CN115838742A - Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof - Google Patents
Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof Download PDFInfo
- Publication number
- CN115838742A CN115838742A CN202211271404.5A CN202211271404A CN115838742A CN 115838742 A CN115838742 A CN 115838742A CN 202211271404 A CN202211271404 A CN 202211271404A CN 115838742 A CN115838742 A CN 115838742A
- Authority
- CN
- China
- Prior art keywords
- nmad
- plant
- meloidogyne incognita
- gene
- demethylase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000243786 Meloidogyne incognita Species 0.000 title claims abstract description 43
- 101000615488 Homo sapiens Methyl-CpG-binding domain protein 2 Proteins 0.000 title claims abstract description 42
- 102100021299 Methyl-CpG-binding domain protein 2 Human genes 0.000 title abstract description 20
- 101150028074 2 gene Proteins 0.000 title description 3
- 101150091406 nmad-1 gene Proteins 0.000 title description 3
- 241000244206 Nematoda Species 0.000 claims abstract description 54
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 51
- 230000009261 transgenic effect Effects 0.000 claims abstract description 40
- 230000003071 parasitic effect Effects 0.000 claims abstract description 23
- 239000002773 nucleotide Substances 0.000 claims abstract description 6
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 6
- 239000013598 vector Substances 0.000 claims description 18
- 238000000034 method Methods 0.000 claims description 15
- 241000894006 Bacteria Species 0.000 claims description 11
- 238000010276 construction Methods 0.000 claims description 4
- 241000196324 Embryophyta Species 0.000 abstract description 52
- 235000002637 Nicotiana tabacum Nutrition 0.000 abstract description 36
- 241000208125 Nicotiana Species 0.000 abstract description 31
- 241000243785 Meloidogyne javanica Species 0.000 abstract description 6
- 238000009395 breeding Methods 0.000 abstract description 5
- 230000001488 breeding effect Effects 0.000 abstract description 5
- 238000010353 genetic engineering Methods 0.000 abstract description 4
- 230000008261 resistance mechanism Effects 0.000 abstract description 2
- 239000012636 effector Substances 0.000 description 14
- 230000006870 function Effects 0.000 description 8
- 102000004169 proteins and genes Human genes 0.000 description 8
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 7
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 6
- 244000061176 Nicotiana tabacum Species 0.000 description 5
- 102100027051 Nucleic acid dioxygenase ALKBH1 Human genes 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 5
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 229940088598 enzyme Drugs 0.000 description 4
- 238000000338 in vitro Methods 0.000 description 4
- 208000015181 infectious disease Diseases 0.000 description 4
- 102000007469 Actins Human genes 0.000 description 3
- 108010085238 Actins Proteins 0.000 description 3
- 241000589158 Agrobacterium Species 0.000 description 3
- 229910002547 FeII Inorganic materials 0.000 description 3
- 206010061217 Infestation Diseases 0.000 description 3
- 210000002421 cell wall Anatomy 0.000 description 3
- 230000017858 demethylation Effects 0.000 description 3
- 238000010520 demethylation reaction Methods 0.000 description 3
- 230000007246 mechanism Effects 0.000 description 3
- 230000009467 reduction Effects 0.000 description 3
- 239000002689 soil Substances 0.000 description 3
- 230000001131 transforming effect Effects 0.000 description 3
- 241000620209 Escherichia coli DH5[alpha] Species 0.000 description 2
- 108700039887 Essential Genes Proteins 0.000 description 2
- 108010005336 Histone H2a Dioxygenase AlkB Homolog 1 Proteins 0.000 description 2
- 101710095926 Nucleic acid dioxygenase ALKBH1 Proteins 0.000 description 2
- 230000002141 anti-parasite Effects 0.000 description 2
- 239000003096 antiparasitic agent Substances 0.000 description 2
- 230000003197 catalytic effect Effects 0.000 description 2
- 239000002299 complementary DNA Substances 0.000 description 2
- 230000000593 degrading effect Effects 0.000 description 2
- 230000029087 digestion Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 235000013601 eggs Nutrition 0.000 description 2
- 230000009368 gene silencing by RNA Effects 0.000 description 2
- 230000028993 immune response Effects 0.000 description 2
- 235000015097 nutrients Nutrition 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 239000013605 shuttle vector Substances 0.000 description 2
- 241000589155 Agrobacterium tumefaciens Species 0.000 description 1
- 102100040433 Alpha-ketoglutarate-dependent dioxygenase alkB homolog 6 Human genes 0.000 description 1
- 102100040429 Alpha-ketoglutarate-dependent dioxygenase alkB homolog 7, mitochondrial Human genes 0.000 description 1
- 101710104295 Beta-1,4-xylanase Proteins 0.000 description 1
- 108010059892 Cellulase Proteins 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 101000891530 Homo sapiens Alpha-ketoglutarate-dependent dioxygenase alkB homolog 6 Proteins 0.000 description 1
