2005 (2005-01-31) * |
| WANG TQ ET AL.: "EFFECT OF OVER-EXPRESSION OF V-ATPase SUBUNIT C FROM ANTARCTIC NOTOTHENIOID FISHES ON COLD TOLERANCE IN TOBACCO", 《BIOTECHNOLOGY & BIOTECHNOLOGICAL EQUIPMENT》, vol. 26, no. 6, 31 December 2012 (2012-12-31) * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382476A (en) * | 2013-06-06 | 2013-11-06 | 江苏省农业科学院 | Application of cotton P-type ATPase gene Gbpatp capable of endowing plants with cold tolerance |
| CN105189741B (en) * | 2013-06-24 | 2018-03-16 | 创世纪种业有限公司 | A kind of cotton ATP hydrolase As TPase 2 and its encoding gene and application |
| WO2014205596A1 (en) * | 2013-06-24 | 2014-12-31 | 创世纪转基因技术有限公司 | Atp hydrolase atpase-2 from cotton and coding gene and use thereof |
| CN105073984A (en) * | 2013-06-24 | 2015-11-18 | 创世纪种业有限公司 | Atp hydrolase atpase-1 derived from cotton, and coding gene and use thereof |
| CN105189741A (en) * | 2013-06-24 | 2015-12-23 | 创世纪种业有限公司 | ATP hydrolase ATPase-2 from cotton and coding gene and use thereof |
| CN105073984B (en) * | 2013-06-24 | 2017-11-10 | 创世纪种业有限公司 | A kind of cotton ATP hydrolase As TPase 1 and its encoding gene and application |
| WO2014205595A1 (en) * | 2013-06-24 | 2014-12-31 | 创世纪转基因技术有限公司 | Atp hydrolase atpase-1 derived from cotton, and coding gene and use thereof |
| WO2017076305A1 (en) * | 2015-11-03 | 2017-05-11 | 西南大学 | Method for improving plant resistance to verticillium wilt using beauveria bassiana bbp4-atpase gene |
| WO2017076306A1 (en) * | 2015-11-03 | 2017-05-11 | 西南大学 | Method for improving plant resistance to verticillium wilt using verticillium-wilt bacteria vdp4-atpase gene |
| CN106397559A (en) * | 2016-09-05 | 2017-02-15 | 黑龙江八农垦大学 | Vegetable carbonate stress tolerance related protein GsHA16, as well as coding gene and application thereof |
| CN106397559B (en) * | 2016-09-05 | 2019-07-19 | 黑龙江八一农垦大学 | A kind of and plant carbonate stress tolerance GAP-associated protein GAP GsHA16 and its encoding gene and application |
| CN109867715A (en) * | 2019-02-28 | 2019-06-11 | 中国科学院昆明植物研究所 | A kind of chloroplast protein and ATPase enzymatic activity mutant are improving the application in stress resistance of plant |
| CN109867715B (en) * | 2019-02-28 | 2022-06-17 | 中国科学院昆明植物研究所 | Application of chloroplast protein and ATPase enzymatic activity mutant in improvement of stress resistance of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952816B (en) | 2014-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102952816B (en) | Application of ATPase proteins in stress tolerance of plants | |
| CN105254726B (en) | ERF class transcription factor relevant to plant stress-resistance and its encoding gene and application | |
| CN1833025A (en) | EPSP synzyme of high anti-cancrinia discoidea and its coding squence | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN114317552B (en) | Gene PeERF1 for regulating and controlling salt tolerance of populus euphratica and application thereof | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN104327173B (en) | A kind of cotton WRKY transcription factors GarWRKY22 of regulation and control plant salt endurance and application | |
| CN104480117A (en) | NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos | |
| CN103620039A (en) | Hkt protein of cotton and coding gene and application thereof | |
| CN102653763A (en) | Meloidogyne javanica dominant-effect gene (Mj-nulg), related protein and application of Mj-nulg | |
| CN111154800A (en) | Application of rice OsRNCR gene and encoding protein thereof in enhancing salt tolerance of plants | |
| CN102719449A (en) | Clone of apple resistance-related gene MdSIMYB1 and application thereof | |
| CN101503693B (en) | Halimodendron halodendron ERF transcription factor cDNA sequence, expression vector and use thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN106191001A (en) | The application in improving plant salt endurance of phospholipase PLD ζ 1 gene | |
| CN103602688B (en) | Helianthus tuberosus L. Na<+>/H<+> reverse transport protein genes HtNHX1 and HtNHX2 and use thereof | |
| CN103319584B (en) | Bruguiear gymnorrhiza (L.) Lam ERF transcription factor cDNA sequence, its expression vector and application | |
| CN105177001A (en) | MiR167d related to barley powdery mildew resistance and application thereof | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN102899296B (en) | Rice stress tolerance-related receptor-like protein OsSIK3, its coding gene and application | |
| CN107663232A (en) | Plant anti-adversity associated protein OsIAA18 and its encoding gene and application | |
| CN110358774B (en) | Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time | |
| CN102633869B (en) | Low temperature resistance associated protein and encoding gene and application thereof | |
| CN105567713B (en) | 3 albumen of peanut AhPLD α and its encoding gene and application | |
| CN102417911A (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140514 Termination date: 20180823 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |