CN102952816B - Application of ATPase proteins in stress tolerance of plants - Google Patents
Application of ATPase proteins in stress tolerance of plants Download PDFInfo
- Publication number
- CN102952816B CN102952816B CN201110242917.9A CN201110242917A CN102952816B CN 102952816 B CN102952816 B CN 102952816B CN 201110242917 A CN201110242917 A CN 201110242917A CN 102952816 B CN102952816 B CN 102952816B
- Authority
- CN
- China
- Prior art keywords
- atpase
- plant
- tobacco
- arabidopis thaliana
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses an application of ATPase proteins in the stress tolerance of plants. A transgenic plant cultivation method is characterized in that transgenic plants having a higher stress tolerance than target plants is obtained through introducing ATPase protein coding genes into the target plants, and the amino acid sequence of the ATPase proteins is represented by sequence 2 in a sequence table. Experiments in the invention prove that Dissostichus mawsoni which is a special species is treated as a research material and a cDNA library constructing and sequencing technology is utilized to find that the ATPase gene possibly has a cod resistance function, the ATPase gene is transferred to tobacco and Arabidopis thaliana to obtain transgenic plants, and the transgenic plants have the cold resistance function at a low temperature and have a higher cold resistance than wild plants, so a case than the ATPase gene is a cold resistance related gene is confirmed.
Description
Technical field
The present invention relates to biological technical field, relate in particular to the application of a kind of ATPase albumen in plant stress tolerance.
Background technology
Antarctic Fish is the most cold-resistant known fish, its cell can be at-1 ℃--in the low temperature of 2 ℃, complete all vital movements including ontogeny, under cold environment evolve form genome encoding all functions molecule of surviving required under low temperature, be important genetic resources.The fish that live in the South Pole have shown a series of and cold-resistant relevant physiology and chemistry proterties, as the evolution of antifreeze protein, Heat shock response (the heat-shock response, HSR) disappearance, in blood, a large amount of the minimizing even of red blood corpuscle disappears, myofibrillar reduced number, diameter but increases etc.Therefore, to living in the comparative analysis of the Antarctic Fish genoid group under differing temps environment, and the clone identification of genes involved, functional analysis and study on mechanism thereof, contribute to understand the mechanism that South Pole fish survive under 0 ℃ of following extreme like this low temperature environment.
The activity of cold and heat air is one of fundamental cause of Changes in weather.Under specific synoptic situation, the strong cold air that accumulates in high latitude area is gone down south rapidly, invasion China, cause violent cooling on a large scale, and with phenomenons such as strong wind, sleet, freeze injuries, this class synoptic process is called cold wave or strong cold air, and the loss that caused is thus called cold wave and freezing disaster.Cold weather can cause a large amount of underproduction of farm crop, in the U.S., cause rural economy loss to reach tens dollars, for example in December, 1998 due to cold every year, California is oranges and tangerines Large Scale Death due to freezing disaster, and direct economic loss reaches 500,000,000 9 thousand ten thousand dollars.There are hundred million mu of farmlands of 6-7 to suffer the harm of cold weather in the every annual of China, 20,000,000,000 kilograms of the grain reduction of income (sustainable development of China Information Network 2003.10.13).
Therefore, how to make farm crop avoid cold disaster and become the focus of research.
Summary of the invention
An object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention, is that the encoding gene of ATPase albumen is imported in object plant, obtains the transgenic plant of resistance of reverse higher than described object plant;
The aminoacid sequence of described ATPase albumen is the sequence 2 in sequence table.
The nucleotides sequence of the encoding gene of described ATPase albumen is classified the sequence 1 in sequence table as.
The encoding gene of described ATPase albumen imports in described object plant by following recombinant vectors;
Described recombinant vectors is following A or B:
Recombinant vectors shown in A is that the encoding gene of described ATPase albumen is inserted in pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in B is that the encoding gene of described ATPase albumen is inserted in pHQSN carrier, expresses the recombinant vectors of described encoding gene.
Described resistance of reverse is winter hardiness.
The described ATPase of turning gene plant winter hardiness embodies by the relatively saturating property of increase plant height, raising survival rate and/or reduction cytoplasmic membrane, mainly embodies by reducing the relatively saturating property of cytoplasmic membrane.
Described object plant is dicotyledons or monocotyledons, and described dicotyledons is specially tobacco or Arabidopis thaliana.
Another object of the present invention is to provide a kind of recombinant vectors.
Recombinant vectors provided by the invention is following A or B:
Recombinant vectors shown in A is that the encoding gene of described ATPase albumen is inserted in pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Recombinant vectors shown in B is that the encoding gene of described ATPase albumen is inserted in pHQSN carrier, expresses the recombinant vectors of described encoding gene.
Recombinant vectors shown in described A is that described gene is inserted between pCPAE2 carrier MluI and EcoRI restriction enzyme site, the recombinant vectors of expressing said gene;
Recombinant vectors shown in described B is that described gene is inserted in pHQSN carrier between MluI and EcoRI restriction enzyme site, the recombinant vectors of expressing said gene.
The encoding gene of described ATPase albumen, described ATPase albumen and/or described recombinant vectors are also the scope of protection of the invention in the application of cultivating in resistance of reverse transgenic plant.
Described resistance of reverse is winter hardiness; Described object plant is dicotyledons or monocotyledons, and described dicotyledons is specially tobacco or Arabidopis thaliana.
Of the present invention experimental results show that, the present invention is take these special species of Antarctic Fish Dissostichus mawsoni as research material, utilize the structure of cDNA library and the technology of order-checking, find to have the ATPase gene of cold-resistant function, and proceeded in tobacco and Arabidopis thaliana, obtain transgenic plant and really there is at low temperatures cold-resistant function, higher than wild-type plant winter hardiness, confirm that this gene is and cold-resistant relevant gene.
Accompanying drawing explanation
Fig. 1 is the tobacco expressed carrier of improved pCAPE2
Fig. 2 is Arabidopis thaliana expression vector carrier pHQSN
Fig. 3 is the RT-PCR of transgene tobacco
Fig. 4 is the phenotype of transgene tobacco
Fig. 5 is transgene tobacco membrane permeability
Fig. 6 is the resistance screening of transgenic arabidopsis
Fig. 7 is the RT-PCR of transgenic arabidopsis
Fig. 8 is the phenotype of transgenic arabidopsis
Fig. 9 is transgenic arabidopsis membrane permeability
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
Laboratory apparatus, all ingredients and test kit:
Laboratory apparatus :-20 ℃, 4 ℃ of refrigerators (Haier, AUCMA);-80 ℃ of ULT Freezer (Thermo Forma); PTC-200 PCR instrument (MJ Reaserch); TP-600 PCR instrument (TakaRa); 5417R, 5810R and the freezing desk centrifuge of 5417D high speed (Eppendorf); Sub-Cell GT Agarose Gel Electrophoresis Systems (Bio-Rad); YLN-2000 gel imaging system (Beijing Ya Lien mechanical & electrical technology institute); DH4000A type electro-heating standing-temperature cultivator (Tianjin Stettlen Instrument Ltd.); GXZ intelligent illumination incubator (south of the River instrument); BIO-RAD electrophoresis apparatus (Beijing Bole); Ultra-clean aseptic operating platform; PB-21PH meter; Homogenizer; Ice-making machine; High-pressure sterilizing pot; Water-bath; Baking box; Microwave oven; Adjustable micropipette rifle (Eppendorf); 25 ℃ of normal temperature culturing room; 4 ℃ of low temperature culturing room; Mortar; Mill; Shaking table; Centrifuge tube.
Reagent: restriction enzyme, RNase A etc. are purchased from Dalian Bao Bio-Engineering Company; T4 DNA ligase, TaqDNA polysaccharase be purchased from NEB company,
reagent is purchased from Invitrogen biotech firm; Tryptones, yeast extract, agar powder, microbiotic, purchased from Ding Guo company and Takara company;
Test kit: QIAquick Gel Extraction Kit (QIAGEN, Cat.No.28704); Plasmid mini kit (OMEGA, Cat.D6944-01); RNA Isolation Kit (TIANZE)
Sample: Antarctic Fish (Dissostichus mawsoni; Aspects of body size and gonadal histology in the Antarctic toothfish, Dissostichus mawsoni, from McMurdo Sound, Antarctica.Eastman JT, DeVries AL.Polar Biol. (2000) 23:189-195., the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.)
Bacterial strain: intestinal bacteria XL10-Gold (purchased from Stratagene company, Cat.NO.200315); Agrobacterium GV3103 (Chinese plasmid vector strain cell pnca gene preservation center, Biovector Science Lab.Inc, BV93526); Agrobacterium EHA105 (Chinese plasmid vector strain cell pnca gene preservation center, Biovector Science Lab.Inc, BV93526).
Plasmid:
Tobacco expressed carrier: PEBV-VIGS carrier system, is made up of two T-DNA plasmids (pCAPE1, pCAPE2 (pCAPE2 structural representation as shown in Figure 1));
PCAPE1, pCAPE2 is all documented in Constantin, G.D., B.N.Krath, S.A.MacFarlane, M.Nicolaisen, I.E.Johansen, and O.S.Lund.2004.Virus-induced gene silencing as a tool for functional genomics in a legume species.Plant J 40:622-631, the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.)。
Arabidopis thaliana expression vector: (carrier pHQSN is transformed by expression vector pCAMBIA1390 carrier pHQSN, this carrier is awarded transformation by South China Normal University's Li Hong Puritanism, the detailed source of article of carrier pHQSN: Improvement of Torenia fournieri salinity tolerance by expression of Arabidopsis AtNHX5.Le-Yi Shi, Hong-Qing Li, Xiao-Ping Pan, Guo-Jiang Wu and Mei-Ru Li.Functional Plant Biology, 2008-CSIRO., the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.The detailed source of former expression vector pCAMBIA1390 is: The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation.Hajdukiewicz, P., Svab, Z.and Maliga, P.Plant Mol.Biol.25 (6), 989-994 (1994). there is 35S promoter and NOS terminator, as shown in Figure 2.
Tobacco (Ben Saimushi tobacco, Nicotiana Benthamiana), purchased from Tobacco Institute, Chinese Academy of Agricultural Science.
Hereinafter to be referred as wild-type tobacco;
Arabidopis thaliana (Arabidopsis thaliana (L.) Heynh, Columbia (Col)), hereinafter to be referred as wild-type Arabidopis thaliana.
The acquisition of embodiment 1, ATPase gene
1, obtaining of ATPase full length gene sequence
Consequence devised PCR primer according to library EST order-checking:
Gene_ATPase:MluI/EcoRI (for tobacco expressed carrier pCAPE2)
ATPase1_F:5-AT ACGCGT ATGTCGGCCGAAAGTC-3 (sequence 3)
ATPase1_R:5-CGG GAATTC TTATTTCGTGGAGAGGA-3 (sequence 4)
Gene_ATPase:XbaI/BamHI (for Arabidopis thaliana expression vector pHQSN)
ATPase2_F:5-AT TCTAGA ATGTCGGCCGAAAGTCCCGA-3 (sequence 5)
ATPase2_R:5-AT GGATCC TTATTTCGTGGAGAGGATCAG-3 (sequence 6)
Extract the RNA of the liver of Antarctic Fish Dissostichus mawsoni, reverse transcription obtains cDNA as template, increase with primer pair ATPase 1_F, ATPase 1_R and primer pair ATPase 2_F, ATPase 2_R respectively, obtain PCR product 1 and PCR product 2.
PCR product 1 and PCR product 2 are sent to order-checking, result is that PCR product 1 and PCR product 2 all have the Nucleotide shown in sequence 1 in sequence table, the unnamed gene of this PCR product is ATPase, and its coding region is that sequence 1 in sequence table is from 5 ' end 1-462 position Nucleotide.The albumen called after ATPase of this genes encoding, its aminoacid sequence is the sequence 2 in sequence table.Sequence 1 is made up of 462 Nucleotide, and sequence 2 is made up of 153 amino acid.
Also can artificial synthesized sequence 1, increase with primer pair ATPase 1_F, ATPase 1_R and primer pair ATPase 2_F, ATPase 2_R respectively, obtain PCR product 1 and PCR product 2.
2, the acquisition of recombinant vectors
Cut PCR product 1 with MluI and EcoRI enzyme, the object fragment obtaining connects with the carrier pCPAE2 cutting through same enzyme, obtaining connecting product proceeds in intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, result is that this plasmid is that the sequence in sequence table 1 is inserted to the carrier obtaining between the MluI of pCPAE2 and EcoRI restriction enzyme site, by this plasmid called after pCPAE2-ATPase.
Cut PCR product 2 with XbaI and BamHI enzyme, the object fragment obtaining connects with the carrier pHQSN cutting through same enzyme, obtaining connecting product proceeds in intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, result is that this plasmid is that the sequence in sequence table 1 is inserted to the carrier obtaining between the XbaI of pHQSN and BamHI restriction enzyme site, by this plasmid called after pHQSN-ATPase.
Embodiment 2, turn the functional study of ATPase plant
One, turn acquisition and the functional study of ATPase tobacco
1, turn acquisition and the evaluation of ATPase tobacco
1) preparation of tobacco material:
In 25 ℃ of cultivations, illumination in 16 hours, 8 hours dark, the wild-type tobacco seedling of growing in vermiculite, grows to 5-6 sheet expansion leaf and is acceptor tobacco.
2) preparation of restructuring Agrobacterium
The recombinant vectors pCPAE2-ATPase being obtained by embodiment 1 is proceeded in Agrobacterium GV3103, obtain recombinant bacterium, extract the plasmid of recombinant bacterium, send to order-checking, result is for this plasmid is pCPAE2-ATPase, the recombinant bacterium called after GV3103/pCPAE2-ATPase that contains this plasmid.
3) turn the acquisition of ATPase tobacco
(1) 28 ℃ of overnight incubation of picking GV3103/pCPAE2-ATPase line;
(2) the above-mentioned bacterium that spends the night of picking is inoculated into 5ml LB (Rif final concentration 50mg/l, Kana final concentration 50mg/l)) 28 ℃ of overnight incubation in Rif;
(3) the above-mentioned bacterium liquid spending the night is transferred in 50ml LB (10mM MES+20 μ M Acetosyringone+Kana) to 28 ℃ of overnight incubation;
(4) the above-mentioned bacterium liquid of centrifugal collection, is then resuspended in LB (10mM MgCl
2+ 10mM MES+200 μ M Acetosyringone) in, OD adjusted
600=2.0, under room temperature (25 ℃), leave standstill 3 hours;
(5) pCAPE1 and two carriers of pCAPE2 are proceeded to respectively in Agrobacterium, picking positive colony shakes bacterium, the bacterium liquid that contains pCAPE1 and pCAPE2 expression vector that the shakes ratio hybrid injection acceptor tobacco with 1: 1 will be got, when injection, to inject the tender leaf of proximal ends, obtain 8 strain T0 for turning ATPase tobacco.