- 101000891540 Homo sapiens Alpha-ketoglutarate-dependent dioxygenase alkB homolog 7, mitochondrial Proteins 0.000 description 1
- 101000836620 Homo sapiens Nucleic acid dioxygenase ALKBH1 Proteins 0.000 description 1
- 206010020649 Hyperkeratosis Diseases 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 102000016397 Methyltransferase Human genes 0.000 description 1
- 108060004795 Methyltransferase Proteins 0.000 description 1
- 108090000417 Oxygenases Proteins 0.000 description 1
- 102000004020 Oxygenases Human genes 0.000 description 1
- 108010029182 Pectin lyase Proteins 0.000 description 1
- 241000425347 Phyla <beetle> Species 0.000 description 1
- 238000012228 RNA interference-mediated gene silencing Methods 0.000 description 1
- 108091030071 RNAI Proteins 0.000 description 1
- 108700019146 Transgenes Proteins 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000001679 anti-nematodal effect Effects 0.000 description 1
- 230000004888 barrier function Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 229940106157 cellulase Drugs 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 238000003501 co-culture Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 230000003828 downregulation Effects 0.000 description 1
- 230000002708 enhancing effect Effects 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000005286 illumination Methods 0.000 description 1
- 230000036039 immunity Effects 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 238000004949 mass spectrometry Methods 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 230000011987 methylation Effects 0.000 description 1
- 238000007069 methylation reaction Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000000149 penetrating effect Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000003259 recombinant expression Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000004576 sand Substances 0.000 description 1
- 230000003248 secreting effect Effects 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention belongs to the field of plant genetic engineering, and provides a demethylase gene of Meloidogyne incognita, which is Mi-NMAD-1 or Mi-NMAD-2, wherein the nucleotide sequence of Mi-NMAD-1 is shown in SEQ ID NO:1, and the nucleotide sequence of Mi-NMAD-2 is shown in SEQ ID NO:2, respectively. The gene obtained by the invention is a gene for coding demethylase found in root-knot nematodes for the first time, and the gene can be used for transgenic breeding to prevent and control plant parasitic nematodes. In addition, the invention improves the resistance of the plant to the nematode by constructing the transgenic tobacco, and simultaneously explains the resistance mechanism of the transgenic tobacco.
Description
Technical Field
The invention belongs to the field of plant genetic engineering, and particularly relates to two homologous Meloidogyne incognita demethylase related genes Mi-NMAD-1/2, in particular to application of two genes capable of enhancing plant resistance to plant parasitic nematodes through a plant genetic engineering technology.
Background
Nematodes can be present in almost all ecoenvironments and are among the largest phyla of the animal kingdom. Among them, plant parasitic nematodes are a group of pathogens distributed around the world with a wide host range, which cause an average crop yield decrease of 12% -23%, even in severe cases, the crop is extremely harvested, and economic losses of $ 800-1570 billion are caused to global agriculture every year.
The most remarkable difference between plant parasitic nematodes and other free-living nematodes is that a piercing-sucking hollow telescopic spear-shaped mouth needle, which is developed to adapt to parasitic life, is an important organ for penetrating the external barrier of plants, destroying cell walls, injecting effector and taking plant cell nutrients. Plant parasitic nematodes are successful in parasitizing plants in part because of the secreted effectors, which act synergistically to aid nematode infestation. Before entering the plant body, the nematodes can secrete a large number of enzymes, including cellulase, beta-1,4-xylanase, pectin lyase and the like, which are used for degrading plant cell walls and helping the nematodes to enter; after entering the plant body, the nematode first faces the immune response of the plant body, and the plant parasitic nematode secretes a series of effectors to inhibit the immune response of the plant body and help the nematode to parasitize. Because of the wide distribution and host range of root-knot nematodes and the difficulty in controlling them by secreting different effectors, resistance breeding of plants is considered to be an economical and effective control means. However, the resistance breeding time is long, the effect is not obvious, so researchers turn attention to construct transgenic plants to resist plant parasitic nematodes, for example, dsRNA is designed for essential genes of nematodes or effect and is expressed in plants, so that the plants finally control the nematodes through an RNAi mode, namely, resistant varieties are developed by utilizing plant genetic engineering.
Plant parasitic nematodes cause severe economic losses, resulting in reduced crop yield and reduced quality. At present, the control of plant parasitic nematodes is difficult, and some safe and effective control modes need to be found urgently. The dsRNA is designed by utilizing essential genes of the nematode, is expressed in a plant body so as to influence the normal growth and development of the nematode, improve the plant resistance, and simultaneously, the genes are excavated and cloned, so that the functions of the dsRNA in the nematode can be researched, and more gene resources can be provided for the cultivation of resistant transgenic crops.
Disclosure of Invention
The inventor discovers two nematode resistance related genes Mi-NMAD-1/2 through gene discovery, cloning and function analysis, wherein the genes are derived from Meloidogyne incognita, and discovers that the resistance of plants to Meloidogyne incognita is obviously increased by constructing transgenic tobacco expressing minmad-1/2 dsRNA.
Therefore, the first purpose of the invention is to provide two homologous meloidogyne incognita related genes Mi-NMAD-1/2, which code for demethylase.
Specifically, the purpose of the invention is realized according to the following technical scheme: the meloidogyne incognita demethylase gene is Mi-NMAD-1 or Mi-NMAD-2, and the nucleotide sequence of the Mi-NMAD-1 is shown in SEQ ID NO:1, and the nucleotide sequence of Mi-NMAD-2 is shown in SEQ ID NO:2, respectively.
Secondly, the second objective of the invention is to provide a recombinant vector, which comprises the above-mentioned Meloidogyne incognita demethylase gene. Meanwhile, the invention also provides an engineering bacterium, which comprises the recombinant vector.
Thirdly, different recombinant expression vectors are constructed by utilizing the gene Mi-NMAD-1/2, and further engineering bacteria can be prepared and applied to transgenic breeding to improve the resistance of plants to root-knot nematodes. Therefore, a third object of the present invention is to provide a series of uses, including the following aspects:
(1) The above-mentioned Meloidogyne incognita demethylase gene and homologous gene, recombinant vector or engineering bacterium in other Meloidogyne incognita can be used in resisting parasitic nematode or preparing product for resisting parasitic nematode.
(2) The application of the meloidogyne incognita demethylase gene in constructing a transgenic plant resistant to parasitic nematodes is to overexpress the meloidogyne incognita demethylase gene Mi-NMAD-1/2 in the plant.
(3) The recombinant vector is applied to constructing an anti-parasitic nematode transgenic plant, and the application is to overexpress the Meloidogyne incognita demethylase gene Mi-NMAD-1/2 in the plant by using the recombinant vector.
(4) The engineering bacteria are applied to constructing an anti-parasitic nematode transgenic plant, and the application is to overexpress the meloidogyne incognita demethylase gene Mi-NMAD-1/2 in the plant by using the engineering bacteria.
In a fourth aspect, the present invention provides a method for combating plant parasitic nematodes, the method comprising the steps of:
(1) The above-mentioned Meloidogyne incognita demethylase gene Mi-NMAD-1/2 is overexpressed in plants.
(2) The Meloidogyne incognita demethylase gene Mi-NMAD-1/2 is overexpressed in plants by using the recombinant vector described above.
(3) The Meloidogyne incognita demethylase gene Mi-NMAD-1/2 is overexpressed in plants by using the engineering bacteria.
Compared with the prior art, the gene Mi-NMAD-1/2 related to the Meloidogyne incognita demethylase provided by the invention has the following beneficial effects: the gene obtained by the invention is a gene for coding demethylase found in root-knot nematodes for the first time, and the gene can be used for transgenic breeding to prevent and control plant parasitic nematodes. In addition, the invention identifies the related gene of the root-knot nematode demethylase for the first time, verifies the function of the gene, improves the resistance of the plant to the nematode by constructing transgenic tobacco in a related way, and simultaneously expounds the resistance mechanism of the transgenic tobacco. Finally, the cloned resistance gene Mi-NMAD-1/2 can not only research the functions of the gene in nematode, but also provide more gene resources for the cultivation of transgenic crops.
Drawings
FIG. 1 finds Mi _06562.1, mi _43851.1, mi _37285.1 with 2OG _FeIIdomain of three copies of the same gene in Pfam notation, i.e., it is likely to be a potential demethylase.
FIG. 2 is the phylogenetic tree established by three homologous genes and the ALKBH family of human demethylase.
FIG. 3 is a graph showing the change in 6mA content in nematodes after the interference of three homologous genes by mass spectrometry.
FIG. 4 shows the expression of the target gene of transgenic tobacco expressing minmad-1/2 dsRNA.
FIG. 5 is the root knot situation of 40 days after the infection of the transgenic tobacco nematode for constructing and expressing the minmad-1/2dsRNA, wherein the left graph is the root knot situation of the minmad-1dsRNA transgenic tobacco, and the right graph is the root knot situation of the minmad-2dsRNA transgenic tobacco).
FIG. 6 shows the root node reduction of transgenic tobacco expressing minmad-1/2 dsRNA.
FIG. 7 shows that the tobacco expressing minmad-1/2dsRNA transgenes can resist nematode mechanism and can reduce the expression of effector gene.
Detailed Description
The present invention is further illustrated by the following detailed description, wherein the specific technical steps or conditions not indicated in the examples are conventional methods, and can be performed according to the general techniques or conditions described in the literature in the field or according to the product specification. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available. The tobacco variety used in this experiment was common tobacco (Nicotiana tabacum, nt).
Example 1: identification of Mi-NMAD-1/2 gene of Meloidogyne incognita
The 6mA methyltransferases of 3 Meloidogyne incognita are found by a homologous alignment method in the former people, but the corresponding demethylases are not found. We know that there are 2OG-FeII _ Oxy _2 domains in the demethylase structure of the species reported, which belong to the family of oxygenases and are the key structure in the demethylation process. Therefore, in order to identify demethylase (Mi-NMAD-1) in Meloidogyne incognita, we searched proteins homologous to the reported demethylase by means of low-threshold homology alignment, and screened potential demethylase genes with 2OG-FeII _ Oxy _2 domain in genome-wide manner by means of pfam domain scanning. In the blastp alignment, we constructed a database with the self-annotated Mi total protein and found that there were no homologous proteins in the alignment at evalue set-5 (default), which also agreed with the previous conclusions of studying 6mA methylation in Mi, when we changed evalue values, using a loose threshold, and finally found 12 homologous proteins at evalue =1, but only one of the genes Mi _14752.1 and two other copies thereof, with potential demethylase function. In addition, pfam scan also candidates Mi _45233.1 and Mi _00010.1 and the corresponding two homologous genes, respectively, have 2OG-FeII _ Oxy _2 domain, as in fig. 1. To further identify the presence of potential DNA 6mA demethylases in these proteins, the three homologous genes were found to belong to the ALKBH1, ALKBH6 and ALKBH7 families by establishing phylogenetic trees with the human demethylase ALKBH family, as shown in fig. 2. Meanwhile, the method for detecting the 6mA level in the nematode body after RNA interference on the target gene is adopted for verification, and the result shows that the 6mA level is obviously increased only after the genes Mi _14752.1 and Mi _00010.1 are interfered, which means that the two genes are possible to be potential 6mA demethylase. To further confirm that the two proteins have the function of in vitro catalytic demethylation, we used E.coli to heterologously express and purify the two proteins, and both the in vitro digestion experiment of the genomic DNA of Meloidogyne incognita and the in vitro digestion experiment of the synthesized oliga DNA containing 6mA modification by the purified proteins prove that the two genes have the function of in vitro catalytic demethylation, as shown in FIG. 3. Therefore, according to the newly discovered gene function, we named Mi _14752.1 and Mi _00010.1 as Mi-NMAD-1 and Mi-NMAD-2 genes, respectively, which are two DNA 6mA demethylases in Meloidogyne incognita.
Example 2: construction of Mi-NMAD-1/2dsRNA transgenic tobacco
We designed DNA fragment primers containing about 300bp of demethylase domain region, and respectively connected to pUCCRNAi vector in forward and reverse directions, and respectively select two enzyme cutting sites at upper arm and lower arm of intron. Designing upper and lower arm primers, taking the upper arm as an example, selecting xho I and bglII as upper arm enzyme cutting sites, respectively taking about 20bp of upstream and downstream genes, adding corresponding enzyme cutting sites and corresponding protection bases in front, and designing downstream primers in the same way. Taking cDNA of meloidogyne incognita as a template, amplifying upper and lower arms, connecting the cDNA to a pUCCRNAi vector, transforming to escherichia coli DH5 alpha, selecting a correct target band, sending a corresponding transformant to sequence, sequencing a correct plasmid, connecting to a shuttle vector pHW25, transforming to escherichia coli DH5 alpha, transforming the correct plasmid to agrobacterium EHA105 competence by a freeze-thaw method, and obtaining agrobacterium Mi-NMAD-1/EHA105 and agrobacterium Mi-NMAD-1/EHA105. Then, constructing transgenic tobacco by utilizing agrobacterium tumefaciens-mediated tobacco leaf disc method genetic transformation, finally obtaining 10 transgenic tobacco strains through the steps of co-culture, callus culture, adventitious bud differentiation, rooting culture and the like, detecting the expression quantity of different strain genes by using tobacco ACTIN as an internal reference gene and qRT-PCR (quantitative reverse transcription-polymerase chain reaction), and finding that the expression quantity of Mi-NMAD-1dsRNA transgenic tobacco 5# plant is the highest and can reach 34 times; the expression level of Mi-NMAD-2dsRNA transgenic tobacco 8# plant is the highest and can reach 256 times, as shown in figure 4.
Wherein, the Mi-NMAD-1 full-length primer for amplification is as follows:
Mi-NMAD-1clone R：ATGCTTCTTTTATACAGAAAT
Mi-NMAD-1clone F：TTATTCTGATTGTGGAATTATT
the full-length primer for amplifying the Mi-NMAD-2 comprises the following components:
Mi-NMAD-2clone R：ATGCAAAATAATAAAATTCAAAC
Mi-NMAD-2clone F：TCACTTGAAGTTCAATAAGCCT
wherein the upper arm primer of Mi-NMAD-1 connected to the pUCCRNAi vector is as follows:
Mi-NMAD-1up F:CCGCTCGAGCAAGAAATCGAACCTCATAT
Mi-NMAD-1up R:GAAGATCTAAGCCACATTCATGTAAATCT
wherein the lower arm primer of Mi-NMAD-1 connected to the pUCCRNAi vector is as follows:
Mi-NMAD-1down F:CGGGATCCAAGCCACATTCATGTAAATCT
Mi-NMAD-1down R:GCTCTAGACAAGAAATCGAACCTCATAT
wherein the upper arm primer of Mi-NMAD-2 connected to the pUCCRNAi vector is as follows:
Mi-NMAD-2up F:CGGAATTCGAGCTCGCCGATGTGGTTAGAAAATTGT
Mi-NMAD-2up R:CGGGATCCGAGCATGAGAGCCTAAAGTA
wherein the lower arm primer of Mi-NMAD-2 connected to pUCCRNAi vector is as follows:
Mi-NMAD-2down F:GAAGATCTGAGCATGAGAGCCTAAAGTA
Mi-NMAD-2down R：GGACTAGTGCCGATGTGGTTAGAAAATTGT
wherein the shuttle vector pHW25 universal primer is as follows:
pHW25-F:GGCTATCATTCAAGATGCCT
pHW25-R:CGTCATGCATTACATGTTAA
the primers for detecting the expression quantity of different strains by Mi-NMDA-1qRT-PCR are as follows:
qRT-Mi-NMDA-1F：GCTCTTCCTCCCATCGCATTCT
qRT-Mi-NMDA-1R：GCCAGACTTCATCTCGCAAGGT
the primers for detecting the expression quantity of different strains by Mi-NMDA-2qRT-PCR are as follows:
qRT-Mi-NMDA-2F：TCCTGGTGATTTAACCTTTCTTCC
qRT-Mi-NMDA-2R：CCGTCTGTGTGAGGCAAA
the tobacco ACTIN primers were:
Nt-ACTIN-F：CCTGAGGTCCTTTTCCAACCA
Nt-ACTIN-R：GGATTCCGGCAGCTTCCATT
example 3: mi-NMAD-1/2dsRNA transgenic tobacco nematode resistance detection
The resistance of transgenic tobacco to root-knot nematode is verified through pot culture experiments, 5 mi-nmad-1/2dsRNA transgenic tobacco plants with higher expression quantity are selected respectively, and pot culture experiments are carried out in a greenhouse in campus of university of agriculture in Huazhong, the temperature range is about 28 ℃, the relative humidity is 70%, and the illumination time is 14 hours. The soil is nutrient soil and the ratio of sand is 1:2, adding about 1kg of sterilized soil into a flowerpot with the volume of 14 multiplied by 16; selecting tobacco plants with consistent growth vigor and four true leaves, inoculating 800 larvae of Meloidogyne incognita J2 to the root of each plant, completely taking out the root of each plant after 21 days, and counting the root knot number of the root after cleaning with water. Pot culture results show that after the nematode is infected for 21 days, the root knot number of the mi-nmad-1/2 dsRNA-transferred transgenic tobacco is obviously lower than that of a control group, the root knot reduction rate of the mi-nmad-1 dsRNA-transferred transgenic tobacco can reach 76%, and the root knot reduction rate of the mi-nmad-2 dsRNA-transferred transgenic tobacco can reach 71%, as shown in figure 6; the control group had many large root knots, indicating that the nematode caused complex infection, while the mi-nmad-1/2 group had few large root knots and few small root knots, as shown in FIG. 5, indicating that transgenic tobacco plants expressing mi-nmad-1/2dsRNA could increase the resistance to nematodes.
Example 4: mi-NMAD-1/2dsRNA transgenic tobacco nematode-resistant mechanism
In the above results, we have found that mi-nmad-1/2dsRNA transgenic plants can significantly increase tobacco resistance to Meloidogyne incognita, however we do not know what the anti-nematode mechanism is. Since the most important weapon for nematode infestation of plants to complete life history is the effector secreted at each stage of infestation, there are a plurality of clearly studied effectors of Meloidogyne incognita, such as effector Mi-XYl1 associated with degrading plant cell walls, effector MiPFN3, mi8D05, 16D10 and MiIDL1 associated with promoting feeding site establishment, effector Mi-CRT and MiSGCR1 associated with inhibiting plant immunity, and the like. In order to study the expression of the efactors in nematodes with interfered demethylase, mi-nmad-1dsRNA transgenic tobacco is taken as an example, southern root knot nematodes are inoculated on roots of the mi-nmad-1dsRNA transgenic tobacco, eggs of the southern root knot nematodes infecting the mi-nmad-1dsRNA transgenic tobacco are collected after 40 days of infection, the eggs are broken by a grinder, RNA is extracted by a trizol method, ACTIN is taken as an internal reference gene, and qRT-PCR is carried out by designing primers to analyze the expression of each efactor. Wherein the primer of each effector is as follows: mi-XYl (F: CGTGTCGGAATTGTTGATTTATGT; R: TTGTGCTGTTAATGCTTCTTGTC) MiPFN3 (F: GGAACTGGCCATGTTTCAAAGGC; R: GTCCATTCGCTGCAGCATTTGC) Mi8D05 (F: TTCCACCACAACAGCCACCTT; R: GACTGCCAGCAAGACCTCCTC) 16D10 (F: GCCTTTAATGGTTACTTTAATGC; R: TCAATTATTTCCTCCAGGATTTGG) MiIDL1 (F: GCTTTTATCTGTCTCAATTGTGG; R: CGGCCGGGACCTGGAACTTT) Mi-CRT (F: GATGCTCGCTTCTATAGTATTTC; R: GAGGCCATGAGCTAAATTGATTC) MiSGCR1 (F: GGAATCGGTGGCTTTGGT; R: CTCCTCCGCATCCTCCATA) Mi-ACTIN (F: GTTATTCTTTCACCGCAACCG; R: GAATACCAGCAGATTCCATCCC)
To investigate the expression of these effector genes in nematodes with disturbed demethylase, the results showed that all studied effectors were downregulated to different extents in meloidogyne incognita, with maximal Mi-CRT downregulation of 126-fold. The results show that the transgenic tobacco expressing mi-nmad-1dsRNA can reduce the infection of nematodes by reducing the expression of effector genes of Meloidogyne incognita, thereby improving the resistance of plants to nematodes, as shown in FIG. 7.
Claims (10)
1. The meloidogyne incognita demethylase gene is Mi-NMAD-1 or Mi-NMAD-2, and the nucleotide sequence of the Mi-NMAD-1 is shown in SEQ ID NO:1, and the nucleotide sequence of Mi-NMAD-2 is shown in SEQ ID NO:2, respectively.
2. A recombinant vector comprising the Meloidogyne incognita demethylase gene according to claim 1.
3. An engineered bacterium comprising the recombinant vector according to claim 2.
4. Use of the meloidogyne incognita demethylase gene according to claim 1, or homologous genes from other meloidogyne incognita, the recombinant vector according to claim 2, or the engineered bacterium according to claim 3 for combating parasitic nematodes or for preparing products for combating parasitic nematodes.
5. Use of the meloidogyne incognita demethylase gene according to claim 1 in the construction of a transgenic plant resistant to parasitic nematodes by overexpressing in the plant the meloidogyne incognita demethylase gene according to claim 1.
6. Use of the recombinant vector of claim 2 in the construction of a transgenic plant resistant to parasitic nematodes by overexpressing in a plant said meloidogyne incognita demethylase gene in said plant using said recombinant vector.
7. The use of the engineered bacterium of claim 3 in the construction of transgenic plants resistant to parasitic nematodes by overexpressing the meloidogyne incognita demethylase gene in the plant using said engineered bacterium.
8. A method of combating plant parasitic nematodes, said method comprising overexpressing in a plant the meloidogyne incognita demethylase gene according to claim 1.
9. A method of combating plant parasitic nematodes, said method comprising: overexpressing in a plant the meloidogyne incognita demethylase gene of claim 1, by using the recombinant vector of claim 2.
10. A method of combating plant parasitic nematodes, the method comprising: overexpresses the meloidogyne incognita demethylase gene of claim 1 in a plant by using the engineered bacterium of claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211271404.5A CN115838742A (en) | 2022-10-18 | 2022-10-18 | Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211271404.5A CN115838742A (en) | 2022-10-18 | 2022-10-18 | Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115838742A true CN115838742A (en) | 2023-03-24 |
Family
ID=85576363
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211271404.5A Pending CN115838742A (en) | 2022-10-18 | 2022-10-18 | Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115838742A (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2480564A1 (en) * | 2002-03-27 | 2003-10-02 | University Of Tsukuba | Novel root-knot nematode-resistance gene and application thereof |
| CN104630246A (en) * | 2015-02-02 | 2015-05-20 | 江西农业大学 | Meloidogyne incognita acetylcholinesterase genes Miace1, Miace2 and Miace3 as well as related proteins and application of acetylcholinesterase genes |
| CN104651372A (en) * | 2014-12-16 | 2015-05-27 | 中国农业大学 | Application of MIF genes of Meloidogyn incognita in reducing pathogenicity of nematode to plants |
| CN105296492A (en) * | 2015-10-28 | 2016-02-03 | 华南农业大学 | Meloidogyne javanica effect gene Mj-1-1, related protein and application of effect gene Mj-1-1 |
| CN106497932A (en) * | 2015-09-08 | 2017-03-15 | 华中农业大学 | Preventing and treating Meloidogyne incognita related gene Misp12 and its application |
| KR20180045161A (en) * | 2016-10-25 | 2018-05-04 | 대한민국(농촌진흥청장) | Nematode resistance Cucurbitaceae plant as bottle gourd rootstock |
| CN113302303A (en) * | 2018-11-28 | 2021-08-24 | 诺维信公司 | Modified filamentous fungal host cells |
| WO2022121127A1 (en) * | 2020-12-11 | 2022-06-16 | 江苏省农业科学院 | Meloidogyne-related mirna, regulatory gene thereof, protein thereof and application thereof |
-
2022
- 2022-10-18 CN CN202211271404.5A patent/CN115838742A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2480564A1 (en) * | 2002-03-27 | 2003-10-02 | University Of Tsukuba | Novel root-knot nematode-resistance gene and application thereof |
| CN104651372A (en) * | 2014-12-16 | 2015-05-27 | 中国农业大学 | Application of MIF genes of Meloidogyn incognita in reducing pathogenicity of nematode to plants |
| CN104630246A (en) * | 2015-02-02 | 2015-05-20 | 江西农业大学 | Meloidogyne incognita acetylcholinesterase genes Miace1, Miace2 and Miace3 as well as related proteins and application of acetylcholinesterase genes |
| CN106497932A (en) * | 2015-09-08 | 2017-03-15 | 华中农业大学 | Preventing and treating Meloidogyne incognita related gene Misp12 and its application |
| CN105296492A (en) * | 2015-10-28 | 2016-02-03 | 华南农业大学 | Meloidogyne javanica effect gene Mj-1-1, related protein and application of effect gene Mj-1-1 |
| KR20180045161A (en) * | 2016-10-25 | 2018-05-04 | 대한민국(농촌진흥청장) | Nematode resistance Cucurbitaceae plant as bottle gourd rootstock |
| CN113302303A (en) * | 2018-11-28 | 2021-08-24 | 诺维信公司 | Modified filamentous fungal host cells |
| WO2022121127A1 (en) * | 2020-12-11 | 2022-06-16 | 江苏省农业科学院 | Meloidogyne-related mirna, regulatory gene thereof, protein thereof and application thereof |
Non-Patent Citations (6)
| Title |
|---|
| LORIS PRATX等: "Genome-wide expert annotation of the epigenetic machinery of the plant-parasitic nematodes Meloidogyne spp., with a focus on the asexually reproducing species", BMC GENOMICS, vol. 19, 3 May 2018 (2018-05-03), pages 1 - 21 * |
| MACARIO OSORIO-CONCEPCIÓN: "DNA Methylation on N6-Adenine Regulates the Hyphal Development during Dimorphism in the Early-Diverging Fungus Mucor lusitanicus", J FUNGI (BASEL), vol. 7, no. 9, 30 September 2021 (2021-09-30), pages 1 - 16 * |
| MARY ANN D. MAQUILAN等: "Genetic analyses of resistance to the peach root-knot nematode (Meloidogyne floridensis) using microsatellite markers", TREE GENETICS & GENOMES, vol. 14, 3 June 2018 (2018-06-03), pages 1 - 10 * |
| SIMON YUAN WANG等: "The demethylase NMAD-1 regulates DNA replication and repair in the Caenorhabditis elegans germline", PLOS GENET, vol. 15, no. 7, 8 July 2019 (2019-07-08), pages 1008252 * |
| 张晓娟: "秀丽隐杆线虫的组蛋白去甲基化酶同源物参与DNA损伤反应", 天津大学 医药卫生科技, 1 May 2021 (2021-05-01), pages 1 - 61 * |
| 许园园等: "晶胞粘连苏云金芽胞杆菌C15杀线虫毒力因子发掘与功能鉴定", 生物资源, vol. 41, no. 4, 30 July 2019 (2019-07-30), pages 314 - 323 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012245135A1 (en) | Plants resistant to insect pests | |
| AU2012286177A1 (en) | Plants resistant to insect pests | |
| CN111424022B (en) | Verticillium dahliae VdEG target gene fragment for pathogen-resistant bacteria, interference vector and application thereof | |
| CN114621967B (en) | Wheat receptor protein kinase gene TaLEMK1.1 and application thereof | |
| Fan et al. | Resistance to Ditylenchus destructor infection in sweet potato by the expression of small interfering RNAs targeting unc-15, a movement-related gene | |
| CN113528518B (en) | MiRNA for inhibiting sclerotinia sclerotiorum and application thereof | |
| CN107586782A (en) | It is a kind of by disturbing verticillium wilt pathogen VdRGS1 gene expressions to significantly improve method of the cotton to resistance to verticillium wilt | |
| CN102943091B (en) | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique | |
| CN113337520A (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| Xie et al. | Characterization of VdASP F2 secretory factor from Verticillium dahliae by a fast and easy gene knockout system | |
| CN108588041B (en) | Gossypium barbadense cytochrome P450 gene, and coding protein and application thereof | |
| CN112501172B (en) | Root knot nematode related miRNA and regulatory gene, protein and application thereof | |
| CN107056908B (en) | Soybean salt-tolerant gene GmCHS5 and application thereof | |
| CN102653763A (en) | Meloidogyne javanica dominant-effect gene (Mj-nulg), related protein and application of Mj-nulg | |
| CN110564740B (en) | A gene AtPIP2 for improving disease resistance of plants; 7 and uses thereof | |
| CN106554964B (en) | Application of cotton GbABR1 gene in verticillium wilt resistance | |
| AU2017310264A1 (en) | Metabolite production in endophytes | |
| CN116694652A (en) | Verticillium dahliae VdNRPS4 gene antipathogenic target gene fragment, interference vector and application | |
| CN105524150A (en) | Functional analysis and application of verticillium dahliae pathogenicity-related gene VdGFP | |
| CN115838742A (en) | Meloidogyne incognita demethylase Mi-NMAD-1/2 gene and application thereof | |
| CN104630246B (en) | Meloidogyne incognita acetylcholinesterasegene gene Miace1, Miace2 and Miace3, GAP-associated protein GAP and its application | |
| Ewald et al. | Transgenic forest trees in China | |
| CN104046633B (en) | Resistance Strain of Cotton nematode gene GhNtR1 and application thereof | |
| CN111704659A (en) | Root-knot nematode RALF protein, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |