CN102653763A - Meloidogyne javanica dominant-effect gene (Mj-nulg), related protein and application of Mj-nulg - Google Patents

Abstract

The invention discloses a meloidogyne javanica dominant-effect gene (Mj-nulg), a related protein and application of the Mj-nulg, and belongs to the technical field of biological gene engineering. The nucleotide sequence of the Mj-nulg is shown in SEQ ID NO: 1-3, and the amino acid sequence of the related Mj-NULG protein is shown in SEQ ID NO: 4. According to the invention, a qPCR (Real-time Quantitative Polymerase Chain Reaction Detecting System) is used for studying the expression conditions of the gene in the different stages of nematode; an immune positioning method is utilized to prove that the Mj-NULG protein exists in the dorsal esophageal gland of the nematode, is secreted in a plant cell, and is positioned on nucleus; when a designed gene overexpression vector of the gene is transformed in arabidopsis, the transgenic arabidopsis is easier to be infected with the meloidogyne; and a designed RNAi (Ribonucleic Acid Interference) vector induced and reorganized from virus is introduced in a plant to generate ds (double-strand) RNA of the Mj-nulg in the plant, and thus the plant can obviously inhibit the parasitism of the meloidogyne. The Mj-nulg can be used for obtaining the plant with the strong meloidogyne resistance.

Description

A kind of javanese root knot nematode effector Mj-nulg, GAP-associated protein GAP and application

Technical field

The invention belongs to technical field of biological genetic engineering, be specifically related to a kind of javanese root knot nematode effector Mj-nulg, GAP-associated protein GAP and application.

Background technology

Root knot nematode is one type of very important plant nematode, is distributed widely in all over the world, can infect to surpass 3000 kinds of different plants.Root knot nematode is caused general 77,000,000,000 dollars financial loss every year, and along with the raising of crop multiple crop index and the development of industrialized agriculture, generation of root knot nematode and harm will constantly aggravate.Because the root endoparasitism of root knot nematode, the host range shortage of characteristic and anti-root knot nematode germ plasm resource have widely limited chemical prevention, crop rotation and breeding for disease resistance etc. and have prevented and treated the application of method in the harm of control root knot nematode.Therefore, the method for seeking other effectively preventing root knot nematodes is the challenge that plant production faces for a long time.

The appearance of RNA perturbation technique (RNAi) makes the method for the more efficiently control of exploitation root knot nematode become possibility.RNAi can suppress that root knot nematode specific gene function limits that root knot nematode is infected through target, parasitic and breeding thereby can reduce the harm of root knot nematode efficiently and safer to other non-target organisms.The RNAi phenomenon is found in beautiful rhabditis axei, in plant, invertebrates and vertebrates, has all found this phenomenon subsequently in succession.RNAi technology is through the specific degraded said target mrna of dsRNA, influences or suppresses this goal gene function, thereby influence growth, growth, the breeding of this kind biology even can kill this kind biology.Other great advantage of preventing and treating method of this compared with techniques are directive action can not influence the other biological in this habitat in certain specific (certain type) insect.

Gene silencing (VIGS) technology of using agriculture bacillus mediated virus induction obtains the RNAi transfer-gen plant more simply fast with respect to traditional using-system cultural method, makes us need just can not obtain the nematicide plant fast through the tissue culture method of complicacy.

Summary of the invention

The object of the present invention is to provide a kind of new javanese root knot nematode effector Mj-nulg

Another object of the present invention provides above-mentioned javanese root knot nematode effector Mj-nulgGAP-associated protein GAP MJ-NULG.

Another purpose of the present invention provides above-mentioned javanese root knot nematode effector Mj-nulgApplication.

The present invention realizes above-mentioned purpose through following technical scheme:

A kind of javanese root knot nematode ( Meloidogyne javanica) effector Mj-nulg, its nucleotide sequence is shown in any one of SEQ ID NO:1 ~ 3.Wherein SEQ ID NO:1 is complete genome sequence (comprising 5 ' end non-coding region, 3 ' end non-coding region, intron and exon); SEQ ID NO:2 is coding region sequence (comprising intron and exon); SEQ ID NO:3 is encoding sequence (is the cDNA sequence, is merely exon).

Under stringent condition with above-mentioned javanese root knot nematode effector Mj-nulgThe dna molecular of the parasitic GAP-associated protein GAP of hybridization and coding and javanese root knot nematode is perhaps with above-mentioned javanese root knot nematode effector Mj-nulgThe dna molecular that 90% above homology and the parasitic GAP-associated protein GAP of coding root knot nematode are arranged is also within protection scope of the present invention.Said stringent condition is: can be in the solution of 0.1 * SSC, 0.1% SDS, and hybridization and wash film under 65 ℃ of conditions.

A kind of javanese root knot nematode effect protein MJ-NULG; Its aminoacid sequence is shown in SEQ ID NO:4, or this aminoacid sequence is through replacement and/or disappearance and/or the interpolation and the derived protein parasitic relevant with javanese root knot nematode of one or more amino-acid residues.

Be convenient to purifying in order to make javanese root knot nematode effect protein MJ-NULG; Can connect upward specific label at the N-terminal or the C-terminal of this sequence (SEQ ID NO:4); Said specific label is 5 ~ 6 l-arginine, or 2 ~ 12 Histidines, or shown in SEQ ID NO:5 sequence; Or shown in SEQ ID NO:6 sequence, or shown in SEQ ID NO:7 sequence.Like table 1, but be not limited to table 1:

Table 1 sequence label

Label	Residue quantity	Sequence
			Poly-Arg	5-6 (often being 5)	RRRRR
Poly-His	2-12 (often being 6)	HHHHHH
			FLAG	8	DYKDDDK（SEQ ID NO:5）
Strep-TagⅡ	8	WSHPQFEK（SEQ ID NO:6）
			c-myc	10	EQKLISEEDL（SEQ ID NO:7）

Above-mentioned albumen can synthetic, also can synthesize its encoding sox earlier, carries out biology again and expresses and obtain.

A kind of recombinant expression vector is that the MCS by the carrier that sets out inserts above-mentioned javanese root knot nematode effector Mj-nulg, or the part exon fragment of this gene forms like sequence construct shown in SEQ ID NO:8 ~ 10 are arbitrary.Wherein SEQ ID NO:8 does Mj-nulgThe the 369th to 691 nucleotide sequence of complete genome sequence (SEQ ID NO:1), SEQ ID NO:9 is the 951st to 1305 nucleotide sequence, SEQ ID NO:10 is the 1712nd to 1852 nucleotide sequence.

The carrier that sets out of above-mentioned expression vector can be general expression vector or RNAi carrier, can select as required.For the preparation disease resistance transgenic plant, carrier pTRV2 is more excellent, and this carrier is a kind of plant RNA i carrier, will contain the javanese root knot nematode effector Mj-nulgThis RNAi carrier import plant; Can in plant, produce the dsRNA of said gene, after root knot nematode was infected this plant, dsRNA got in the body of root knot nematode; Make the mRNA degraded of said gene; Cause the inactivation of said gene, the serious parasitic ability that has weakened nematode, thus suppress the infecting of nematode, parasitic, breeding and propagate.

For containing above-mentioned javanese root knot nematode effector Mj-nulgRecombinant gene expression box, transgenic cell line or reorganization bacterium, also belong to protection scope of the present invention.

Above-mentioned javanese root knot nematode effector Mj-nulgIn the application of preparation in the transgenic plant, the purpose plant optimization of said transgenic plant is dicotyledons or monocotyledons, especially tomato, like the tomato summer red No. 1.

As an aspect of above-mentioned application, can be with containing the javanese root knot nematode effector Mj-nulgRecombinant expression vector utilize Agrobacterium to be directed in the purpose plant; Perhaps through using conventional biological method transformed plant cells or tissues such as Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity importing or particle gun; And the plant transformed tissue cultivating become plant, obtain the transgenic plant of anti-root knot nematode.

Compared with prior art, the present invention has following beneficial effect:

The invention provides a kind of new help improving active gene order of the anti-root knot nematode of plant and proteins encoded thereof, have the new variety of plant of wide spectrum pest-resistant property to lay the foundation for further cultivating.

Description of drawings

Fig. 1 is the segmental electrophoresis result that 3 ' RACE amplification obtains; 3 is the electrophoresis result of 3 ' RACE; M is a molecular weight marker.

Fig. 2 is the segmental electrophoresis result that 5 ' RACE amplification obtains; 3 is the electrophoresis result of 5 ' RACE; M is a molecular weight marker.

Fig. 3 is amplification Mj-nulgThe electrophoresis result of gene; 3 are amplification Mj-nulgThe electrophoresis result of gene; M is a molecular weight marker.

Fig. 4 is the javanese root knot nematode different developmental phases Mj-nulgThe relative expression quantity of gene.

Fig. 5 is MJ-NULG albumen tissue positioned in javanese root knot nematode.A: be preinfective second instar larvae, B: for infecting the stage third-instar larvae, C:, do not add antiserum(antisera) for contrast.DG: expression back of the body esophageal gland cell.

Fig. 6 is for using the proteic secretion situation of immunolocalization technical study MJ-NULG.A: root knot nematode is infected the root knot section after 5 days; B: for root knot nematode is infected the root knot section after 10 days, C: for root knot nematode is infected the root knot section after 10 days, D cuts into slices for the root knot that infects for root knot nematode after 21 days; E: for root knot nematode is infected the root knot section after 10 days; What add is the non-immune antiserum(antisera) of contrast, F: infect the root knot section after 10 days for root knot nematode, do not do any processing.

Fig. 7 is a pBI121-nulg carrier synoptic diagram.

Fig. 8 is a pTRV2-nulg carrier synoptic diagram.

Fig. 9 is for expressing the plant of pTRV2-nulg carrier, with the experiment of the anti-root knot nematode capacity variance of control group plant.

Embodiment

Further explain the present invention through embodiment below, but the present invention is not done any type of qualification.Do not have specified otherwise among the embodiment, be this area normal experiment method; Used experiment material is like no specified otherwise, all available from routine biochemistry reagent shop.Quantitative experiment all is provided with three repetitions, results averaged among the embodiment.

Biological material source is following:

Red No. one of the tomato summer: purchase development in science and technology ltd in Agricultural University Of South China;

Javanese root knot nematode: gather reference: Hu M, X., Zhuo, K., Liao, J, L. Multiplex PCR for the simultaneous identification and detection of voluntarily Meloidogyne incognita, M. enterolobiiAnd M. javanicaUsing DNA extracted directly from individual galls. Phytopathology, 2011,101 (11): 1270-1277.

Following biomaterial obtains for the contriver receives:

Arabidopis thaliana gram rival is inferior environmental: reference: Ye Qing, and Hou Zhihui, Liu Jing, etc. H ₂O ₂Mediation H ₂S inductive Arabidopis thaliana stomatal closure. plant physiology journal, 2011,47 (12): 1195-1200.

Carrier pTRV1 and carrier pTRV2: reference: Dubreuil; G.; M. Magliano, M. P. Dubrana, et al. Tobacco rattle virus mediates gene silencing in a plant parasitic root-knot nematode. Journal of Experimental Botany; 2009,60 (14): 4041-4050.

Vector pBI121: References: Wang Xin, Cao tree to Xun, et al. PBI121 Expression vector and its rapid identification of transformed plants. Zhejiang University ( Agriculture and Life Sciences), 2008,34 (2): 137 -142.

Agrobacterium tumefaciens EHA105: reference: Ryu; C. M.; A. Anand, L. Kang, et al. Agrodrench:a novel and effective agroinoculation method for virus-induced gene silencing in roots and diverse Solanaceous species. Plant Journal; 2004,40 (2): 322-331.

The above biomaterial public can obtain from the applicant.

The clone of embodiment 1 javanese root knot nematode MJ-NULG albumen and encoding sox thereof

(1) this laboratory is used and is suppressed the method that difference subtracts hybridization (SSH), from javanese root knot nematode, has obtained a collection of est sequence that expression amount obviously increases than the expression amount of ovum in second instar larvae.The contriver has selected an est sequence that only appears in the Meloidogyne to clone through the homology of the gene found in the more above-mentioned est sequence of BLASTN program on the NCBI and other species.

(2) use the TRIZOL method to extract javanese root knot nematode second instar larvae RNA, use Clontech RACE test kit that the RNA reverse transcription is cDNA then.

The segmental acquisition of (3) 3 ' RACE: use primer right, D153R2:GTTGAGGAAGAGACCCGTGAGAA, the anchor primer NUP of (SEQ ID NO:11) and Clontech RACE test kit, the cDNA that obtains with step (2) is that template increases.Pcr amplification system: cDNA 2 μ L, two each 3 μ L of primer, 10 * KOD plus Buffer, 5 μ L, MgSO ₄2 μ L, dNTP 5 μ L, KOD plus DNA polymerase 1 μ L, ddH ₂O 34 μ L.Pcr amplification program: 94 ℃ of 3min, 30 * (94 ℃ of 30s, 66 ℃ of 30s, 68 ℃ of 2min), 68 ℃ of 5min, 20 ℃ of preservations.Agarose electrophoresis detects amplification, sees Fig. 1.

The segmental acquisition of (4) 5 ' RACE: use primer right, D155R2:CTTTTCACGTTCATCAGCACCAG, the anchor primer NUP of (SEQ ID NO:12) and Clontech RACE test kit, the cDNA that obtains with step (2) is that template increases.Pcr amplification system: cDNA 2 μ L, two each 3 μ L of primer, 10 * KOD plus Buffer, 5 μ L, MgSO ₄2 μ L, dNTP 5 μ L, KOD plus DNA polymerase 1 μ L, ddH ₂O 34 μ L.The pcr amplification program is with (3), 20 ℃ of preservations.Agarose electrophoresis detects amplification, sees Fig. 2.

(5) the EST fragment that 3 ' RACE fragment, 5 ' RACE fragment and SSH is obtained is spliced the back and is obtained Mj-nulgFull length gene, re-use primer D15cdsF:ATGAAAACCTCAGTGTTGTGCCTAT (SEQ ID NO:13) and D15cdsR:TTAATGGCCCTTTCCTTTAGATTCTA (SEQ ID NO:14) increased, checking sequence exactness.The pcr amplification program is with (3).The result sees Fig. 3, and the sequence that the order-checking back obtains is shown in SEQ ID NO:1 in the sequence table, and called after Mj-nulg, the albumen called after MJ-NULG of this genes encoding is shown in SEQ ID NO:4 in the sequence table sequence.

Embodiment 2 Mj-nulgGene is at the expression analysis of javanese root knot nematode different developmental phases

(1) uses the TRIZOL method to extract the RNA of the javanese root knot nematode of different developmental phases, and be cDNA the RNA reverse transcription.

(2) use primer qD15AF:AAAGAAAAACGTACAGAAAAGACCA (SEQ ID NO:15) and qD15AR:AACTTCCTCAACAGGTTTCTTCTCT (SEQ ID NO:16) right Mj-nulgCarry out the quantitative fluorescent PCR analysis, with javanese root knot nematode β-actinGene is confidential reference items, and primer is qactinF:GACGGTCAAGTTATTACTGTGGAAA (SEQ ID NO:17) and qactinR:GTAAAGGTCTTTACGGATGTCTATG (SEQ ID NO:18).Reaction conditions: 94 ℃ of 30s, 40 * (94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 1min).The result sees Fig. 4.

Fig. 4 result shows, Mj-nulgExpression amount was the highest when gene infected back second instar larvae (infecting tomato after 5 days) at javanese root knot nematode, and this is consistent with coding root knot nematode effect protein expression of gene pattern.Prove that this gene plays a significant role in the parasitism of javanese root knot nematode.

The tissue positioned of embodiment 3 MJ-NULG albumen in javanese root knot nematode

Ordinary method prepares MJ-NULG albumen, and immunize rabbit prepares antiserum(antisera), detects the location of this albumen in tissue.Concrete steps are following:

(1) the MJ-NULG albumen that uses purifying is gathered antiserum(antisera) as the antigen immune new zealand rabbit after 40 days.

(2) the javanese root knot nematode second instar larvae of the fresh hatching of collection and the third-instar larvae that colonizes in the root after the aqua sterilisa cleaning many times, added 4% formaldehyde fixed 24 hours.

(3), add 5% BSA and handled 30 minutes for 37 ℃ with after the aqua sterilisa cleaning many times.

(4) add the MJ-NULG antiserum(antisera), control group then adds non-immune antiserum(antisera), handles 16 hours for 4 ℃.

(5), add the anti-rabbit igg antibody of HRP mark, room temperature treatment 1 hour with after the aqua sterilisa cleaning many times.

(6) with after the aqua sterilisa cleaning many times, add HRP colour developing liquid, dark left standstill after 10 minutes observes result such as Fig. 5.

Fig. 5 result shows that MJ-NULG albumen is expressed in the back of the body esophageal gland of javanese root knot nematode, this tissue expression pattern with other root knot nematode effect protein genes is consistent.Further specifying this gene plays a significant role in the parasitism of javanese root knot nematode.

Proteic secretion of embodiment 4 MJ-NULG and location situation

(1) the MJ-NULG albumen that uses purifying is gathered antiserum(antisera) as the antigen immune new zealand rabbit after 40 days.

(2) collect the javanese root knot nematode second instar larvae of fresh hatching and be inoculated into the tomato seedling root, treat that elegans development arrives respective stage and collects the root knot, after cleaning with aqua sterilisa, add 4% formaldehyde fixed.

(3) use alcohol to carry out the gradient dehydration, and with paraffin embedding under 65 ℃ of conditions.Be made into 5 microns slabs then.

(4) after microscopically is observed and found out suitable section, carry out dewaxing treatment.

(5) adding 5% BSA then handled 30 minutes for 37 ℃.

(6) add the MJ-NULG antiserum(antisera), control group then adds non-immune antiserum(antisera), handles 16 hours for 4 ℃.

(7), add the anti-rabbit igg antibody of HRP mark, room temperature treatment 1 hour with after the aqua sterilisa cleaning many times.

(8) with after the aqua sterilisa cleaning many times, add HRP colour developing liquid, dark left standstill after 10 minutes observes result such as Fig. 5.

Fig. 6 result shows that MJ-NULG albumen can be secreted in the vegetable cell by javanese root knot nematode, and is positioned the nucleus of vegetable cell.Explain that this albumen acts on plant nucleolus and the successful parasitism of root knot nematode is played an important role.

Embodiment 5 Mj-nulgThe effect of gene in the javanese root knot nematode parasitism

(1) uses the TRIZOL method to extract javanese root knot nematode second instar larvae RNA, and be cDNA the RNA reverse transcription.

(2) use primer to D15nsFbam: Cgcggatcc(SEQ ID NO:19, italics are restriction enzyme site to ATGGATGATAAAGAAGTTGAGAAGCATAA BamH I)/D15cdsRsac: Cgagctc(SEQ ID NO:20, italics are restriction enzyme site to TTAATGGATGATAAAGAAGTTGAGAAGCATAA SacI) carry out pcr amplification, the pcr amplification program: 94 ℃ of 3min, 30 * (94 ℃ of 30s, 60 ℃ of 30s, 68 ℃ of 2min), 68 ℃ of 5min.The PCR product that obtains is used restriction enzyme SalI with SphI carries out enzyme and cuts, and purifying and recovering.

(3) use restriction enzyme simultaneously BamH I with SacThe I enzyme is cut carrier pBI121, and purifying and recovering.

(4) (2) are connected with the product that (3) obtain, obtain recombinant expression vector pBI121-nulg.According to sequencing result, it is following that recombinant expression vector pBI121-nulg is carried out structrual description: skeleton is pBI121, at skeleton carrier BamH I with SacInserted double chain DNA fragment A (from the dna molecular shown in 5 ' end the 58th to 825 Nucleotide of sequence SEQ ID NO:3) between the I restriction enzyme site, like Fig. 7.And carrier pBI121-nulg is transformed agrobacterium tumefaciens EHA105 obtain the Agrobacterium of recombinating.

(5) the environmental Arabidopis thaliana of Colombia is seeded on the sterilization soil.After 45 days, treat that Arabidopis thaliana grows inflorescence after, the Agrobacterium of will recombinating is used 0.01M KH ₂PO ₄Be inoculated into the Arabidopis thaliana inflorescence after resuspension and the mixing.After the normal cultured 30 days, collect seed.

(6) the described seed of step (5) is carried out surface sterilization after, be seeded in 0.5 * MS substratum and screen (having added 500mg/L Pyocianil and 25mg/L HYG in the substratum).

(7) the Arabidopis thaliana plantlet of transplant that can in the MS substratum described in the step (6), grow is cultivated in sterilization soil, gathers in the crops seed then.

(8) the described seed of step (7) is carried out succeeding transfer culture to T3 generation, get the conversion system of isozygotying and experimentize.

(9) the said plant of step (8), every plant inoculates about 500 javanese root knot nematode second instar larvaes.After the inoculation, maintain the temperature between 23 ℃-26 ℃, calculate the quantity of ripe female worm, root knot after 42 days.Experiment is carried out three times and is repeated results averaged.The result sees table 2.

Table 2 is respectively organized parasitic exponential statistics

	The wild-type Arabidopis thaliana	Conversion is 1 Arabidopis thaliana	Conversion is 2 Arabidopis thalianas
				Investigation strain number	45	47	42
Ripe female borer population (bar/strain)	27±0.6a	45±2.6b	52±3b
				Root footing (individual/strain)	20±1.7a	42±3.4b	40±2.1b

Annotate: data are MV ± standard error in the table, in the table among the same index colleague lowercase difference person differential different remarkable ( p<0.05, Duncan ' s method)

Table 2 is the result show, expresses javanese root knot nematode Mj-nulgThe Arabidopis thaliana strain system of gene, ripe female worm, root knot and quantity and wild-type Arabidopis thaliana significantly increase on every strain plant, explain that this gene can strengthen the susceptibility of javanese root knot nematode, further specify this gene and in the root knot nematode parasitism, play an important role.

Embodiment 6 Mj-nulgThe application of gene in cultivating anti-root knot nematode plant

(1) uses the TRIZOL method to extract javanese root knot nematode RNA, and be cDNA the RNA reverse transcription.

(2) use primer to D15RNAiF3: Cgagctcg(SEQ ID NO:21, italics are restriction enzyme site to GAAAACCTCAGTGTTGTGCCTAT SacI)/D15RNAiR322: CtagtctagaTTTCATCAGAAACTTCCTCAACAGG (, SEQ ID NO:22, italics are restriction enzyme site XbaI) carry out pcr amplification, the pcr amplification program: 94 ℃ of 3min, 30 * (94 ℃ of 30s, 60 ℃ of 30s, 68 ℃ of 1min), 68 ℃ of 5min.The PCR product that obtains is used restriction enzyme SacI with XbaI carries out enzyme and cuts, and purifying and recovering.

(3) use restriction enzyme simultaneously SacI with XbaThe I enzyme is cut carrier pTRV2, and purifying and recovering.

(4) (2) are connected with the product that (3) obtain, obtain recombinant expression vector pTRV2-nulg.According to sequencing result, it is following that recombinant expression vector pTRV2-nulg is carried out structrual description: skeleton is pTRV2, at skeleton carrier XbaI with SacInserted double chain DNA fragment B (from the dna molecular shown in 5 ' end the 3rd to 322 Nucleotide of sequence SEQ ID NO:3) between the I restriction enzyme site, like Fig. 8.

(5) carrier pTRV1 (RNA polymerase 1 of coding TRV virus, institute is necessary for the virus infection plant) is transformed agrobacterium tumefaciens EHA105 to reorganization Agrobacterium A.

(6) carrier pTRV2-nulg is transformed the agrobacterium tumefaciens EHA105 Agrobacterium B that obtains recombinating, carrier pTRV2 is transformed agrobacterium tumefaciens EHA105 obtain contrasting Agrobacterium.

(7) a red seed of tomato summer is carried out being seeded in the silty loam of sterilization after the surface sterilization.After 14 days, seedling grows the 4th or the 5th true leaf; Agrobacterium A, B use 0.01M KH will recombinate ₂PO ₄Be inoculated into the root of seedling after resuspension and the mixing.Grow after 21 days, get the blade that newly grows and detect.

(8) treatment process of control group A is said with (7), but replaces reorganization Agrobacterium B to the contrast Agrobacterium.Control group B does not then inoculate Agrobacterium bacterium liquid.

(9) step (6), (7) and (8) described plant, every plant inoculates about 200 javanese root knot nematode second instar larvaes.After the inoculation, maintain the temperature between 23 ℃-26 ℃, calculate the quantity of ripe female worm, root knot and ovum after 42 days.Experiment is carried out three times and is repeated results averaged.The result sees table 3.

Table 3 is respectively organized parasitic exponential statistics

	The experimental group tomato	Contrast A group tomato	Contrast B group tomato
				Investigation strain number	37	32	38
Ripe female borer population (bar/strain)	24.7±5.4a	158.3±32b	154.6±17b
				Root footing (individual/strain)	12.7±8a	90±14b	94±27b
Ovum number (individual/strain)	70±3a	1140±205b	820±174b

Annotate: data are MV ± standard error in the table, in the table among the same index colleague lowercase difference person differential different remarkable ( p<0.05, Duncan ' s method)

Table 3 and shown in Figure 9 showing, the expression silencing javanese root knot nematode Mj-nulgBehind the gene, can reduce the quantity of ripe female worm on every strain plant, root knot and ovum significantly, promptly reticent Mj-nulgBehind the gene, can suppress the parasitic ability ability of root knot nematode significantly.

SEQUENCE LISTING

< 110>Agricultural University Of South China

< 120>a kind of javanese root knot nematode effector Mj-nulg, GAP-associated protein GAP and application

<130>

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 1974

<212> DNA

< 213>artificial sequence

<400> 1

gagaacggtt aaaaataaag ggagagaaga aagagaaaaa aataaaaagt tggagaaaag 60

aaacgcgcag tcaaaataat aaaagaaaga gaaaaaatgt tattgtttaa tatatatttt 120

ttcaattttg ttttattaaa tgattgatat tacttaacaa aaatatcaag agagtaagaa 180

aacgcgtggc tactttaaac agattttttt tatcaaacaa ccgttttcat aaacaatttg 240

gcaaaaagga ggcgtcgtct caataaacac aaattttaag atgtataaaa gtgttcgagt 300

caaaacaagt aaatcattcc cagttttaat ttaattttta ataccacatt aaaaatataa 360

acaaaatgaa aacctcagtg ttgtgcctat ttttgattat ttctattatt tctatttatg 420

ccgatgataa agaagttgag aagcataaag ttgaggaaga gacaaaagaa aaacgtgatg 480

ataaagaact tactcataaa gttgaggatg agacaaaaga gaaacgtgat gataaagaaa 540

aacgtacaga aaagaccata acaggaaaga agcatgtcga agcagatgag ccaaaatccg 600

aaacttctgg tgctgatgaa cgtgaaaagc gtattacagc aaagaaacca acagagaaga 660

aacctgttga ggaagtttct gatgaaacaa ggtgagaaaa tatttttaaa aatttatatt 720

gagaaaacaa tattgatatt tgtggagata cttatgtata ttacccatat ttaaaaattc 780

tataaatgtt ctatagacat gatctagatt ttggaagata ttctgtgatt atgcacctgc 840

gatcatgtag gcgcataact tctctataac ccggaaataa ttttgtagtt tatctacttc 900

tttaaaaaca tcacaaaatt tttaaatgta aataaatcaa attttaacag agaaaaacgc 960

actactaaag aaaagaagcc tacaaaaccc gctgacgctg aagagtccgc agctgaagag 1020

agccgtgaaa agcgtactat cccaaaaaag gaaaagccaa aaaccgttga ggaagaatct 1080

aaagttgaag acgaaactcg cgagaagcgc ttgactggaa ccccaaagaa gacaaaacct 1140

gctgatgctg aggaagagac tcctaaggtt gaggaagaga cccgtgagaa gcgattggca 1200

acaacaaaaa aagaaaagat caagccagct gatgacgaat ccaaagtcga ggaagagact 1260

aaggaaaaga gaacaataaa gaaggaaaag acaaaaacag ctgatgtaag tatacagggg 1320

aggaatgttg taaaatggtt tttgagatca ggataggact agtttttttt tataaatatg 1380

agtggttggc attctaagtt tatagcttta ggttactttt tggtcatcta aactataaat 1440

ttatctacct cgatccataa tacttactag ggttatataa gaaagttatg tgagtatgtt 1500

aaagtaagga tcattgagtt gtttcaatcg tgaaaatcgc cagggaacga ggccaggatg 1560

cttactattt tcatattaag taaaataacc aatttatttt tcgggtcatc atattaaaat 1620

agagttcaat aatataaagt gagagtgtga ttttaaagtt gtaattcttt taagcaattt 1680

ttaaaattca aaactttcaa atatttttta gattgaagca gaagcagacg aacccagaga 1740

ggagcgtatg acaaagaaaa ctagcacagc agagaaaaag ccaattcata cccgcgcagc 1800

tcgtgcaaca aagactggaa ccaaaacaat agaatctaaa ggaaagggcc attaaatatc 1860

tgataaattt gtctattata tttagtatgt agatttaatt gaaagagaaa gagatgattc 1920

aatcttaaat attttttaat tctttcattt tttgacgatg aaaataaaag aagg 1974

<210> 2

<211> 1490

<212> DNA

< 213>artificial sequence

<400> 2

atgaaaacct cagtgttgtg cctatttttg attatttcta ttatttctat ttatgccgat 60

gataaagaag ttgagaagca taaagttgag gaagagacaa aagaaaaacg tgatgataaa 120

gaacttactc ataaagttga ggatgagaca aaagagaaac gtgatgataa agaaaaacgt 180

acagaaaaga ccataacagg aaagaagcat gtcgaagcag atgagccaaa atccgaaact 240

tctggtgctg atgaacgtga aaagcgtatt acagcaaaga aaccaacaga gaagaaacct 300

gttgaggaag tttctgatga aacaaggtga gaaaatattt ttaaaaattt atattgagaa 360

aacaatattg atatttgtgg agatacttat gtatattacc catatttaaa aattctataa 420

atgttctata gacatgatct agattttgga agatattctg tgattatgca cctgcgatca 480

tgtaggcgca taacttctct ataacccgga aataattttg tagtttatct acttctttaa 540

aaacatcaca aaatttttaa atgtaaataa atcaaatttt aacagagaaa aacgcactac 600

taaagaaaag aagcctacaa aacccgctga cgctgaagag tccgcagctg aagagagccg 660

tgaaaagcgt actatcccaa aaaaggaaaa gccaaaaacc gttgaggaag aatctaaagt 720

tgaagacgaa actcgcgaga agcgcttgac tggaacccca aagaagacaa aacctgctga 780

tgctgaggaa gagactccta aggttgagga agagacccgt gagaagcgat tggcaacaac 840

aaaaaaagaa aagatcaagc cagctgatga cgaatccaaa gtcgaggaag agactaagga 900

aaagagaaca ataaagaagg aaaagacaaa aacagctgat gtaagtatac aggggaggaa 960

tgttgtaaaa tggtttttga gatcaggata ggactagttt ttttttataa atatgagtgg 1020

ttggcattct aagtttatag ctttaggtta ctttttggtc atctaaacta taaatttatc 1080

tacctcgatc cataatactt actagggtta tataagaaag ttatgtgagt atgttaaagt 1140

aaggatcatt gagttgtttc aatcgtgaaa atcgccaggg aacgaggcca ggatgcttac 1200

tattttcata ttaagtaaaa taaccaattt atttttcggg tcatcatatt aaaatagagt 1260

tcaataatat aaagtgagag tgtgatttta aagttgtaat tcttttaagc aatttttaaa 1320

attcaaaact ttcaaatatt ttttagattg aagcagaagc agacgaaccc agagaggagc 1380

gtatgacaaa gaaaactagc acagcagaga aaaagccaat tcatacccgc gcagctcgtg 1440

caacaaagac tggaaccaaa acaatagaat ctaaaggaaa gggccattaa 1490

<210> 3

<211> 825

<212> DNA

< 213>artificial sequence

<400> 3

atgaaaacct cagtgttgtg cctatttttg attatttcta ttatttctat ttatgccgat 60

gataaagaag ttgagaagca taaagttgag gaagagacaa aagaaaaacg tgatgataaa 120

gaacttactc ataaagttga ggatgagaca aaagagaaac gtgatgataa agaaaaacgt 180

acagaaaaga ccataacagg aaagaagcat gtcgaagcag atgagccaaa atccgaaact 240

tctggtgctg atgaacgtga aaagcgtatt acagcaaaga aaccaacaga gaagaaacct 300

gttgaggaag tttctgatga aacaagagaa aaacgcacta ctaaagaaaa gaagcctaca 360

aaacccgctg acgctgaaga gtccgcagct gaagagagcc gtgaaaagcg tactatccca 420

aaaaaggaaa agccaaaaac cgttgaggaa gaatctaaag ttgaagacga aactcgcgag 480

aagcgcttga ctggaacccc aaagaagaca aaacctgctg atgctgagga agagactcct 540

aaggttgagg aagagacccg tgagaagcga ttggcaacaa caaaaaaaga aaagatcaag 600

ccagctgatg acgaatccaa agtcgaggaa gagactaagg aaaagagaac aataaagaag 660

gaaaagacaa aaacagctga tattgaagca gaagcagacg aacccagaga ggagcgtatg 720

acaaagaaaa ctagcacagc agagaaaaag ccaattcata cccgcgcagc tcgtgcaaca 780

aagactggaa ccaaaacaat agaatctaaa ggaaagggcc attaa 825

<210> 4

<211> 274

<212> PRT

< 213>artificial sequence

<400> 4

Met Lys Thr Ser Val Leu Cys Leu Phe Leu Ile Ile Ser Ile Ile Ser

1 5 10 15

Ile Tyr Ala Asp Asp Lys Glu Val Glu Lys His Lys Val Glu Glu Glu

20 25 30

Thr Lys Glu Lys Arg Asp Asp Lys Glu Leu Thr His Lys Val Glu Asp

35 40 45

Glu Thr Lys Glu Lys Arg Asp Asp Lys Glu Lys Arg Thr Glu Lys Thr

50 55 60

Ile Thr Gly Lys Lys His Val Glu Ala Asp Glu Pro Lys Ser Glu Thr

65 70 75 80

Ser Gly Ala Asp Glu Arg Glu Lys Arg Ile Thr Ala Lys Lys Pro Thr

85 90 95

Glu Lys Lys Pro Val Glu Glu Val Ser Asp Glu Thr Arg Glu Lys Arg

100 105 110

Thr Thr Lys Glu Lys Lys Pro Thr Lys Pro Ala Asp Ala Glu Glu Ser

115 120 125

Ala Ala Glu Glu Ser Arg Glu Lys Arg Thr Ile Pro Lys Lys Glu Lys

130 135 140

Pro Lys Thr Val Glu Glu Glu Ser Lys Val Glu Asp Glu Thr Arg Glu

145 150 155 160

Lys Arg Leu Thr Gly Thr Pro Lys Lys Thr Lys Pro Ala Asp Ala Glu

165 170 175

Glu Glu Thr Pro Lys Val Glu Glu Glu Thr Arg Glu Lys Arg Leu Ala

180 185 190

Thr Thr Lys Lys Glu Lys Ile Lys Pro Ala Asp Asp Glu Ser Lys Val

195 200 205

Glu Glu Glu Thr Lys Glu Lys Arg Thr Ile Lys Lys Glu Lys Thr Lys

210 215 220

Thr Ala Asp Ile Glu Ala Glu Ala Asp Glu Pro Arg Glu Glu Arg Met

225 230 235 240

Thr Lys Lys Thr Ser Thr Ala Glu Lys Lys Pro Ile His Thr Arg Ala

245 250 255

Ala Arg Ala Thr Lys Thr Gly Thr Lys Thr Ile Glu Ser Lys Gly Lys

260 265 270

Gly His

<210> 5

<211> 7

<212> PRT

< 213>artificial sequence

<400> 5

Asp Tyr Lys Asp Asp Asp Lys

1 5

<210> 6

<211> 8

<212> PRT

< 213>artificial sequence

<400> 6

Trp Ser His Pro Gln Phe Glu Lys

1 5

<210> 7

<211> 10

<212> PRT

< 213>artificial sequence

<400> 7

Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

<210> 8

<211> 323

<212> DNA

< 213>artificial sequence

<400> 8

aaaacctcag tgttgtgcct atttttgatt atttctatta tttctattta tgccgatgat 60

aaagaagttg agaagcataa agttgaggaa gagacaaaag aaaaacgtga tgataaagaa 120

cttactcata aagttgagga tgagacaaaa gagaaacgtg atgataaaga aaaacgtaca 180

gaaaagacca taacaggaaa gaagcatgtc gaagcagatg agccaaaatc cgaaacttct 240

ggtgctgatg aacgtgaaaa gcgtattaca gcaaagaaac caacagagaa gaaacctgtt 300

gaggaagttt ctgatgaaac aag 323

<210> 9

<211> 355

<212> DNA

< 213>artificial sequence

<400> 9

agaaaaacgc actactaaag aaaagaagcc tacaaaaccc gctgacgctg aagagtccgc 60

agctgaagag agccgtgaaa agcgtactat cccaaaaaag gaaaagccaa aaaccgttga 120

ggaagaatct aaagttgaag acgaaactcg cgagaagcgc ttgactggaa ccccaaagaa 180

gacaaaacct gctgatgctg aggaagagac tcctaaggtt gaggaagaga cccgtgagaa 240

gcgattggca acaacaaaaa aagaaaagat caagccagct gatgacgaat ccaaagtcga 300

ggaagagact aaggaaaaga gaacaataaa gaaggaaaag acaaaaacag ctgat 355

<210> 10

<211> 141

<212> DNA

< 213>artificial sequence

<400> 10

attgaagcag aagcagacga acccagagag gagcgtatga caaagaaaac tagcacagca 60

gagaaaaagc caattcatac ccgcgcagct cgtgcaacaa agactggaac caaaacaata 120

gaatctaaag gaaagggcca t 141

<210> 11

<211> 23

<212> DNA

< 213>artificial sequence

<400> 11

gttgaggaag agacccgtga gaa 23

<210> 12

<211> 23

<212> DNA

< 213>artificial sequence

<400> 12

cttttcacgt tcatcagcac cag 23

<210> 13

<211> 25

<212> DNA

< 213>artificial sequence

<400> 13

atgaaaacct cagtgttgtg cctat 25

<210> 14

<211> 26

<212> DNA

< 213>artificial sequence

<400> 14

ttaatggccc tttcctttag attcta 26

<210> 15

<211> 25

<212> DNA

< 213>artificial sequence

<400> 15

aaagaaaaac gtacagaaaa gacca 25

<210> 16

<211> 25

<212> DNA

< 213>artificial sequence

<400> 16

aacttcctca acaggtttct tctct 25

<210> 17

<211> 25

<212> DNA

< 213>artificial sequence

<400> 17

gacggtcaag ttattactgt ggaaa 25

<210> 18

<211> 25

<212> DNA

< 213>artificial sequence

<400> 18

gtaaaggtct ttacggatgt ctatg 25

<210> 19

<211> 38

<212> DNA

< 213>artificial sequence

<400> 19

cgcggatcca tggatgataa agaagttgag aagcataa 38

<210> 20

<211> 39

<212> DNA

< 213>artificial sequence

<400> 20

cgagctctta atggatgata aagaagttga gaagcataa 39

<210> 21

<211> 31

<212> DNA

< 213>artificial sequence

<400> 21

cgagctcgga aaacctcagt gttgtgccta t 31

<210> 22

<211> 35

<212> DNA

< 213>artificial sequence

<400> 22

ctagtctaga tttcatcaga aacttcctca acagg 35

Claims (10)

1. javanese root knot nematode effector Mj-nulg, it is characterized in that nucleotide sequence is shown in any one of SEQ ID NO:1 ~ 3.

2. a javanese root knot nematode effect protein MJ-NULG is characterized in that aminoacid sequence is shown in SEQ ID NO:4.

Under stringent condition with the said javanese root knot nematode effector of claim 1 Mj-nulgThe dna molecular of the parasitic GAP-associated protein GAP of hybridization and coding and javanese root knot nematode.

4. with the said javanese root knot nematode effector of claim 1 Mj-nulgDna molecular with 90% above homology and the parasitic GAP-associated protein GAP of coding javanese root knot nematode.

5. javanese root knot nematode effect protein MJ-NULG; It is characterized in that being connected with specific label at the N-terminal or the C-terminal of aminoacid sequence shown in the SEQ ID NO:4; Said specific label is 5 ~ 6 l-arginine, or 2 ~ 12 Histidines, or shown in SEQ ID NO:5 sequence; Or shown in SEQ ID NO:6 sequence, or shown in SEQ ID NO:7 sequence.

6. a recombinant expression vector is characterized in that inserting the said javanese root knot nematode effector of claim 1 by the MCS of the carrier that sets out Mj-nulg, or the part exon fragment of this gene forms like sequence construct shown in SEQ ID NO:8 ~ 10 are arbitrary.

7. a recombinant gene expression box is characterized in that containing the said javanese root knot nematode effector of claim 1 Mj-nulg

8. transgenic cell line is characterized in that containing the said javanese root knot nematode effector of claim 1 Mj-nulg

9. a reorganization bacterium is characterized in that containing the said javanese root knot nematode effector of claim 1 Mj-nulg

10. the said javanese root knot nematode effector of claim 1 Mj-nulgApplication in the preparation transgenic plant.

Images