4), turning ATPase tobacco RT-PCR identifies
Extract the RNA that T0 generation turns ATPase tobacco leaf, reverse transcription obtains cDNA as template, take ATPase 1_F, ATPase 1_R as primer, carry out RT-PCR, using wild-type tobacco as negative control, result as shown in Figure 3, wherein, 1 is DL2000Marker, 2 positive contrast pCPAE2-ATPase, 3 for T0 is for turning ATPase tobacco, 4 negative contrasts (wild-type tobacco), 5 is the PCR product that is template without the T0 of reverse transcription for tobacco RNA, 6 is the water PCR product that is template, can find out, in the positive T0 generation that obtains 462bp, turns ATPase tobacco.
Adopt and use the same method, empty carrier pCPAE2 is proceeded in wild-type tobacco, obtain T0 for turning empty carrier tobacco, extract the RNA that T0 generation turns empty carrier tobacco leaf, reverse transcription obtains cDNA as template, take ATPase 1_F, ATPase1_R as primer, do not obtain object fragment, illustrate that obtaining T0 generation turns empty carrier tobacco.
2, turn the functional study of ATPase tobacco
1) phenotype analytical
In the positive T0 generation of 3 weeks seedling ages, is turned to lower 23 ℃ of ATPase tobacco normal condition, 16h illumination/8h dark, grow after 14 days, be placed in 4 ℃, 16h illumination/8h dark, grew after 20 days, be placed in again 23 ℃, 16h illumination/8h dark, recovers growth 15 days, turns empty carrier tobacco and wild-type tobacco as contrast take T0 generation.
Observe phenotype, result as shown in Figure 4, wherein, the positive T0 of A is for turning 23 ℃ under normal operation of ATPase tobacco (ATPase) and wild-type tobaccos (GFP), 16h illumination/8h dark, the result of growing 14 days, the positive T0 of B is for turning ATPase tobacco (ATPase) and wild-type tobacco (GFP) at 4 ℃, 16h illumination/8h dark, the result of growing 20 days, in positive T0 generation of C, turns ATPase tobacco (ATPase) and wild-type tobacco (GFP) is placed in 23 ℃ again, 16h illumination/8h dark, recover the growth result of 15 days, can find out, in A, under normal operation, in positive T0 generation, turns ATPase tobacco (ATPase) and wild-type tobacco (GFP) is grown without significant difference, in B, wild-type tobacco (GFP) has the phenotype of obvious cold damage, the bending of plant stem, plant is short and small, in positive T0 generation, turns ATPase tobacco (ATPase) and after 4 ℃ of subzero treatment, grows still good, subzero treatment does not cause it to have untoward reaction.In C, after renewal cultivation, wild-type tobacco (GFP) is placed under normal temps again and cultivates after deepfreeze is subject to injury from low temperature, still can not return to normal growth conditions, illustrate that the subzero treatment of 4 ℃ is visible to the injury of tobacco, and in positive T0 generation, turns ATPase tobacco (ATPase), 4 ℃ of deepfreezes are after 20 days, be placed in 23 ℃ and recover growth after 15 days, plant can continue normal growth and grow, and does not show the injury proterties that any low temperature causes.
Process after 20 days at 4 ℃, each strain is got 3 strains and is surveyed its plant height, test results averaged in triplicate, statistical study is used SPSS-Oneway (Duncan) method, it is 36cm that T0 generation turns ATPase tobacco plant height mean value, standard is mistaken for 36 ± 0.30551, and wild-type tobacco (GFP) plant height mean value is 28cm, and standard is mistaken for 28 ± 0.34641.
T0 is for turning empty carrier tobacco and wild-type tobacco result without significant difference.
2) mensuration of tobacco physiological indexes
In order further to confirm the cold tolerance of transfer-gen plant, measure transfer-gen plant cytoplasmic membrane property (membrane permeability) physical signs relatively thoroughly.
When plant tissue is subject to adverse circumstance injury, because the function of film is impaired or structure deteriorate, and its saturating property is increased, various water-soluble substanceses comprise that ionogen will have exosmosing in various degree in cell, plant tissue is immersed in deionized water, and the electricity of water is led and will be strengthened because of electrolytical exosmosing, and injures heavier, exosmose the more, the increase of conductivity is also larger.Membrane permeability is higher thus, illustrates that plant is hurt heavier, otherwise, be hurt lighter.
The mensuration of the relatively saturating property of cytoplasmic membrane is with reference to the method (Li Jinshu of Li Jinshu, Wang Hongchun, Wang Wenying, Zhu Yafang Effect of drought on the permeability and membrane lipid composition from maiz e leaves the 09th phase of plant physiology journal nineteen eighty-three), measure and get second climax leaves with DDS-11C conductivity meter type conductivity meter, first turn ATPase tobacco leaf with distillation washing T0 generation, using deionized water rinsing, then get 5 of disks with the punch tool of diameter 0.5cm, be placed in the test tube of containing 10ml distilled water, under room temperature, leave standstill 2h, then survey transudate electric conductivity value S1 with conductivity meter, then test tube is placed in to boiling water bath 20min, kill tissues, after being cooled to room temperature, survey its electric conductivity value S2 with aforesaid method again, represent blade cell plasma membrane property (S1/S2) relatively thoroughly with relative conductivity (%), measure and repeat 5 times.Turn empty carrier tobacco and wild-type tobacco as contrast take T0 generation.Each strain 3 strains, test results averaged in triplicate.
As shown in Figure 5, wherein, in positive T0 generation of ATPase11, turns ATPase tobacco to result, and GFP turns empty carrier tobacco in T0 generation, as seen from the figure,
Before 4 ℃ of processing, the value of the membrane permeability of ATPase11 is 23.54%; The membrane permeability value of GFP is 25.25%.
Process after 20 days for 4 ℃, the value of the membrane permeability of ATPase11 is 53.98%; The membrane permeability value of GFP is 66.59%.
After 4 ℃ of processing, recover after 7 days, the value of the membrane permeability of ATPase11 is 44.58%; The membrane permeability value of GFP is 62.99%.
As seen from the figure, the membrane permeability that T0 generation turns empty carrier tobacco is the same with positive T0 substantially for turning ATPase tobacco (T0 generation turns ATPase tobacco) before deepfreeze, and along with the lengthening of freezing time, in T0 generation, turns empty carrier tobacco and positive T0 starts to have obvious difference for the membrane permeability that turns ATPase tobacco (T0 generation turns ATPase tobacco), and along with the lengthening of deepfreeze time, the difference of two groups of tobaccos is larger, and this illustrative experiment group turns the tobacco plant of ATPase and organizes effective to the resistance of low temperature than empty carrier tobacco.
T0 is for turning empty carrier tobacco and wild-type tobacco result without significant difference.
Can determine thus, this new gene of the ATPase finding in Antarctic Fish body has certain function keeping out the cold really.
Two, turn acquisition and the functional study of ATPase Arabidopis thaliana
1, turn acquisition and the evaluation of ATPase Arabidopis thaliana
1) preparation of Arabidopis thaliana material:
By wild-type Arabidopis thaliana (day temperature is 22～24 ℃, and night, Wen Biwen was low 2 ℃, and humidity is 60%～70%, and light intensity is 150 μ mols/m
-2) cultivate on the antibiotic substratum of raw type WEI Totomycin, every have 20-30 inflorescence and a fruit pod of some maturations in addition, the inflorescence of cutting ripe fruit pod before conversion and having opened, and only the white petal of lulu, is the Arabidopis thaliana for transforming.
2) preparation of restructuring Agrobacterium
The recombinant vectors pHQSN-ATPase being obtained by embodiment 1 is proceeded in Agrobacterium EHA105, obtain recombinant bacterium, extract the plasmid of recombinant bacterium, send to order-checking, result is for this plasmid is pHQSN-ATPase, the recombinant bacterium called after EHA105/pHQSN-ATPase that contains this plasmid.
3) turn the acquisition of ATPase Arabidopis thaliana
(1) get EHA105/pHQSN-ATPase bacterium liquid 100ul and contain in kantlex (75mg/L) and the antibiotic LB liquid nutrient medium of Rifampin (60mg/L) test tube in 5ml, 200rpm, 28 ℃ activate 2 days.
(2) in the bacterium liquid having suspended, add Silwet-77, concentration is 0.02% (vol/vol).Arabidopis thaliana for transforming is fallen to immerse the beaker 2min that fills bacterium liquid, put afterwards preservative film, then lodging, shading recovers normal cultivation for one day afterwards, and (day temperature is 22～24 ℃, night, Wen Biwen was low 2 ℃, and humidity is 60%～70%, and light intensity is 150 μ mols/m
-2), obtain 20 strain T1 for turning ATPase Arabidopis thaliana.
3) turn ATPase Arabidopis thaliana resistance screening
Totomycin antibiotic-screening positive plant: because expression vector pHQSN has hygromycin resistance in plant, so positive transfer-gen plant add on Totomycin antibiotic substratum can normal growth, wildness plant can not normal growth.
The contemporary plant transforming is designated as T0 generation, in results T0 generation, turns the seed of ATPase Arabidopis thaliana, obtain T1 for turning ATPase Arabidopis thaliana seed, being added with the antibiotic MS substratum of Totomycin, (MS substratum is purchased from the biological company limited of the neat cloud in Guangzhou, and the Totomycin final concentration of use is 50mg/l in sowing.) upper cultivation, it is all positive plant that length has true leaf and the long green seedling of root, etiolated seedling and dead seedling are all wild-type plant.Be designated as T2 generation from T1 for the seed of individual plant results plant.It is generally acknowledged that target gene is heterozygosis at T1 in for transfer-gen plant, should there is 3: 1 separation phenomenons for plant in T2.Therefore T2 will screen being added with on the antibiotic substratum of Totomycin equally for seedling, and the plant with homozygous gene in green seedling and the ratio of heterozygous plant should be 1: 1.From T2 generation green seedling, the seed of individual plant results is designated as T3 generation, and T3 cultivates being added with on the antibiotic substratum of Totomycin for plant, and every what do not occur separating be the positive plant that isozygotys, and what occur separation is heterozygosis positive plant.The mixed seed of receiving homozygous plants, is designated as T4 for homozygous lines, has obtained the positive T4 of two overexpressions for turning ATPase Arabidopis thaliana strain, is respectively ATP8 and ATPase11.
Concrete outcome as shown in Figure 6, wherein, a is T1 for seedling at the growing state adding on the antibiotic MS substratum of Totomycin, b1, b2 is T2 for seedling at the growing state adding on the antibiotic MS substratum of Totomycin, separate than being 3: 1, c1, c2 is T3 for seedling at the growing state adding on the antibiotic MS substratum of Totomycin, obtain two homozygote strains, col is Colombia's wild-type Arabidopis thaliana, ATPase is for turning ATPase Arabidopis thaliana, as seen from the figure, T3 cultivates being added with on the antibiotic substratum of Totomycin for plant, what do not occur separation is the positive plant overexpression strain of isozygotying, obtained the positive T3 of two overexpressions for turning ATPase Arabidopis thaliana strain, be respectively ATP8 and ATPase11.
5) turning ATPase Arabidopis thaliana sxemiquantitative RT-PCR identifies
Extract respectively wild-type (col) and be numbered ATP8 and the positive T3 of ATPase11 generation turns ATPase Arabidopis thaliana homozygote (take the whole plant of the wild-type of growing 7 days on MS substratum and two homozygous lines as material, take respectively 0.15g extract RNA) RNA, reverse transcription obtains cDNA as template, take ATPase 2_F, ATPase 2_R as primer, take the actin of Arabidopis thaliana as internal reference, internal reference primer is ActinF CTACGAGCAGGAACTCGAGA; ActinR GATGGACCTGACTCGTCATAC, carry out RT-PCR, using wild-type Arabidopis thaliana as negative control, result as shown in Figure 7, wherein, col is wild-type Arabidopis thaliana, can find out, in the positive T3 generation that is numbered ATP8 and ATPase11, turns the fragment that all has 462bp in ATPase Arabidopis thaliana, further proves, ATPase is expressed, and the positive T3 generation obtaining turns ATPase Arabidopis thaliana.
Adopt and use the same method, empty carrier pCPAE2 is proceeded in wild-type tobacco, obtain T0 for turning empty carrier Arabidopis thaliana, extract the RNA that T0 generation turns empty carrier Arabidopis thaliana, reverse transcription obtains cDNA as template, take ATPase 2_F, ATPase 2_R as primer, do not obtain object fragment, illustrate that obtaining T0 generation turns empty carrier Arabidopis thaliana, in results T0 generation, turns the seed of empty carrier Arabidopis thaliana, sowing, continues to go down to posterity, and obtains T4 for turning empty carrier Arabidopis thaliana.
2, turn the functional study of ATPase Arabidopis thaliana
1) phenotype analytical
In the positive T4 generation that 3 weeks seedling ages are numbered to ATP8 and ATPase11, turns ATPase (homozygote) and wild-type Arabidopis thaliana at 22 ℃, under the normal culture condition of 16h/8h, grow after 3 weeks, be placed in 4 ℃, 16h illumination/8h dark condition, grow after 28 days, then be placed in 22 ℃, 16h illumination/8h dark, recover growth 7 days, turn empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana as contrast take T4 generation.
Observe phenotype, result as shown in Figure 8, wherein, A turns 22 ℃ under normal operation of ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thalianas (col) the positive T4 generation of ATPase11, the result of growing 3 weeks under 16h/8h illumination condition, B turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) the positive T4 generation of ATPase11 at 4 ℃, 16h illumination/8h dark condition growth result of 3 days, C turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) the positive T4 generation of ATPase11 at 4 ℃, 16h illumination/8h dark condition growth result of 7 days, D turns ATPase (ATPase overexpression isozygoty drag for be 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) the positive T4 generation of ATPase11 at 4 ℃, 16h illumination/8h dark condition growth result of 14 days, E is that the positive T4 generation of ATPase11 turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) is placed in 22 ℃ again, 16h illumination/8h dark, recover the growth result of 7 days, can find out, in A, under normal operation, the positive T4 generation of ATPase11 in, turns ATPase (ATPase overexpression homozygous lines 11) Arabidopis thaliana (ATP) and wild-type Arabidopis thaliana (col) is grown without significant difference, in B, wild-type Arabidopis thaliana (col) and overexpression strain subzero treatment after 3 days difference not too remarkable, but wild-type is short and small compared with overexpression strain.In C and D, wild-type Arabidopis thaliana (col) is along with the deepfreeze time increases, the phenotype of cold damage is also aggravated, blade is dispirited, plant is short and small, and the positive T4 generation of ATPase11 turns ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP) and after 4 ℃ of subzero treatment, grows still good.In E, after renewal cultivation, wild-type Arabidopis thaliana (col) is placed under normal temps again and cultivates after deepfreeze is subject to injury from low temperature, still can not return to normal growth conditions, the subzero treatment that illustrates 4 ℃ is visible to the injury of tobacco, and the positive T4 generation of ATPase11 in, turns after ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP) recovery growth, plant can continue normal growth and grow, and does not show the injury proterties that any low temperature causes.
Process after 7 days for 4 ℃, each strain is got 20 strains and is surveyed its survival rate, test results averaged in triplicate, statistical study is used SPSS-Oneway (Duncan) method, ATPase overexpression homozygous lines 11 survival rates are 72%, standard is mistaken for 0.72 ± 0.009866, and the survival rate of wild-type Arabidopis thaliana (col) is 15%, and standard is mistaken for 0.15 ± 0.006083.
The result that T4 generation turns empty carrier Arabidopis thaliana and wild-type Arabidopis thaliana is without significant difference.
2) mensuration of Arabidopis thaliana physical signs
In order further to confirm the cold tolerance of transfer-gen plant, measure transfer-gen plant cytoplasmic membrane property physical signs relatively thoroughly.
In detect ATPase11 positive T4 generation, turns ATPase (ATPase overexpression homozygous lines) Arabidopis thaliana (ATP) membrane permeability, turns empty carrier Arabidopis thaliana as contrast take wild-type Arabidopis thaliana and T4 generation.Each strain 10 strains, test results averaged in triplicate.
The mensuration of the relatively saturating property of cytoplasmic membrane is with reference to the method (Li Jinshu of Li Jinshu, Wang Hongchun, Wang Wenying, Zhu Yafang Effect of drought on the permeability and membrane lipid composition from maiz e leaves the 09th phase of plant physiology journal nineteen eighty-three), measure and get second climax leaves with DDS-11C conductivity meter type conductivity meter, first with distillation washing blade, using deionized water rinsing, then get 5 of disks with the punch tool of diameter 0.cm, be placed in the test tube of containing 10ml distilled water, under room temperature, leave standstill 2h, then survey transudate electric conductivity value S1 with conductivity meter, then test tube is placed in to boiling water bath 20min, kill tissues, after being cooled to room temperature, survey its electric conductivity value S2 with aforesaid method again, represent blade cell plasma membrane property (S1/S2) relatively thoroughly with relative conductivity (%), measure and repeat 5 times.
Result as shown in Figure 9,
Before 4 ℃ of processing, the value that the positive T4 generation of ATPase11 turns the membrane permeability of ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines) is 12.27%, and the value of the membrane permeability of wild-type Arabidopis thaliana is 13.66%
Process after 28 days for 4 ℃, the value that the positive T4 generation of ATPase11 turns ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines) membrane permeability is 38.19%, and the value of wild-type Arabidopis thaliana membrane permeability is 62.08%
After 4 ℃ of processing, recover after 7 days, the value that the positive T4 generation of ATPase11 turns the membrane permeability of ATPase Arabidopis thaliana (ATP) (ATPase overexpression homozygous lines) is that 25.78%, T4 is 55.42% for the value of the membrane permeability that turns empty carrier Arabidopis thaliana.
As seen from the figure, it is the same substantially that the membrane permeability of wild-type Arabidopis thaliana turns ATPase Arabidopis thaliana (ATPase overexpression homozygous lines) with the positive T4 generation of ATPase11 before deepfreeze, and along with the lengthening of freezing time, the membrane permeability that the positive T4 generation of wild-type Arabidopis thaliana and ATPase11 turns ATPase Arabidopis thaliana (overexpression homozygous lines) starts to have obvious difference, and along with the lengthening of deepfreeze time, the difference of two groups of Arabidopis thalianas is larger, it is more effective than wild-type Arabidopis thaliana to the resistance of low temperature that the positive T4 generation of this illustrative experiment group ATPase11 in, turns ATPase Arabidopis thaliana (overexpression homozygous lines) plant.
In wild-type Arabidopis thaliana and T4 generation, turn empty carrier Arabidopis thaliana result without significant difference.
Can determine thus, this new gene of the ATPase finding in Antarctic Fish body has certain function keeping out the cold really, and to improving the cold-resistant quality of plant, there is important realistic meaning the aspect that improves its opposing natural low temperature disaster.
Claims (5)
1. cultivating a method for transgenic plant, is that the encoding gene of ATPase albumen is imported in object plant, obtains the transgenic plant of resistance of reverse higher than described object plant;
The aminoacid sequence of described ATPase albumen is the sequence 2 in sequence table;
Described resistance of reverse is winter hardiness;
Described object plant is tobacco or Arabidopis thaliana;
Described object plant is tobacco, and the encoding gene of described ATPase albumen imports in tobacco by following recombinant vectors A;
Described recombinant vectors A inserts the encoding gene of described ATPase albumen in pCPAE2 carrier, expresses the recombinant vectors of described encoding gene;
Described object plant is Arabidopis thaliana, and the encoding gene of described ATPase albumen imports in Arabidopis thaliana by following recombinant vectors B;
Described recombinant vectors B inserts the encoding gene of described ATPase albumen in pHQSN carrier, expresses the recombinant vectors of described encoding gene.
2. the method for claim 1, is characterized in that:
The nucleotides sequence of the encoding gene of described ATPase albumen is classified the sequence 1 in sequence table as.
3. method as claimed in claim 1 or 2, is characterized in that: described in turn ATPase gene plant winter hardiness by increasing plant height, improve survival rate and/or reduce cytoplasmic membrane relatively thoroughly property embody.
4. the albumen of ATPase described in claim 1 is in the application of cultivating in resistance of reverse transgenic plant;
Described resistance of reverse is winter hardiness;
Described plant is Arabidopis thaliana or tobacco.
5. the encoding gene of the albumen of ATPase described in claim 2 is in the application of cultivating in resistance of reverse transgenic plant;
Described resistance of reverse is winter hardiness;
Described plant is Arabidopis thaliana or tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110242917.9A CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110242917.9A CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952816A CN102952816A (en) | 2013-03-06 |
| CN102952816B true CN102952816B (en) | 2014-05-14 |
Family
ID=47762202
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110242917.9A Expired - Fee Related CN102952816B (en) | 2011-08-23 | 2011-08-23 | Application of ATPase proteins in stress tolerance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952816B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382476B (en) * | 2013-06-06 | 2015-04-08 | 江苏省农业科学院 | Application of cotton P-type ATPase gene Gbpatp capable of endowing plants with cold tolerance |
| CN105189741B (en) * | 2013-06-24 | 2018-03-16 | 创世纪种业有限公司 | A kind of cotton ATP hydrolase As TPase 2 and its encoding gene and application |
| CN105073984B (en) * | 2013-06-24 | 2017-11-10 | 创世纪种业有限公司 | A kind of cotton ATP hydrolase As TPase 1 and its encoding gene and application |
| CN105543269B (en) * | 2015-11-03 | 2019-09-20 | 西南大学 | Plant is improved to the method for resistance to verticillium wilt using beauveria bassiana BbP4-ATPase gene |
| CN105543268B (en) * | 2015-11-03 | 2019-09-06 | 西南大学 | Plant is improved to the method for resistance to verticillium wilt using verticillium wilt pathogen VdP4-ATPase gene |
| CN106397559B (en) * | 2016-09-05 | 2019-07-19 | 黑龙江八一农垦大学 | A kind of and plant carbonate stress tolerance GAP-associated protein GAP GsHA16 and its encoding gene and application |
| CN109867715B (en) * | 2019-02-28 | 2022-06-17 | 中国科学院昆明植物研究所 | Application of chloroplast protein and ATPase enzymatic activity mutant in improvement of stress resistance of plants |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR037699A1 (en) * | 2001-12-04 | 2004-12-01 | Monsanto Technology Llc | TRANSGENIC CORN WITH IMPROVED PHENOTYPE |
| CN101402679B (en) * | 2008-11-13 | 2012-01-25 | 中国科学院遗传与发育生物学研究所 | Coldproof protein, encoding gene and uses thereof |
-
2011
- 2011-08-23 CN CN201110242917.9A patent/CN102952816B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952816A (en) | 2013-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102952816B (en) | Application of ATPase proteins in stress tolerance of plants | |
| CN105254726B (en) | ERF class transcription factor relevant to plant stress-resistance and its encoding gene and application | |
| CN1833025A (en) | EPSP synzyme of high anti-cancrinia discoidea and its coding squence | |
| CN104327173B (en) | A kind of cotton WRKY transcription factors GarWRKY22 of regulation and control plant salt endurance and application | |
| CN105838726B (en) | A kind of Salt Tolerance Gene in Alfalfa gene M sCDPK and its coding albumen and application | |
| CN111154800A (en) | Application of rice OsRNCR gene and encoding protein thereof in enhancing salt tolerance of plants | |
| CN102719449A (en) | Clone of apple resistance-related gene MdSIMYB1 and application thereof | |
| CN104725496A (en) | Gossypium aridum WRKY transcription factor GarWRKY9 for regulating blossoming of plant and application | |
| CN102653763A (en) | Meloidogyne javanica dominant-effect gene (Mj-nulg), related protein and application of Mj-nulg | |
| CN101880674A (en) | Date tree aquaporin gene and application in improvement on plant drought resistance and salt resistance | |
| CN101503693B (en) | Halimodendron halodendron ERF transcription factor cDNA sequence, expression vector and use thereof | |
| CN106191001A (en) | The application in improving plant salt endurance of phospholipase PLD ζ 1 gene | |
| CN105177001A (en) | MiR167d related to barley powdery mildew resistance and application thereof | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN107663232A (en) | Plant anti-adversity associated protein OsIAA18 and its encoding gene and application | |
| CN110358774B (en) | Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time | |
| CN102417911B (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN104120134B (en) | The application in cultivating resistance of reverse transgenic plant of the GsHSFB2b albumen | |
| CN110396125B (en) | Application of arabidopsis transcription factor gene PIF3 in insect stress resistance of plants | |
| CN102633869B (en) | Low temperature resistance associated protein and encoding gene and application thereof | |
| CN105753955A (en) | Soybean bHLH transcription factor and encoding gene and application thereof | |
| CN112522289A (en) | Upland cotton diacylglycerol kinase gene GhDGK7b and application thereof | |
| CN104098662A (en) | Rice drought resistance related protein, coding gene and application thereof | |
| CN103319584A (en) | Bruguiear gymnorrhiza (L.) Lam ERF transcription factor cDNA sequence, its expression vector and application | |
| CN115029355B (en) | Peanut C2 structural domain protein coding gene AhSRC2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140514 Termination date: 20180823 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |